ID: 1151325971

View in Genome Browser
Species Human (GRCh38)
Location 17:73379945-73379967
Sequence CTGTGTAAAGAGTTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 212}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151325971_1151325982 1 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325982 17:73379969-73379991 GGGGCTCAGCTCCAGGGGGGAGG 0: 1
1: 0
2: 1
3: 46
4: 465
1151325971_1151325984 3 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325984 17:73379971-73379993 GGCTCAGCTCCAGGGGGGAGGGG 0: 1
1: 0
2: 6
3: 51
4: 474
1151325971_1151325985 11 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325985 17:73379979-73380001 TCCAGGGGGGAGGGGCGCATTGG 0: 1
1: 0
2: 1
3: 13
4: 210
1151325971_1151325987 24 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325987 17:73379992-73380014 GGCGCATTGGATGTGAATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1151325971_1151325979 -4 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325979 17:73379964-73379986 ACAGCGGGGCTCAGCTCCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1151325971_1151325977 -6 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325977 17:73379962-73379984 ACACAGCGGGGCTCAGCTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 204
1151325971_1151325980 -3 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325980 17:73379965-73379987 CAGCGGGGCTCAGCTCCAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 246
1151325971_1151325978 -5 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325978 17:73379963-73379985 CACAGCGGGGCTCAGCTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 264
1151325971_1151325983 2 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325983 17:73379970-73379992 GGGCTCAGCTCCAGGGGGGAGGG 0: 1
1: 0
2: 5
3: 44
4: 444
1151325971_1151325981 -2 Left 1151325971 17:73379945-73379967 CCATCCACCAACTCTTTACACAG 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1151325981 17:73379966-73379988 AGCGGGGCTCAGCTCCAGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151325971 Original CRISPR CTGTGTAAAGAGTTGGTGGA TGG (reversed) Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
906315822 1:44785907-44785929 CTATGTCAAGAGTTGCTGTAAGG + Intronic
906674587 1:47684034-47684056 GTGTGCAAACAGTGGGTGGATGG + Intergenic
907389445 1:54148109-54148131 CTGAGTAAAAAGTTGATGAAAGG + Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
911256763 1:95642005-95642027 TTGTGGAAAGTGTTGGTGGAAGG + Intergenic
912790950 1:112650135-112650157 CTTTGTAAAGAGTTGGATAATGG + Intronic
913487794 1:119349330-119349352 CAGTGTCAAGATTTGGTGAAAGG - Intergenic
915234405 1:154469974-154469996 CTGTGTAAACAGTTCAGGGATGG + Intronic
917140650 1:171832160-171832182 ATGTGAAAATAGTTTGTGGATGG + Intergenic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
918074426 1:181159633-181159655 CTGTGTGATGAGTTGGTGCCAGG + Intergenic
918326067 1:183411907-183411929 TTGAGTAAAGAATTGGAGGAGGG + Intronic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921539731 1:216398997-216399019 CTTAGTAAAGAGTTGGAGCATGG - Intronic
921671202 1:217925581-217925603 TTATGTAATGAATTGGTGGATGG - Intergenic
1063881438 10:10536671-10536693 CTGTGAAAAGAGTTTGATGAGGG + Intergenic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1070495769 10:77020617-77020639 CCATGTGAAGAGTTGGCGGAGGG - Intronic
1071103899 10:82071737-82071759 CTGTGTCAAGAATTGGCTGAAGG + Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072763737 10:98079645-98079667 GTGTGTATAGAGTTGGGGGCGGG + Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074271246 10:111955954-111955976 CTCTGTAGAGAGTAGGAGGAAGG - Intergenic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1077347743 11:2071914-2071936 CTGTGTGGAGAGTGGTTGGAAGG - Intergenic
1078864447 11:15283689-15283711 CTATGTAAATAGTTGTTGTATGG + Intergenic
1081209797 11:40318714-40318736 TTCTGTAAAGAGCAGGTGGAGGG - Intronic
1083880533 11:65546348-65546370 GTCTGTAAACAGTGGGTGGAAGG - Intronic
1087927044 11:103930651-103930673 CAGTGTAAAGATTTGAAGGAGGG + Intronic
1089656757 11:119952983-119953005 CTGTATGAAGAGTTGGTCCATGG - Intergenic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1090265302 11:125349683-125349705 CTCTGCACAGAGTTGGTGGTTGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1092675707 12:10916571-10916593 CTATGAAAAGAGTTGGTGGAAGG + Intronic
1093457866 12:19382370-19382392 CTGGCAACAGAGTTGGTGGAGGG - Intergenic
1095114959 12:38342460-38342482 TTTTATAAAGAGTTGGTGGTTGG + Intergenic
1096924665 12:55130261-55130283 CTGTGTACTCAGTTGGTGGCTGG + Exonic
1097197080 12:57248928-57248950 CTGTGGCTAGAGTTGGTGTAAGG - Intronic
1098751355 12:74297040-74297062 TTTTGTAAAGAGTTGCTGGAGGG - Intergenic
1098984497 12:76997115-76997137 CTGTGTCAAAATGTGGTGGAAGG - Intergenic
1101415379 12:104504158-104504180 CTGTGGGGAGAGTTGGTGGCTGG + Intronic
1104712242 12:130995135-130995157 CTGTGGGAAGAGTTGGTGGTGGG + Intronic
1105964326 13:25371615-25371637 CTGTGTAGGGACTTCGTGGAAGG - Intergenic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1108232351 13:48360465-48360487 CTCAGTAAAGTGTTGGGGGAGGG + Intronic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1111713158 13:91843684-91843706 CTGTATGAAGAGTAGGTGGCTGG + Intronic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1115488455 14:33935934-33935956 ATGTGTAAAGAGTTGGGGGCTGG + Intronic
1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG + Intergenic
1120854144 14:89198226-89198248 CTATGTAAATAGTTGTTAGATGG - Intronic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1121955620 14:98210163-98210185 GTGTTTAAACAGTTGCTGGAAGG + Intergenic
1122114837 14:99522460-99522482 CTTTGTAAACATTTGTTGGATGG + Intronic
1124094495 15:26636504-26636526 TGGTGGAAAGAGTGGGTGGATGG - Intronic
1131677271 15:94683314-94683336 CTCTGTAAAAAGGGGGTGGATGG - Intergenic
1131698418 15:94905522-94905544 CTGTGGAAAGGATCGGTGGACGG + Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1134024925 16:10946250-10946272 CTGTGGAAAGGATTGGTGGGAGG + Intronic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1141594974 16:85091831-85091853 CACTGTAAAGAGTTTGTGAAAGG + Exonic
1142914570 17:3125739-3125761 TGGTGTACAGAGTTGATGGAAGG + Intergenic
1145078634 17:19876147-19876169 GAGAGTAAAGAGTTGGTGGCCGG + Intergenic
1146468491 17:33106043-33106065 CTGAGTGAAGAGTTGATGCAGGG + Intronic
1146643183 17:34556455-34556477 CTGGGTGAAGAGTTAGTGGTAGG - Intergenic
1148412271 17:47477859-47477881 CTGTGTCATCAGTGGGTGGAAGG + Intergenic
1148752295 17:49952190-49952212 CTGAGCAAAGAGTCTGTGGATGG - Intergenic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1152884513 17:82841720-82841742 TTGTGTCAGGAGTTTGTGGAGGG + Intronic
1153944670 18:10008442-10008464 TGGTGGAAAGAGTGGGTGGATGG - Intergenic
1156170767 18:34482343-34482365 CTGTGTCAAAATATGGTGGAAGG - Intergenic
1158074146 18:53509127-53509149 CTTTGCAGAGAGTTGGTGCAGGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1161668753 19:5592511-5592533 CTATGAAAAGAGTCGGTGGATGG + Intronic
1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG + Intergenic
1165192555 19:34077449-34077471 GTGTGCAAATTGTTGGTGGATGG + Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166745899 19:45141745-45141767 CTGTGTGAAGGCTGGGTGGAGGG + Intronic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933601346 2:84334555-84334577 CAGGGGAAAGAGTTGGTGGGGGG + Intergenic
936600053 2:113887175-113887197 CTGTGTCAAAACATGGTGGAAGG + Intergenic
936714827 2:115173932-115173954 CTAGGTTAAGAGTTGGTAGAAGG + Intronic
936816315 2:116465188-116465210 CTGTGTAGAGAGTCCATGGAGGG + Intergenic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
942737840 2:179136329-179136351 CTCCATAAAGAGTTAGTGGACGG - Intronic
942910707 2:181241021-181241043 CAGTGTATAGTGTTGCTGGAGGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
945272208 2:207952351-207952373 CTGTGTAAAATGTTGCTTGAAGG + Intronic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946912448 2:224477767-224477789 CTGGGTAAAGTATTGGTAGAGGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
1169963267 20:11186972-11186994 ATTTTTAAAGAGTTGGAGGAAGG - Intergenic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1171002774 20:21431299-21431321 CTTTTAAAAGAGTTGGTGGCCGG - Intergenic
1172958695 20:38781620-38781642 CTCGGTGAAGAGTTGATGGAAGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175561959 20:59938786-59938808 TTGTGTAATGAGTTGGGGCAGGG - Exonic
1181595262 22:23910315-23910337 TTGGGTGAAGAGTTGGAGGAGGG - Intergenic
1182956572 22:34432305-34432327 CTGCCAAAAGAGTGGGTGGATGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
952476539 3:33717062-33717084 CTTTCTGAAGAGTTGGTGGTAGG - Intronic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
955452102 3:59079430-59079452 CTGTGGAAATATTTAGTGGATGG + Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
956187552 3:66576877-66576899 CTCAGAAAAGAGTGGGTGGAAGG + Intergenic
956890324 3:73607018-73607040 GTGTGGAAAGAGTTGAGGGATGG - Intronic
959073498 3:101725488-101725510 TTGGGGGAAGAGTTGGTGGATGG + Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
961302000 3:125928161-125928183 CTTTGTGAAGAGTGGGTTGACGG + Intergenic
961774514 3:129274740-129274762 CTGTGGAAAGAGTTGCAGGAAGG + Intronic
961886470 3:130099664-130099686 CTTTGTGAAGAGTGGGTTGATGG - Intronic
964894170 3:161574804-161574826 CTGTGTAACCAGTTTTTGGAGGG + Intergenic
965309691 3:167113733-167113755 CTTGGAAAAGAGTTTGTGGAGGG - Intergenic
966415806 3:179688233-179688255 CTGAGTAAATATTTGTTGGATGG - Intronic
967404578 3:189101144-189101166 CTGTGAAAAGAGTTGGAAGGGGG - Intronic
969998182 4:11336519-11336541 CTGTGGATAGAATTGGGGGAGGG - Intergenic
970111708 4:12645038-12645060 CTGTGTCAAAACATGGTGGAAGG + Intergenic
972406854 4:38754628-38754650 GTGTGTAGAGAGTGTGTGGAGGG - Intergenic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
975155996 4:71073753-71073775 CTGTATAAATACTTGATGGATGG + Intergenic
976826952 4:89271537-89271559 CTATGTAAAGAGTTGTTATATGG + Intronic
977719565 4:100223900-100223922 CTGTGTCAAGAGTGGCTGGTTGG + Intergenic
983222331 4:165054931-165054953 TTGTGTATAGAGTTGGGGGTGGG + Intergenic
985198993 4:187464547-187464569 CTGAGTCAAAAGTTGGTGAAGGG - Intergenic
985662993 5:1166578-1166600 CTATCTGAAGAGTGGGTGGATGG - Intergenic
986564166 5:9094154-9094176 GTGTGTAAAGAATTGGTGCAAGG - Intronic
987811763 5:22845848-22845870 CTGTGTAATGAGTTGGGGTCGGG + Intronic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990155033 5:52867305-52867327 CTCTGTAGAGAGTGAGTGGAAGG + Intronic
990269387 5:54119118-54119140 CTGTGCAAAGAGCCGTTGGAAGG - Intronic
995360141 5:111287635-111287657 CTTTAAAAAGTGTTGGTGGAAGG + Intronic
995779897 5:115763690-115763712 CTTTGTAAAGACTTGTTGAATGG - Intergenic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
997410774 5:133689132-133689154 CTGTGGAGAGACTGGGTGGAGGG - Intergenic
997706964 5:135964774-135964796 CTTTGTAAAGGGTTGTTGGCTGG + Intergenic
998201074 5:140121867-140121889 CTGTTTAATGTGTTTGTGGATGG + Exonic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000284534 5:159815719-159815741 CTGTGTCATCACTTGGTGGAAGG - Intergenic
1000514799 5:162226726-162226748 CCCAGTAAAGAGTTGGGGGATGG + Intergenic
1000717385 5:164662721-164662743 CTGTGTAAACATTTGATGTACGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1002493947 5:179599327-179599349 CTGTGTGGAGAGTGGGTGGTAGG + Intronic
1002663673 5:180807615-180807637 CTGATTAAAGAGGGGGTGGAAGG - Intronic
1003335705 6:5170084-5170106 CAGTGTACAGTGTTGGTTGAAGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1006988952 6:38196702-38196724 TTGTCTAATGAGTTTGTGGAAGG - Intronic
1008081209 6:47196129-47196151 GTGGCTAAAGAGTGGGTGGAAGG - Intergenic
1008264421 6:49406827-49406849 ATGTGTCAAGAGTTGAAGGATGG + Intergenic
1009802757 6:68562355-68562377 TTGTGTAAAGAGGTGGTTGTGGG + Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010618644 6:78045669-78045691 CTTTGTAAAGACTTGTTGAATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014144702 6:117984024-117984046 CTGTTTAAACTGTTGTTGGAGGG - Intronic
1015245168 6:131066503-131066525 CTGTATAAAGAGTTGCTTGAGGG - Intergenic
1018140578 6:160829928-160829950 CTGTGTGAAGAGTTAGAGGTAGG + Intergenic
1020353069 7:7245027-7245049 CTGTTTAAAGAGTTTCTGAAAGG + Exonic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1023107683 7:36778763-36778785 ATGTGTACAGTGTTGGTGTAGGG + Intergenic
1024521644 7:50309527-50309549 CTGTGTAAAGTGTTTTTGAATGG + Intronic
1029673044 7:102047223-102047245 CTCTGTTAAGTGATGGTGGATGG + Intronic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1032642339 7:133783624-133783646 CTGTGTGGAGAGTTAGTGTATGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034237307 7:149582414-149582436 CTGTTTATAGAGTAGCTGGAGGG - Intergenic
1034240329 7:149605850-149605872 CTGTTTACAGAGTAGCTGGAGGG - Intergenic
1034243915 7:149630296-149630318 CTGTTTATAGAGTAGCTGGAGGG - Intergenic
1037586722 8:20281903-20281925 GAGAGAAAAGAGTTGGTGGAAGG + Intronic
1038155433 8:24985052-24985074 TTGTGTTAAGCCTTGGTGGAAGG + Intergenic
1039449371 8:37659420-37659442 CTGTGGTAAGATTTGGTGGCTGG - Intergenic
1040703626 8:50098433-50098455 CTATGTAAATAGTTGTTAGATGG - Intronic
1041327874 8:56688496-56688518 CTGTGTAAACAGTTGGTTATGGG + Intergenic
1041431223 8:57782775-57782797 CCTTGTAAAGAGTTGCTGAATGG - Intergenic
1042170550 8:65986674-65986696 CTATGTGGAGAGTTGATGGAGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043855653 8:85262232-85262254 CTGTGTAAAGATTAGGAGCATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1047078165 8:121428536-121428558 CTTTGTAAAGAATTTGTGAACGG + Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050796165 9:9545572-9545594 CTGTGTACAGAGTTTTTGCATGG + Intronic
1051634460 9:19169148-19169170 GTGTGTTATGAGCTGGTGGAAGG - Intergenic
1054879065 9:70126113-70126135 CAGTGTTAAGAGTTGGGGGTGGG - Intronic
1055700155 9:78935749-78935771 AAGTGAACAGAGTTGGTGGATGG + Intergenic
1059889555 9:118786215-118786237 CTGAGAAAAGAGTGTGTGGAGGG - Intergenic
1060231091 9:121826007-121826029 GTGTGGAAAGAGATGATGGAGGG + Intronic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1186101301 X:6159570-6159592 CTGTGTAATATGTGGGTGGATGG - Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187425544 X:19174646-19174668 TTCTGTCAAGAGTTGGTTGAGGG + Intergenic
1190713492 X:53085590-53085612 CTGAGTATAGGGTTGGTGGGAGG - Intronic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1192442523 X:71185230-71185252 CTGTTGAAAGAGTAGATGGAAGG - Intergenic
1192689605 X:73348599-73348621 CTTTCTAAAGACTTGTTGGATGG + Intergenic
1193031343 X:76901513-76901535 CTTTGTATAGAGTTGGATGAAGG + Intergenic
1193065063 X:77250624-77250646 CTGAGTACAGTGTTAGTGGAGGG - Intergenic
1194076638 X:89402173-89402195 CTGTATTAAAAGTTGGTGAAGGG - Intergenic
1197741095 X:129894647-129894669 CAGTATAAAGAATGGGTGGAGGG + Intergenic
1198816545 X:140597845-140597867 CTGTTTGAAGATTTGGTGGTGGG - Intergenic
1199731055 X:150632551-150632573 GTGTGTGCAGAGTAGGTGGAGGG + Intronic
1200429280 Y:3057696-3057718 CTGTATTAAAAGTTGGTGAAGGG - Intergenic
1202141308 Y:21726301-21726323 ATGTGTAAAGAGTTGTTAAAGGG - Intergenic
1202145557 Y:21777501-21777523 ATGTGTAAAGAGTTGTTAAAGGG + Intergenic