ID: 1151327812

View in Genome Browser
Species Human (GRCh38)
Location 17:73389706-73389728
Sequence CTGTGAGTGGGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1925
Summary {0: 1, 1: 2, 2: 6, 3: 193, 4: 1723}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151327797_1151327812 14 Left 1151327797 17:73389669-73389691 CCTGATCCTGCGCCCATCTGTGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723
1151327800_1151327812 2 Left 1151327800 17:73389681-73389703 CCCATCTGTGTTGACAAGGCCAG 0: 1
1: 0
2: 2
3: 12
4: 149
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723
1151327801_1151327812 1 Left 1151327801 17:73389682-73389704 CCATCTGTGTTGACAAGGCCAGG 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723
1151327796_1151327812 15 Left 1151327796 17:73389668-73389690 CCCTGATCCTGCGCCCATCTGTG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723
1151327798_1151327812 8 Left 1151327798 17:73389675-73389697 CCTGCGCCCATCTGTGTTGACAA 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723
1151327795_1151327812 26 Left 1151327795 17:73389657-73389679 CCAGGCTGCAGCCCTGATCCTGC 0: 1
1: 1
2: 10
3: 64
4: 543
Right 1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG 0: 1
1: 2
2: 6
3: 193
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151327812 Original CRISPR CTGTGAGTGGGGAGGGGAGA GGG Intronic
900015081 1:142777-142799 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900016684 1:155599-155621 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900045348 1:501386-501408 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900046945 1:514191-514213 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900067545 1:743116-743138 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900069148 1:755909-755931 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900188912 1:1345188-1345210 CTGTGAGGGGGCAGGGGGCAGGG - Intronic
900269266 1:1778725-1778747 AGGTGAGTGGGGACGGGAGCCGG - Intronic
900284637 1:1893273-1893295 TTGATAGTGGGGAGGGGAGGAGG - Intergenic
900319655 1:2076272-2076294 ATGTGAGGGAGGTGGGGAGATGG - Intronic
900341484 1:2191379-2191401 CTGCGTGTGGGCAGGGGAGCAGG + Intronic
900387476 1:2417144-2417166 CTGGGATTGGGGAGGGGTGCTGG + Intergenic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900658538 1:3772084-3772106 GTGTGGGTGGGGAGCAGAGAAGG - Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901210466 1:7522095-7522117 CCGTTAGTGGGGATGTGAGATGG - Intronic
901262149 1:7880406-7880428 CGGGGAGTGGGGTGGGGAGGGGG + Intergenic
901301085 1:8200527-8200549 CGGGGAGTGGGGAGGAGAAAGGG + Intergenic
901436532 1:9250368-9250390 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901436569 1:9250482-9250504 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901640556 1:10690989-10691011 CGGGAAGGGGGGAGGGGAGATGG - Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
902263714 1:15246785-15246807 CTGGGAGTGGGGTGGGGATTGGG - Intergenic
902536274 1:17120684-17120706 ATGTGAGTGGGGAAGAGGGAAGG + Intergenic
902578588 1:17394185-17394207 CTCTGAGGGGGGAGGGGACGTGG + Intronic
902985744 1:20153091-20153113 CTGTGAGTGTGAGGGGGAAAGGG + Intergenic
903193552 1:21669397-21669419 CAGTGAGTGGGGAGCGGCGCCGG - Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903756127 1:25662268-25662290 CTGAGAGTGGAGGAGGGAGATGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
903949437 1:26987065-26987087 CTGAGAGTGGGGTGGGGAAGGGG - Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904032710 1:27543189-27543211 GAGGGAGTAGGGAGGGGAGAGGG + Intronic
904175417 1:28624944-28624966 ATGTTTGTGGGTAGGGGAGAAGG - Intronic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904244959 1:29181403-29181425 CCCTGAGTGGGACGGGGAGAAGG - Intronic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
904400711 1:30254691-30254713 CTGTCAATGGTGTGGGGAGAAGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904476040 1:30765209-30765231 CTGTGAGTGGGGCTGGGATCTGG - Intergenic
904601061 1:31672846-31672868 CAGGGAGTGGGGAGAGGAGTGGG + Intronic
904698849 1:32346336-32346358 GTGGGAGTGGGGAGGTGGGAGGG + Intergenic
904770094 1:32876263-32876285 CGGGGAGGGGGGAAGGGAGAAGG + Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905368950 1:37472537-37472559 CTGTGCCTGGGGAGCAGAGAAGG + Intergenic
905653830 1:39673115-39673137 CTCTGACTGGGGAGGTGAGGGGG + Intergenic
905790764 1:40788040-40788062 GTGGGAATGGGGAGGGGAGGAGG + Intronic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
906015139 1:42569970-42569992 CTGTCAGTGGGTGGGGGACAAGG + Intronic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906078315 1:43068133-43068155 CTGCGACTGGGGAAGGGAGCAGG + Intergenic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906275896 1:44515238-44515260 ATGTCACTGGGGACGGGAGAAGG + Intronic
906479926 1:46193216-46193238 CTGGGAGTGGGGTGGGAATAGGG + Intronic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906647539 1:47486502-47486524 GTGTGAGTGAGGAGGAGGGAGGG + Intergenic
906678056 1:47707847-47707869 ATGTGAGTGGGGTGGGGACGGGG + Intergenic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906982761 1:50649099-50649121 TTAAGAGTGGGGTGGGGAGAGGG + Intronic
907267080 1:53269011-53269033 CTCTGAGTAGGGAAGGGACATGG - Intronic
907276914 1:53321786-53321808 CTGTGCCTGGGGAGGAGAGGAGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
907530933 1:55096029-55096051 CTGGGAGTGGGGATTGTAGAGGG + Intronic
907679683 1:56551534-56551556 CTTTGAGTGGGGAGGGGAGGAGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908366107 1:63425290-63425312 CTGTCATTGGGAAAGGGAGATGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
909099936 1:71337525-71337547 AAGAGAGAGGGGAGGGGAGAGGG - Intergenic
909384929 1:75043552-75043574 CTGTCAGGGGGTAGGGGACAAGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909564406 1:77038895-77038917 CTGGGGGTGGGCAGGGGTGATGG + Intronic
909706950 1:78596849-78596871 CTGTGATTGGTGAGTGGTGATGG + Intergenic
910337997 1:86155647-86155669 CGGGGACTGGGGAGGGGAGCAGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911311109 1:96293091-96293113 GTGTGTGTGGGCAGTGGAGAGGG + Intergenic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
912411523 1:109483781-109483803 CTGTGAGTGGGTGGGGGGGGGGG + Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912511344 1:110192262-110192284 CTGGGAGTGGGCAGGGGTGGGGG + Intronic
912512404 1:110198313-110198335 CGGTGAGTGGGCATGGGGGAAGG - Exonic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
912898724 1:113623820-113623842 CGGTGAGAGGGAAGTGGAGATGG - Intronic
912935840 1:114003109-114003131 GTGCTAGTGGGGAGAGGAGAGGG + Intergenic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
913609997 1:120501761-120501783 GTGTCAGTGGGGTGGGGGGAGGG - Intergenic
914032385 1:143972715-143972737 CTCTGAGTGGGAAGCGGAGCCGG + Intergenic
914157060 1:145095252-145095274 CTCTGAGTGGGAAGCGGAGCCGG - Exonic
914203811 1:145509378-145509400 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914345412 1:146794550-146794572 CTGGGAGGGGGAAGGGGAGGAGG + Intergenic
914482934 1:148082532-148082554 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914581191 1:149020481-149020503 GTGTCAGTGGGGTGGGGGGAGGG + Intronic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915082219 1:153360055-153360077 CTAGGTGTGGGCAGGGGAGATGG - Intronic
915526822 1:156481100-156481122 CTGTCAGTGGGGAGGGGCCAGGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
915676008 1:157531813-157531835 CAGAGACTGGGGAGGGGAGAGGG + Intronic
915685888 1:157633616-157633638 CAAAGATTGGGGAGGGGAGAGGG + Intergenic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
915883478 1:159698801-159698823 TTGTGACTGGGAAGGGGAGGAGG + Intergenic
916320682 1:163499795-163499817 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
917058689 1:171013000-171013022 ATGAGAGAGAGGAGGGGAGAGGG - Intronic
917359358 1:174159501-174159523 AACTGAGAGGGGAGGGGAGAAGG - Exonic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918102333 1:181387189-181387211 CTGTGAGTGGGGTGAGGTGGAGG + Intergenic
918329029 1:183438503-183438525 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
918410392 1:184252420-184252442 CTGTCAGTGGGTGGGGGACAAGG + Intergenic
918725612 1:187918104-187918126 CTCAGAATGGGGAGGGTAGAAGG + Intergenic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919061240 1:192635549-192635571 GTGTGTGTGGGGAGGGGTGGGGG - Intergenic
919314556 1:195954823-195954845 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
919412200 1:197259521-197259543 CTGTCAGTGGGGTGGGGGCAAGG + Intergenic
919723651 1:200866996-200867018 GTGTGAGTGGGGTGGGGGGCGGG - Intergenic
919966385 1:202530749-202530771 CTGGGAGTAGGGAGAAGAGATGG - Intronic
920041286 1:203099306-203099328 CTGGGGGTGGGGTAGGGAGAGGG - Intronic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920142074 1:203823538-203823560 TGGTAAGTGGGGAAGGGAGAAGG - Intronic
920180791 1:204130679-204130701 CTGTCAGTGGGGTGGGGAAGGGG - Intergenic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920467863 1:206203599-206203621 CTCTGAGTGGGAAGCGGAGCCGG + Intronic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920693054 1:208161299-208161321 GTGTGAGGGGAGAGGTGAGAAGG - Intronic
920758328 1:208757003-208757025 CTGTGACTGGACAGGAGAGAAGG + Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
920869274 1:209780375-209780397 CTAGGAGTGGGGAGAGGGGAGGG - Exonic
921031957 1:211341649-211341671 CTGGGAATGGGAAGGAGAGAGGG + Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921709603 1:218360507-218360529 CTGTCAGTGGGGATGGGGTAGGG + Intronic
921813864 1:219544958-219544980 GGGAGAGGGGGGAGGGGAGAGGG - Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922102148 1:222485889-222485911 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922104509 1:222501301-222501323 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922263231 1:223961000-223961022 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922264827 1:223973814-223973836 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922317696 1:224457038-224457060 CTGGATGTGGCGAGGGGAGACGG + Intronic
922536408 1:226384249-226384271 CTGGCGGTGGGGTGGGGAGAGGG + Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922868913 1:228884229-228884251 CTTTCAGTGGAGAGGGGACATGG - Intergenic
922896233 1:229102647-229102669 AGGTGAGCGGGGAGGGGAGAAGG - Intergenic
922913828 1:229239547-229239569 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
922934275 1:229411479-229411501 AGGGGAGGGGGGAGGGGAGAGGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923265174 1:232306992-232307014 GGGTGAGTGGGGAGTGGGGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924112919 1:240717484-240717506 GTGTGAGTGCAGAGGGGAAATGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924345071 1:243066009-243066031 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924346684 1:243078820-243078842 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924414865 1:243849486-243849508 CTGCGCGTGGGGTGGGGTGAAGG - Intronic
924806110 1:247363186-247363208 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806117 1:247363214-247363236 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806140 1:247363300-247363322 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
1062841955 10:679207-679229 CTGGGTGTGGGGAGTAGAGATGG - Intronic
1062841982 10:679286-679308 CTGGGCGTGGGGAGCAGAGATGG - Intronic
1062928951 10:1339959-1339981 CTGGGGGTGGGCAGTGGAGAGGG + Intronic
1063251813 10:4282178-4282200 CTGTGAGTGTCGAGGTGAGTCGG - Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063368912 10:5508257-5508279 CAGTGAGTGGGTTGAGGAGAAGG + Intergenic
1063589850 10:7385417-7385439 CCGGGAATGTGGAGGGGAGAAGG + Intronic
1063611924 10:7570064-7570086 CTTTGAGAGGTGAGAGGAGAAGG + Intronic
1063649390 10:7918197-7918219 CTGGGAGTGGGGAAAGGAGAAGG + Intronic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064680437 10:17806400-17806422 CTGGAAGTGGGGAGTGGAGTGGG + Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064762256 10:18633263-18633285 GTGGGAGCGGGGAGGGGGGAGGG + Intronic
1064795542 10:19007577-19007599 GGGAGAGTGGGGAGGGGAGGGGG - Intergenic
1064974834 10:21102970-21102992 CTGGAAGTGGGGTGGGGGGAGGG - Intronic
1065178077 10:23097597-23097619 ATGGGAGTGGGGAGAGGAGCAGG + Intronic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1065865056 10:29907620-29907642 TTTGGAGTGGGGAGGGGACAGGG + Intergenic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066220655 10:33334706-33334728 CTGTGGGTGGGAGGGGGAGGAGG + Exonic
1066588390 10:36963876-36963898 CTGTCAGGGGGTAGGGGACAAGG + Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1066711271 10:38237426-38237448 CTGTGAGGTGGGAGTGGAGTAGG - Intergenic
1066729665 10:38426029-38426051 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1067095331 10:43295696-43295718 CTGTGAGGGGTGAGAGGAGGCGG - Intergenic
1067291494 10:44946663-44946685 CTGAGAGAGGGTAGGGGAGTGGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067439031 10:46297910-46297932 CCGTGAGTGGGCAGAGGTGAGGG + Exonic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067511537 10:46898904-46898926 GTGTGTGTGGGAAGGGGAGGTGG + Intergenic
1067616978 10:47763783-47763805 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067942283 10:50667213-50667235 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069785704 10:70986531-70986553 GAGTGATGGGGGAGGGGAGAAGG + Intergenic
1069891501 10:71655315-71655337 ATCTGAGTGGGCAGGAGAGAAGG - Intronic
1069903291 10:71718212-71718234 CAGGTAGTGGGGAGGGGAGTGGG + Intronic
1069917312 10:71795672-71795694 CAGGGAGTGGGGAGGGGAAGAGG - Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1070204473 10:74242903-74242925 CTCTCAGTGGAGAGGGGAGCTGG - Intronic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070855999 10:79608455-79608477 CTGGGAGTGGTGAAGAGAGATGG + Intergenic
1070863529 10:79692171-79692193 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1071416236 10:85444502-85444524 GTGTGAGAGGAGAGGGGAAAAGG - Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071874799 10:89833569-89833591 CTGCCAGTGGGGAGTGGATATGG + Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1073291360 10:102414842-102414864 CGGTGAGTGGGGAAGTGGGAGGG - Exonic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1073426883 10:103460265-103460287 CTGGGAGTGGGGGGTGGAGGAGG + Intergenic
1073464721 10:103687781-103687803 CTGGCAGTGGGGAGGGAATAGGG - Intronic
1073535847 10:104275752-104275774 AGGGGACTGGGGAGGGGAGATGG - Intronic
1073597778 10:104817568-104817590 GGGGGAGGGGGGAGGGGAGAAGG - Intronic
1073604368 10:104879373-104879395 CAGAGAGTGGTGAGGTGAGAAGG - Intronic
1073671661 10:105597350-105597372 CTTGGAGTGGGGAGGGGTTATGG + Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1073895029 10:108145702-108145724 CTGGGAGTGGGGACTGGGGAGGG - Intergenic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074194988 10:111175792-111175814 ATGAGAGTGGTGCGGGGAGAAGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1074842048 10:117364077-117364099 TTGTGTGTGGGAATGGGAGAAGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074927492 10:118088117-118088139 GTGTCAGTGGGGAGGTGAGCAGG - Intergenic
1074962124 10:118456210-118456232 CCCTGAGGGGGGTGGGGAGAAGG + Intergenic
1075222071 10:120593693-120593715 TTTTGAGTGGGGAGGGGGAAGGG - Intergenic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075545916 10:123354534-123354556 CGTTGAGTGGGGAGGGGTGCTGG + Intergenic
1075670347 10:124260186-124260208 TTGTGAGTGGGGTGGTGTGAGGG - Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076192089 10:128490127-128490149 ATGAGAGAGGGAAGGGGAGAAGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076802216 10:132835951-132835973 CGGGAAGTGGGGAGGGGAGTGGG - Intronic
1076883136 10:133249240-133249262 CCCTGAGTGGGGAGGGGCGTGGG + Intergenic
1076973274 11:150668-150690 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1077003009 11:334421-334443 CAGCCTGTGGGGAGGGGAGAGGG - Intergenic
1077020588 11:415587-415609 CTGGGAGAGGGACGGGGAGAGGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077388424 11:2286973-2286995 TTATGAGTTGGGAGGGGAGATGG - Intergenic
1077472209 11:2769384-2769406 CTGTGAGTTGGGAGGATGGAGGG + Intronic
1077489391 11:2853438-2853460 CCGGCAGTGGGGAGAGGAGAAGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077753067 11:4994827-4994849 CTGTGAGTGGTGAGGCTTGAAGG - Intergenic
1077785567 11:5380074-5380096 CTTGGAGTGGGGAGAAGAGATGG + Intronic
1077789762 11:5425521-5425543 GTGTGTGTGGCGAGGGGAGGAGG + Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078093637 11:8283447-8283469 CTGGCAGCGGGGAGAGGAGAAGG + Intergenic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078222044 11:9359594-9359616 CTGTAACTTGAGAGGGGAGATGG - Intergenic
1078292435 11:10026160-10026182 TTGTGAGGGGGGAGGAGAGGAGG - Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1079079882 11:17406839-17406861 TTGGGAGTGGGGATGGGGGAAGG - Intronic
1079189310 11:18264744-18264766 AAGGGAGAGGGGAGGGGAGAGGG + Intergenic
1079319366 11:19438988-19439010 CTGGAATTGGGGAGTGGAGAGGG + Intronic
1079353948 11:19714702-19714724 CGGGGCGTGGGGATGGGAGATGG + Intronic
1079391161 11:20023274-20023296 GTGTGAGTGGGGGTGGGAGGGGG + Intronic
1080604406 11:33852881-33852903 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1080808900 11:35682620-35682642 CAGAGAGTGGGGTGGGGAGGTGG + Intronic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081063895 11:38515203-38515225 CTGTCAGGGGGTAGGGGACAAGG + Intergenic
1081380044 11:42403827-42403849 CTGGGAAGGGGGTGGGGAGAGGG - Intergenic
1081398087 11:42611116-42611138 CTGTGAGAGGGAAAGAGAGAAGG + Intergenic
1081413437 11:42786054-42786076 CTGTCAGTGGGGAGGAAACAGGG + Intergenic
1081526067 11:43928585-43928607 CTGCGAGTGGGGAGCGGAGGAGG + Intronic
1081556553 11:44167955-44167977 GGGGGAGTGGGGAGGGGGGAGGG - Intronic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1082004412 11:47411848-47411870 CAGTGAGTGGGGTGGGATGAAGG + Intronic
1082262424 11:50087179-50087201 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1082675467 11:56095391-56095413 GTGTGTGTGGGGTGGAGAGATGG + Intergenic
1082774467 11:57234972-57234994 ATGTGAGTGGGGAGTTGGGAAGG - Exonic
1083039079 11:59668911-59668933 CAGGGAGCGGGGAGGGGAGAGGG + Exonic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083268758 11:61560004-61560026 CTCTGAGTGGGGAAGGGTCAGGG - Intronic
1083275476 11:61594728-61594750 CTGAGAGTGAGGACGGGGGAGGG + Intergenic
1083322856 11:61857820-61857842 CAGGGAGCGGGGAAGGGAGATGG - Intronic
1083421786 11:62557417-62557439 CTGGTAGTTGGGAGGGGATAGGG - Intergenic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083691151 11:64409662-64409684 TTGTGAGTGGGGAAGGGAGTGGG + Intergenic
1083923434 11:65792473-65792495 CTGGGGGTGGGCAGGGGCGATGG - Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084477139 11:69395499-69395521 TCGTGTGTGGGCAGGGGAGAAGG + Intergenic
1084515597 11:69636765-69636787 CTGGGAGAGGTGAGGGGAGGAGG - Intergenic
1084555840 11:69875392-69875414 GTGTGAGTGGGGAGGGGGGTTGG - Intergenic
1084580447 11:70019984-70020006 TAGAGATTGGGGAGGGGAGAGGG - Intergenic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084942074 11:72618278-72618300 CTGGGAGTGGGGAGGCTGGAGGG - Intronic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085667022 11:78422951-78422973 CTGTGAGTGGGTAGGGGGTTGGG + Intergenic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1085899685 11:80684056-80684078 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1086436169 11:86782885-86782907 CTTGGGGTGGGGAGTGGAGAAGG + Intergenic
1086494145 11:87385121-87385143 CTCTGCATGGGGATGGGAGAGGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1087608418 11:100405382-100405404 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1088428341 11:109729704-109729726 CTTTCAGTGGGAAGGGGAGCTGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088843041 11:113642900-113642922 CAGTTACTGGGGAGGGGATAGGG - Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1088930097 11:114342561-114342583 TTAGGAGTGGGGTGGGGAGAAGG + Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089191687 11:116658575-116658597 CCGTAAGTGGGGAGAGAAGAGGG - Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089459077 11:118642225-118642247 GTGGGAATGGGGAGGGGAAAAGG - Intronic
1089650794 11:119911495-119911517 GTGGGACTGGGGAGGGCAGATGG - Intergenic
1089667378 11:120029179-120029201 CTAAGAATGGGCAGGGGAGAGGG - Intergenic
1089700305 11:120240408-120240430 CTGCGCGTGGGCAGGGGTGAAGG + Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089895795 11:121929021-121929043 ATGTGAGTGTGGAGGAGAGGGGG + Intergenic
1090104383 11:123836401-123836423 CTGTCAGGGGGTAGGGGTGAGGG - Intergenic
1090242733 11:125195468-125195490 CAGTGAGTGGGGAGGCGGGGAGG + Intronic
1090251240 11:125253423-125253445 GTGTGAGTGAGGAGGAGAGGAGG + Intronic
1090260307 11:125314563-125314585 CAGTCAGTGGGGAGGGGACAAGG + Intronic
1090306210 11:125693386-125693408 GAGTAAGTGGGTAGGGGAGAAGG - Intergenic
1090333985 11:125950797-125950819 GTGTCAGTGGGTAGGGGAGCAGG - Intergenic
1090665665 11:128913499-128913521 CTGCGAGTGGGGTGGGGACTAGG - Intronic
1090770081 11:129912202-129912224 CTGTGACTGGTGAGGGGAAGTGG + Exonic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090918842 11:131190735-131190757 GTGGGAGTGGGCTGGGGAGAGGG + Intergenic
1091082205 11:132681529-132681551 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091228154 11:133970547-133970569 CTGTGAGTGAAGAGTGAAGATGG - Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091381962 12:67435-67457 GAGTGAGCGGGGAGAGGAGATGG + Exonic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092964294 12:13626821-13626843 TGGTGAGGGGGGAGGGGGGAGGG - Intronic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1093000298 12:13988628-13988650 CTGTCAGTGGGGAAGGGTGCAGG - Intergenic
1093592329 12:20917655-20917677 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1093731379 12:22569138-22569160 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094107905 12:26833117-26833139 CACGGAGTGGGGAGCGGAGAGGG - Exonic
1094213820 12:27920042-27920064 CTTTTAGTGTGGAGGAGAGAAGG - Intergenic
1094467789 12:30771959-30771981 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
1094472491 12:30816792-30816814 CTGGGAGCTGGGAGGGGAGCAGG + Intergenic
1094773588 12:33695196-33695218 CTAGGAGAGGGAAGGGGAGAGGG - Intergenic
1095204597 12:39425034-39425056 CTGTTAGTGGACAGGTGAGAAGG - Intronic
1095626179 12:44318026-44318048 CTCTGCATGGGGAGGGGTGACGG + Intronic
1095680330 12:44967238-44967260 GTGGGAGGGGGGAGGGGGGATGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096104174 12:48986875-48986897 CAGAGAGTGGGGAGGTGAGTGGG - Intergenic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1096214954 12:49793588-49793610 GGGAGACTGGGGAGGGGAGAGGG - Intronic
1096319444 12:50598796-50598818 GGGGGAGAGGGGAGGGGAGAGGG - Intronic
1096439533 12:51628573-51628595 CTGGGAGTGGTGGGGGGAAAGGG + Intronic
1096519145 12:52174356-52174378 CTTTCAGTGGGGCCGGGAGAGGG - Intronic
1096582918 12:52600038-52600060 CAGTGAGTGGAGAGGAGACAGGG - Intronic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096829049 12:54300552-54300574 CTGTGAATGGGGATCAGAGAGGG - Intronic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1096850414 12:54432154-54432176 GTGTTAGTGGAGAGGGGGGATGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097214325 12:57398110-57398132 GTGGGGGTGGGCAGGGGAGAGGG + Intronic
1097218295 12:57430886-57430908 CTGGGACGGGGGAGGGGAAAGGG + Exonic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097264995 12:57739357-57739379 GTGTGAGTGGGAAAGGGAGCTGG - Intronic
1097268632 12:57760541-57760563 TTGGGAGAGGGGAGGGGACAAGG - Intergenic
1097287614 12:57889776-57889798 GTGTGAGTGGGAAGGGGACTCGG + Intergenic
1097312022 12:58129650-58129672 CTGTGAGTGGGTGGGGGACTAGG - Intergenic
1097747848 12:63318825-63318847 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097902254 12:64884742-64884764 CTTTGAGTGGATAGGGGACAAGG - Intergenic
1097921025 12:65073871-65073893 GTGTGTGTGGGGTGGGGTGAGGG + Intronic
1097956081 12:65486699-65486721 GTGGCAGTGGGCAGGGGAGAGGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1098545610 12:71707862-71707884 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1099032517 12:77544916-77544938 GCTTGAGTGGGGAGGGTAGAGGG + Intergenic
1099730060 12:86489275-86489297 CTCTCAGTGGGGAGGGGAGCTGG - Intronic
1100228837 12:92586817-92586839 ATGTGATTGGGGAGGTTAGAGGG - Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100697897 12:97115455-97115477 TGGTGAGTGGGGAGTTGAGAAGG + Intergenic
1100757942 12:97773059-97773081 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1100895788 12:99180910-99180932 CAGTCAGTAGGGAGGGGAGGAGG - Intronic
1100959448 12:99946172-99946194 CTCTGAGTGGGGAAAGGAGGAGG + Intronic
1101472854 12:105014954-105014976 CTGTGAGTGGGCAGAGCTGATGG + Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1101916444 12:108899737-108899759 CTGGGAGTGGGGATGGTAGCTGG + Intronic
1101996884 12:109532080-109532102 CTGCGAGCGGGGAGGGGCGGAGG - Intronic
1102180118 12:110906267-110906289 ATGTGAGAGGGGGAGGGAGAGGG + Intronic
1102188273 12:110966366-110966388 ACGGGAGTGGGGAGGGGAGCCGG + Intergenic
1102548011 12:113670523-113670545 CTTTGAGTGAGGATGGGAGTTGG - Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103328938 12:120140471-120140493 GTGTGAGTGGGTAGGGCAGGAGG - Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1103860718 12:124010969-124010991 CAGGGAGTGAGGTGGGGAGAGGG + Intronic
1103946879 12:124531877-124531899 CTGGGAGTGGGGTGGGGAGGTGG - Intronic
1103990358 12:124795075-124795097 CAGGGCATGGGGAGGGGAGAGGG - Intronic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104611584 12:130233107-130233129 CTGGGAGTGGGGAGCGGCGAGGG + Intergenic
1104636632 12:130441770-130441792 CTGCTAGTGGGGAGGGAAGGTGG - Intronic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104889730 12:132134523-132134545 ATGTGAGAGGGGAGAGGAGCGGG - Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104967904 12:132517591-132517613 CTGTGCCTGGGAAGGAGAGAAGG + Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105340945 13:19525044-19525066 CTTTCAGTGGTGAGGAGAGAGGG + Intronic
1105435897 13:20378161-20378183 CAGTGAGTGGGGAAGGGAGGAGG - Intergenic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106616279 13:31331561-31331583 CTGGGAATGGGGAGGGGAAATGG + Exonic
1106830798 13:33580384-33580406 GGCTTAGTGGGGAGGGGAGAAGG + Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107228969 13:38085977-38085999 CTGGGAGTGGGGAGAGGCCAGGG - Intergenic
1107379194 13:39837540-39837562 AAGGGAGGGGGGAGGGGAGAAGG - Intergenic
1107434810 13:40372924-40372946 GTTTGAGTGGGGATGGGAGGGGG - Intergenic
1107706941 13:43117262-43117284 CTTTGAGAGGGGAGGGGAAGGGG + Intergenic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108081872 13:46745481-46745503 GGTGGAGTGGGGAGGGGAGAGGG + Intronic
1108299725 13:49061610-49061632 AAGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299745 13:49061651-49061673 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299751 13:49061663-49061685 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299757 13:49061675-49061697 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108299763 13:49061687-49061709 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1108404416 13:50085405-50085427 CTGTGAGTGGAAAGGGGTGGGGG - Intronic
1108447800 13:50526847-50526869 CTGAGAGGGGAGAGGGGAGAGGG + Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109846801 13:68003921-68003943 TTGTGAGGGGGGAGGTAAGAAGG - Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1109948238 13:69466471-69466493 CTGTCAGAGGGTAGGGGGGAAGG - Intergenic
1110175780 13:72553937-72553959 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1110290749 13:73804094-73804116 AAGTGAGTGAGGAGGTGAGATGG - Intronic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110366443 13:74691587-74691609 CTGTGTGTGGGAAGGGGATGTGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1110739549 13:78978377-78978399 GTATAGGTGGGGAGGGGAGAGGG + Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111640081 13:90957597-90957619 GTGGGGGTGGGGGGGGGAGAGGG - Intergenic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112319244 13:98392110-98392132 CTGCCTCTGGGGAGGGGAGAAGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1113179808 13:107612129-107612151 GGAGGAGTGGGGAGGGGAGAGGG + Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113426616 13:110213659-110213681 GTGTGAGCTGGGAGAGGAGATGG + Intronic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113467617 13:110523456-110523478 CTGTCAGAGGGGTGGGGAGGTGG - Exonic
1113509250 13:110839186-110839208 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1113587747 13:111476859-111476881 CTGAGATTTGGGAGGGGACACGG - Intergenic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1113952035 13:114077466-114077488 CATTGAGTGGGGAGGGAGGAAGG - Intronic
1113957097 13:114104882-114104904 ACGTGTGTGGGGAGGGGAGTGGG - Intronic
1113957105 13:114104908-114104930 ACGTGTGTGGGGAGGGGAGGGGG - Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114332564 14:21652140-21652162 CTGGGAGAGGGGAAAGGAGAGGG + Intergenic
1114382656 14:22224397-22224419 ATGGGAATGGGGAAGGGAGAAGG - Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114664967 14:24372354-24372376 CTGTGAGGGAGGAGGGGGTATGG - Intronic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1115724154 14:36194673-36194695 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1115967127 14:38903051-38903073 ATGTGAGTGGTAAAGGGAGAGGG + Intergenic
1116716351 14:48431377-48431399 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117246349 14:53890395-53890417 CTTGGAGTTGGGAGGAGAGAGGG - Intergenic
1117406413 14:55408444-55408466 GTTTGAGGGGGGAGGGGACAGGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117450559 14:55845695-55845717 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1118056780 14:62087271-62087293 CTGTGAGTGGGGAAAGGCGGAGG + Intronic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118371123 14:65137893-65137915 CAGTGAGTGGGGATGGGCCACGG - Intergenic
1118592074 14:67409591-67409613 CTGTCAGGGGAGTGGGGAGAGGG - Intronic
1118600321 14:67467449-67467471 CTGTGGGTGGGAAGGAGGGAGGG + Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1119182419 14:72613970-72613992 CTGAGAGTGGGGCAGGGGGAAGG - Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119562675 14:75603468-75603490 CTGTCAGTGGGAAGGGGAGCTGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119613042 14:76079933-76079955 GGGGGAGTGGGGAGGGGGGAAGG + Intronic
1119738174 14:76997362-76997384 GTGGGAGGTGGGAGGGGAGAGGG - Intergenic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1120094976 14:80378353-80378375 CTGGAAGTGGGGAGGGGACTTGG + Intronic
1120860926 14:89254394-89254416 CTGTAAGGGAGGTGGGGAGAAGG + Intronic
1121119183 14:91365176-91365198 CTGGGAGGGGTGAGGGGTGAGGG - Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122081046 14:99268272-99268294 GTGGCGGTGGGGAGGGGAGAGGG - Intronic
1122134425 14:99624708-99624730 CTGGGAGTGGTGCGGGGAGGAGG - Intergenic
1122293921 14:100694400-100694422 CTGAGAGTCGGGTGGGGGGAAGG - Intergenic
1122316486 14:100828493-100828515 CAGGGAGAGGGGAGGAGAGAAGG - Intergenic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1122793174 14:104192966-104192988 CTGTGAGTTGGGTGAGGAGGGGG + Intergenic
1123001015 14:105294148-105294170 CCGAGAGTGGGGAGGAGAGAGGG - Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123922141 15:25077690-25077712 CTGGTGGTGGGAAGGGGAGAGGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1125407328 15:39366978-39367000 CTGGGAGTGGGGTGTAGAGAGGG + Intergenic
1125673169 15:41487806-41487828 GTAGGAGTGGGGAGGTGAGAGGG - Intergenic
1125686719 15:41567944-41567966 CTGTGAGAGGGGAGTGGTAAGGG + Intronic
1125968228 15:43891343-43891365 CTGTTAGATGGGAGTGGAGAAGG + Intronic
1126002791 15:44227372-44227394 CTGTCGGTGGGGTGGGGAGCTGG + Intergenic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126614849 15:50567318-50567340 CATTTAGTGGGGAGGGGACAGGG - Intronic
1126669627 15:51104387-51104409 CTGTGAGTGGGGAGCATAGCAGG - Intronic
1126741932 15:51786176-51786198 CGGGGAGTGAGGAGGGGAGGAGG - Intronic
1127051326 15:55087308-55087330 CTGTCAGTGGGGGGCGGAGAAGG - Intergenic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127426723 15:58865318-58865340 CTGCGACGGGGGAGGGGAGGAGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127500908 15:59553447-59553469 CTGAGAGGGAGGAGAGGAGATGG + Intergenic
1127657780 15:61071625-61071647 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128056252 15:64702384-64702406 CTGGGAGAGGGGTGTGGAGAGGG + Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128721731 15:69955297-69955319 GTGGGAGTAGGGAGAGGAGAAGG - Intergenic
1128758660 15:70199883-70199905 GGGAAAGTGGGGAGGGGAGAGGG - Intergenic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129010683 15:72413720-72413742 GGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1129034866 15:72642804-72642826 ATGGAAGTGGAGAGGGGAGACGG - Intergenic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129113259 15:73350670-73350692 CTGTGACTGGGAAGAGGAGATGG - Intronic
1129215016 15:74094412-74094434 ATGGAAGTGGAGAGGGGAGACGG + Intergenic
1129228264 15:74182263-74182285 CTGCCAGTGGGGTGGGGAGGTGG + Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129700207 15:77763407-77763429 CAGTGACTGGGGAGAGGGGATGG - Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130381937 15:83379048-83379070 CTGGGAGTGGTGGGGGGAGGGGG + Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1130624912 15:85504274-85504296 CTGGGAGAGGAGAGAGGAGAGGG + Intronic
1130971866 15:88739937-88739959 CTGTGTGTGGCTAGTGGAGAAGG + Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131521515 15:93119592-93119614 CTCTGAGAGGGGAGCAGAGATGG + Intergenic
1131662273 15:94530817-94530839 CAGGGAGTGGGAAGGAGAGAAGG - Intergenic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1131933937 15:97480141-97480163 ACTTGAGTGGGGAGGGTAGAAGG + Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132056549 15:98654963-98654985 CTTTAAGTGGGGATGGGGGAGGG + Intronic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132607117 16:798278-798300 TTGTGAGTGGGGCCGGGAGTGGG + Exonic
1132607128 16:798313-798335 GTGTGAGTGGGGCTGGGAGTGGG + Exonic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132716452 16:1292562-1292584 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133041898 16:3065343-3065365 CTGAGAGTGGGGAGGGGCAGAGG - Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133373552 16:5264671-5264693 CTGTGATGGGGGAGGGGATGTGG + Intergenic
1133565935 16:6993451-6993473 ATCAGAGTGGGAAGGGGAGATGG + Intronic
1133588584 16:7220137-7220159 TCGGGAGTGGGGAGGGGAGATGG - Intronic
1133690261 16:8207595-8207617 CTGTTAAGGGAGAGGGGAGAGGG - Intergenic
1133804702 16:9115962-9115984 ATGGAAGTGGGGAGGGGAGAGGG - Intronic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1134166431 16:11933717-11933739 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134494282 16:14720012-14720034 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134499663 16:14759132-14759154 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134526211 16:14945759-14945781 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134546197 16:15110614-15110636 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134580913 16:15369912-15369934 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134713789 16:16344230-16344252 GTGAGAGTGAGGAGAGGAGAAGG - Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134721659 16:16387584-16387606 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134945767 16:18324291-18324313 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134953028 16:18364427-18364449 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135311822 16:21411134-21411156 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135447069 16:22527751-22527773 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1135539848 16:23321414-23321436 CTGTGAGTGGGGGTGTGAGCAGG + Intronic
1135621601 16:23960620-23960642 GTCAGAGTGGGGAGGGAAGAGGG - Intronic
1135706071 16:24676184-24676206 CAGGGAGTGGGCAGGGGAGAAGG - Intergenic
1135869972 16:26140697-26140719 CTGTCTTTGGGTAGGGGAGAAGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136073807 16:27804839-27804861 CTGGGATTGGGGACGGGAGAGGG + Intronic
1136073956 16:27805227-27805249 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073985 16:27805292-27805314 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073999 16:27805324-27805346 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074013 16:27805356-27805378 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074027 16:27805388-27805410 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074071 16:27805486-27805508 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074085 16:27805518-27805540 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074099 16:27805550-27805572 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074128 16:27805615-27805637 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074142 16:27805647-27805669 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074171 16:27805712-27805734 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074185 16:27805744-27805766 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136150991 16:28349034-28349056 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136167225 16:28462874-28462896 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136195752 16:28652142-28652164 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136212090 16:28766267-28766289 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136256809 16:29046195-29046217 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136281183 16:29212356-29212378 TTGAGAGTGGGGAGGGGAGCTGG + Intergenic
1136284605 16:29233615-29233637 CTCGGAGTGGGAAGGGCAGACGG + Intergenic
1136308526 16:29390141-29390163 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136321941 16:29491667-29491689 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136436622 16:30231640-30231662 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1137349894 16:47704320-47704342 CTGTCAGAGGGGTGGGGAGGAGG + Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137439231 16:48483892-48483914 CGGAGAGGGGGAAGGGGAGAGGG + Intergenic
1137485835 16:48890352-48890374 CTGTGAGGGGTGAGGGGCGCTGG + Intergenic
1137525666 16:49234076-49234098 TGGGGTGTGGGGAGGGGAGAGGG + Intergenic
1137586276 16:49665618-49665640 CTGAGAGTGAGGAGCGGAGGAGG - Intronic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137677862 16:50312759-50312781 CGGGGAGTGGGGAGGGGGGCGGG - Intronic
1137692767 16:50441026-50441048 CCCTGAGTGAGGAGGAGAGAGGG - Intergenic
1137709410 16:50555864-50555886 GTGTGAGTGGGCAAGAGAGAGGG - Intronic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138214766 16:55193934-55193956 GTGTGTGTGGGCAGGGGACAGGG - Intergenic
1138244973 16:55460646-55460668 CTGTGAGGGGTCAGGGGATAGGG + Intronic
1138555625 16:57769743-57769765 CTGTGAGGCGGGAGGGGATGAGG + Intronic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138846250 16:60570394-60570416 CAGGGACTGGGGAGGGGAAATGG + Intergenic
1138987019 16:62341904-62341926 CTGAGAGGGGGCAGGGGCGACGG - Intergenic
1139332623 16:66205325-66205347 CTGTGAGTTCGGATGGGACAAGG + Intergenic
1139379176 16:66519823-66519845 CTCTCAGTGGGGAGGGGGCAGGG + Intronic
1139420720 16:66848052-66848074 GTATTTGTGGGGAGGGGAGAAGG - Intronic
1139442772 16:66977148-66977170 CTGGGAGGGGGGAGAGGAGGGGG + Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139856227 16:69982550-69982572 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1139988575 16:70920713-70920735 CTGGGAGGGGGAAGGGGAGGAGG - Exonic
1140366501 16:74385527-74385549 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1140685297 16:77427777-77427799 CTGTGAGTTGGCAGGGGAGGTGG + Intronic
1141188395 16:81805623-81805645 TTGTGAGTGGGGTGGGGGAAGGG - Intronic
1141245441 16:82302686-82302708 GTGCCAGTGGGGAGGGGAGGAGG - Intergenic
1141461028 16:84179034-84179056 CTGGGAGTGGGGAGGTGTGGTGG + Exonic
1141570482 16:84930784-84930806 GTGTGAGTGGGTAGGGGTGTGGG + Intergenic
1141570503 16:84930858-84930880 GTGTGAGTGGGTAGGGGTGTGGG + Intergenic
1141572428 16:84941998-84942020 GTGCGAGTGGGGTGGGGAGAAGG - Intergenic
1141659788 16:85435647-85435669 GTCTGAGAGGGAAGGGGAGAGGG + Intergenic
1141993721 16:87623990-87624012 CTGTCAGCTGGGAGGGGACAGGG + Intronic
1142085546 16:88178279-88178301 TTGAGAGTGGGGAGGGGAGCTGG + Intergenic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142285970 16:89171695-89171717 GTGTGAGGGGGGCGGGGAGGGGG - Intergenic
1142446977 16:90146858-90146880 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142448573 16:90159645-90159667 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1142458912 17:75644-75666 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142460515 17:88473-88495 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143706773 17:8703535-8703557 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1144032721 17:11336636-11336658 CTGTTAGAGGGGAGGAGAGAAGG - Intronic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144250255 17:13409205-13409227 CTCTTAGTGGGGATGGGTGAGGG - Intergenic
1144483431 17:15645859-15645881 CTGGGAGTGGGGAGTGGGGGTGG + Intronic
1144533343 17:16061941-16061963 CTGGGAATGTGGTGGGGAGATGG + Intronic
1144726725 17:17506015-17506037 GCGGGAGAGGGGAGGGGAGAGGG + Intronic
1144781989 17:17812986-17813008 CTGAGACTAGGGTGGGGAGAGGG - Intronic
1144782562 17:17815344-17815366 AGGTGAGTGGGGTGGGGAGCAGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144915253 17:18719168-18719190 CTGGGAGTGGGGAGTGGGGGTGG - Intronic
1144930888 17:18858103-18858125 CGGTGGGCGGGGAGGGGCGAGGG - Exonic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145184500 17:20782612-20782634 TTGGGAGGGGGGAGGGGACAGGG + Intergenic
1145912789 17:28552290-28552312 CCGCGGGTGGGAAGGGGAGAGGG - Intronic
1146157403 17:30535699-30535721 CTGTGACTGGGGTGGGGTGGGGG - Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1146668284 17:34719578-34719600 CTGCGAGCGGGGAGGGGACAGGG - Intergenic
1146693523 17:34892707-34892729 GTGGGAGTGGGGTGGGGAGGTGG - Intergenic
1146791031 17:35750609-35750631 CTGTGACTGTGGATGAGAGAAGG + Intronic
1146852151 17:36231441-36231463 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1146868060 17:36355312-36355334 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1147070934 17:37955930-37955952 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147082460 17:38035456-38035478 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1147098404 17:38159423-38159445 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147583129 17:41638050-41638072 CAGTGACTGGGGAGGAGACAAGG + Intergenic
1147638165 17:41976570-41976592 CTGTGAGTGGGGTGGAGCAAAGG - Exonic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1147932927 17:43994377-43994399 CTGTGAGTGGGGCAGGGGAAGGG - Intronic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148162577 17:45459273-45459295 CTGAGAGTGGCCAGGGGAAATGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148411880 17:47474438-47474460 TTGGGAGGGGGGAGGGGACAGGG - Intergenic
1148450895 17:47777310-47777332 ATGGGAGTGAGGTGGGGAGATGG + Intergenic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148686259 17:49502764-49502786 GTGACAGAGGGGAGGGGAGACGG + Intronic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149232838 17:54555033-54555055 CAGTGAGTGGGAATGGTAGATGG + Intergenic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149498836 17:57136136-57136158 GTGGGCGTGGGGAGGGGAGGAGG + Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149579740 17:57741274-57741296 CTGAGAGTGGGGAGGAGAAATGG + Intergenic
1149867388 17:60158239-60158261 CTGTCAGTGAGGGTGGGAGAAGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150291217 17:63983456-63983478 CTGTGGGTGGGGACGGGAAGGGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150393806 17:64805937-64805959 CTGAGAGTGGCCAGGGGAAATGG - Intergenic
1150823745 17:68457138-68457160 CTGGGAGTGGGGTGGGGTGGGGG + Intronic
1150848230 17:68680582-68680604 GTGGGAGGGGGAAGGGGAGATGG + Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151499210 17:74478153-74478175 CTGGGAGTGAGCTGGGGAGAGGG - Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151698925 17:75732238-75732260 TGGTGAGTGGGGAAGGGAGTTGG + Exonic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152067075 17:78117781-78117803 CAGTGAGTGGGGCGGGTGGAGGG - Exonic
1152118060 17:78400886-78400908 CTGTGGGTGGGGTGGAGTGAGGG + Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152293824 17:79455257-79455279 CCGTGACGGGGGAGCGGAGAGGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152334875 17:79695107-79695129 CTGTGACTGGGGAGGGGCTGAGG - Intergenic
1152367800 17:79866776-79866798 TTGTGTGTGGGGCCGGGAGAAGG - Intergenic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1153037945 18:782100-782122 ATGGGAGTGGGGTGGAGAGAGGG - Intronic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153408354 18:4765882-4765904 CTGTCAGTGGGTGGGGGACAAGG - Intergenic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154074125 18:11182536-11182558 CTGTGAGTTGGGTGGAGAAAGGG - Intergenic
1154117699 18:11625776-11625798 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1154168748 18:12035678-12035700 ATGTGAGGGGGGTGGGGAAAAGG + Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154363837 18:13688495-13688517 CTTTCAGTGGGGAGAGGAGCTGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154961148 18:21309897-21309919 GTGTGTGTGGGGAGGGGATGGGG - Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155596190 18:27490431-27490453 TTCCCAGTGGGGAGGGGAGAAGG - Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156013218 18:32517759-32517781 CTGGGAGAGGGGAAAGGAGAAGG - Intergenic
1156292409 18:35759464-35759486 GGGGGAGGGGGGAGGGGAGAGGG + Intergenic
1156310699 18:35919192-35919214 ATGTTAGAGGAGAGGGGAGAGGG + Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156494522 18:37517192-37517214 CTCTGAGTGGGGAGAGGGGACGG - Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156798601 18:41079940-41079962 GGGTGAGTGGGAAGGGGGGAGGG - Intergenic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157794000 18:50559150-50559172 TTGGGAGTTGGGAGAGGAGAAGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157944775 18:51967046-51967068 GAGTGAGGGGGGAGGGGGGAGGG - Intergenic
1158388887 18:57026944-57026966 CTGTGATAGGGAAAGGGAGAGGG + Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158875446 18:61730061-61730083 CTGTGAGTAGGGAGCAGGGATGG - Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159453442 18:68631593-68631615 ATGTGATTTGGGAGGGGTGAGGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1159652235 18:70990572-70990594 GTGGGTGGGGGGAGGGGAGAGGG + Intergenic
1159927472 18:74281953-74281975 CTGTGAGTGGGAAGGGGAACAGG + Intronic
1159943429 18:74426176-74426198 CTGAGGGTGGGAAGTGGAGAGGG - Intergenic
1159964103 18:74579296-74579318 AAGGGAGTGGGGAGAGGAGAAGG - Intronic
1160087736 18:75794210-75794232 CAGGGAGTGGGGTAGGGAGAGGG - Intergenic
1160582271 18:79890466-79890488 CTGCCAGTGGGGAGGGGGAAGGG - Intronic
1160648631 19:208157-208179 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160650230 19:220973-220995 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160698865 19:496955-496977 CGGTGAGCGGGGAGGGGACGCGG + Intronic
1160699012 19:497374-497396 CGGTGAGCGGGGAGGGGACGCGG + Intronic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1160798671 19:957106-957128 CTGTGGGTGGGGGGGGGCGCTGG + Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160975472 19:1790398-1790420 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
1160983254 19:1826376-1826398 CTGGGAGTAGGGAGGAGGGAGGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161093826 19:2377446-2377468 AGGGGAGAGGGGAGGGGAGAAGG - Intergenic
1161093866 19:2377536-2377558 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161093912 19:2377637-2377659 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1161256279 19:3311598-3311620 TGGTGTGTGGGGAGGGGCGAGGG - Intergenic
1161258846 19:3324535-3324557 CTGTGAGGGGTGAGAGCAGAGGG - Intergenic
1161451914 19:4350911-4350933 CAGCGAGAGGGGAGGTGAGAGGG + Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1162013657 19:7832115-7832137 CTGGGAGTGGGGAGGGCGGCGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162303884 19:9859800-9859822 CTGGGATTGGGGTGGGGGGAAGG - Intronic
1162323632 19:9985811-9985833 CTGGGGGTGGGGGGTGGAGATGG - Intronic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162850830 19:13429987-13430009 GGGGGAGTGGGGAGGGGGGAAGG + Intronic
1162953838 19:14087802-14087824 TTATGAATGGGGTGGGGAGAGGG - Intergenic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1162975571 19:14205853-14205875 CCGCGAGGGGGGAGGGGACACGG - Intronic
1163041639 19:14607149-14607171 CTGACCATGGGGAGGGGAGAAGG + Intronic
1163240330 19:16058857-16058879 CTGTGATTTGGGAGTGTAGAGGG + Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163458084 19:17420449-17420471 CCGTGAATGGGCAGGGGAGGTGG - Intronic
1163513347 19:17748611-17748633 CTGTGAGTGGGGTGCGGAGGAGG + Intronic
1163548584 19:17952839-17952861 CCGGGAGAGGGGAGGGGGGAAGG - Intronic
1163747435 19:19056753-19056775 CTGGGAGTGAGGAGGCGAGGAGG - Intronic
1163748553 19:19062152-19062174 CTGGAAGTGAGGTGGGGAGATGG + Intergenic
1163836809 19:19579937-19579959 CTGTGGATGGTGGGGGGAGATGG - Intronic
1163945686 19:20531254-20531276 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
1164600327 19:29558704-29558726 CTGTCAGTGGGGAGGTTAGGAGG + Intronic
1164730272 19:30498436-30498458 CAGGGAGTGGGGTGGGGGGACGG + Intronic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1164824336 19:31273424-31273446 CTGGGAGTGGGGTGAGGAGATGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1164906690 19:31973848-31973870 GTGGGAGTGGGCAGAGGAGAAGG + Intergenic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165178479 19:33947633-33947655 CTCTGAGTGGTGAGAGGTGAGGG - Intergenic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166020655 19:40025517-40025539 GGGGGAGTGGGGAGGGGAGTGGG + Intergenic
1166547314 19:43640962-43640984 CGGGGAGGGGGGAGGGGGGAAGG - Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166762806 19:45235343-45235365 CTGTGACTGAGGAGGGGATCTGG + Intronic
1166778058 19:45324183-45324205 ATCTGAGGGGGGAGGGGAGAGGG + Intergenic
1166817753 19:45557076-45557098 CAGAGAGTGGTGAGGGGTGAGGG + Intronic
1166827949 19:45621119-45621141 CTGGGAGTGGGGAGGGGGAGTGG + Intronic
1166835620 19:45666024-45666046 AAGGGAGGGGGGAGGGGAGAGGG + Intergenic
1166917655 19:46206476-46206498 GTGTGTGTGGGGCGGGGTGAGGG + Intergenic
1167036137 19:46995992-46996014 CAGCCAGTGGGGAGGGGAGCAGG + Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167112353 19:47469797-47469819 GTGGGAGCGGGGAGGGCAGATGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167429920 19:49448284-49448306 CTGTGAGCAGGGAAGGGATAGGG - Intronic
1167460383 19:49621420-49621442 CTCTGAGTGGGAAGGGGATTTGG + Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168309893 19:55455107-55455129 CTGTGAGTGGGAGGGAGGGAGGG + Intronic
1168402148 19:56091594-56091616 CTGGGAGTGGGGAAGGCAGGAGG + Intronic
1168412244 19:56147224-56147246 CTGCAAGCGGGGAAGGGAGAGGG + Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1168630298 19:57950817-57950839 CTGAGAGTGGGGAGAGGCCAGGG + Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925348916 2:3187974-3187996 AGGTGAGTGGGGAGTGGGGAGGG - Intergenic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925824751 2:7836807-7836829 CTGTCACTGGAGAGGTGAGAAGG + Intergenic
925837373 2:7959431-7959453 CTGTGATGGGTGGGGGGAGAAGG - Intergenic
926037008 2:9643732-9643754 CTGAGAGAGGAGAGAGGAGAGGG - Intergenic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926136174 2:10338167-10338189 CAGGGAGTGGGGAGGAGGGATGG + Intronic
926685400 2:15694191-15694213 CTGAGACTGGGGTGGGGAGCGGG - Intronic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927491336 2:23523041-23523063 CATTTAGTGGGGAGGGGGGATGG + Intronic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
927705348 2:25293283-25293305 CTGGGAGAGGGGAGGGGGCAGGG - Intronic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927890404 2:26744510-26744532 GTGTTAGTGGGGAGGGGTGCCGG - Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928024833 2:27730746-27730768 CTGACAGTGGGGAGGAGGGACGG + Intergenic
928029439 2:27766174-27766196 CAGTGACAGGGGTGGGGAGAGGG - Intergenic
928116049 2:28545834-28545856 CTCTGTGTGGGGAGCAGAGAGGG + Intronic
928133747 2:28672488-28672510 CTGTCAGTGGGGCGAGGGGAGGG + Intergenic
928265271 2:29805990-29806012 ATGTGAGTGAGGAGGTGAAATGG + Intronic
928265302 2:29806266-29806288 CTGTCAGTGGGGAGAGGTGTGGG + Intronic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
928424327 2:31165679-31165701 TTGAGAGTGTGGTGGGGAGAGGG - Intergenic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928559170 2:32461156-32461178 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
928559176 2:32461168-32461190 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
928606181 2:32947065-32947087 CGGGGAGCGGGGAGGGGCGAGGG - Exonic
928703308 2:33921086-33921108 CTGAGAGTGAGGAGGAGAAAAGG - Intergenic
929045462 2:37784786-37784808 ATGAGTGTGGGGAGGAGAGAGGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929245059 2:39692625-39692647 CTATAAAGGGGGAGGGGAGAGGG + Intronic
929461014 2:42101971-42101993 TTGCGAGTGGGCAGAGGAGAGGG + Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929909657 2:46078756-46078778 ATGTGAGTGGGAGGAGGAGAAGG - Intronic
929987188 2:46746182-46746204 CTGTTAGGGGGCAGTGGAGATGG + Intronic
930187464 2:48424610-48424632 CTGGGATGGGGGAAGGGAGAAGG + Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931566650 2:63622018-63622040 AGGGGAGTGGGGAGGGGGGAGGG - Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932179163 2:69630321-69630343 CTCTGAGTGGGGCGGGGGGTGGG + Intronic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933506630 2:83183851-83183873 CCATGAGGGGGGAGGGGGGAGGG + Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933700292 2:85250342-85250364 CTGTGTGTGGCAAGGTGAGAAGG - Intronic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
934689556 2:96347838-96347860 CTCTGAGTGGTGAGGTGAGCAGG + Intronic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934877883 2:97942319-97942341 CTGTCAATGGGGTGGGGGGAGGG + Intronic
934891841 2:98077628-98077650 CTGTCAATGGGGTGGGGGGAGGG + Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
934942931 2:98515463-98515485 CGGTGGGTGGGGCAGGGAGAGGG + Intronic
935017664 2:99199646-99199668 ATGGGAGTGGGGTGGGGAGTCGG - Intronic
935074890 2:99731511-99731533 CTGTGAGCGGGGAGGTGGGAGGG - Intronic
935308358 2:101759550-101759572 AGGGGAATGGGGAGGGGAGAGGG - Intronic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
935852640 2:107239395-107239417 CTGTCAGTGGGTGGGGGACAAGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
936027804 2:109046855-109046877 CTGACAGTGGAGAGGGGAGCAGG + Intergenic
936460805 2:112712691-112712713 CAGTGAGTGTGAAAGGGAGAAGG - Intergenic
936527501 2:113251450-113251472 TTGTGAGTGGGGAGGTGGGGTGG + Intronic
936626670 2:114156147-114156169 CTGTCAGTGGGGCGGCGGGAGGG + Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937018967 2:118633204-118633226 GTGTGAGTGGGGAGAAGAGAAGG - Intergenic
937159739 2:119748834-119748856 AGGTGAAAGGGGAGGGGAGAGGG - Intergenic
937866045 2:126752644-126752666 CCTGGAGTTGGGAGGGGAGAGGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938771019 2:134500811-134500833 CAGAGACTGGGGAGGGGAGGGGG + Intronic
938864192 2:135401452-135401474 TTGTGAGGGGGAAGGGGAGAAGG - Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
938965639 2:136386055-136386077 CTTTGAGTGAGCTGGGGAGAAGG + Intergenic
939099646 2:137880916-137880938 CTGGGAGTGGGACGGGGAGCTGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
939528631 2:143328578-143328600 CTGTCAGGGGGTAGGGGAGTAGG + Intronic
939583978 2:143984838-143984860 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
939606603 2:144262633-144262655 GAGGGAGAGGGGAGGGGAGATGG + Intronic
939801795 2:146720359-146720381 CTGGGAGTGGGGAGAGGCCAGGG - Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
939928815 2:148206598-148206620 AAGGCAGTGGGGAGGGGAGATGG - Intronic
940176902 2:150888107-150888129 ATGTGAGTTGGCAGTGGAGAAGG - Intergenic
940285271 2:152027485-152027507 GTGTGAGTCAGGAGGGGAGGTGG - Intronic
940599577 2:155841684-155841706 TCGTGAGAGGGTAGGGGAGAGGG - Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
941762961 2:169264993-169265015 CTGGGAGTGGGCAGAGGAAAGGG - Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941831610 2:169967260-169967282 CTGTGTGTGGGGGGGGGCGGGGG - Intronic
941901121 2:170679506-170679528 CTGTGGGTGGGGCGGGGCGGGGG - Intergenic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942168370 2:173264836-173264858 CGGTCAGGGGGCAGGGGAGAAGG + Intronic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942468789 2:176238175-176238197 CTGGGAGTGGGGAAGTGAGTGGG - Intergenic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943126363 2:183797395-183797417 GGGGGAGTGGGGAGGGGGGAGGG + Intergenic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
943999313 2:194811884-194811906 CGGGGTGTGGGGAGGGGGGACGG + Intergenic
944053304 2:195496000-195496022 GAGTGAGTGGGGTGGGGAGGTGG - Intergenic
944202975 2:197127815-197127837 CTGTCAGTGGGGAGAAGGGAGGG - Intronic
944518096 2:200532412-200532434 CTGTGACTGGGCAGAGGAAAAGG - Intronic
944625660 2:201566352-201566374 CTGTGAGGGGTGGGGGGAGGGGG - Intronic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
944891063 2:204117824-204117846 CTTTCAGTGGGAAGGGGAGCTGG + Intergenic
945388041 2:209227761-209227783 CTGTCAGTGGGGCAAGGAGAGGG - Intergenic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945867537 2:215193498-215193520 CTGTGAGAGGTTAGGGGAAAAGG + Intergenic
945920540 2:215750598-215750620 CTGGTAGAGGGGAAGGGAGAGGG + Intergenic
946025242 2:216667990-216668012 CTGAGATTGGGGAGAGGAGCGGG + Intergenic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946428730 2:219613508-219613530 GGGTGAGTGGGGGGCGGAGATGG + Intronic
946428739 2:219613530-219613552 GGGTGAGTGGGGGGCGGAGATGG + Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
946756571 2:222953437-222953459 CTGTCAGTGTGGCGAGGAGAGGG - Intergenic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947715895 2:232338665-232338687 GTGTGACTGGTGTGGGGAGAAGG - Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947734919 2:232449411-232449433 GTGTGACTGGTGTGGGGAGAAGG - Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
948228641 2:236333650-236333672 CTATCAGTGGGAAGGGGTGAGGG + Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948401036 2:237685665-237685687 CTGGGTGTGGGGAGCGGGGAGGG - Intronic
948444131 2:238019076-238019098 CTAGTAGTGGGGAGGGGAGAGGG - Intronic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
949056167 2:241929157-241929179 CTGCGAGTGGGGGTGGGAGTGGG - Intergenic
1168818505 20:757269-757291 TTGGGAGTGGGGCGGGGGGAGGG + Intergenic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1169207701 20:3749458-3749480 CTGTGAGTGGGGTGGGGGTGCGG - Intronic
1169897307 20:10518005-10518027 CTGGGAGTGGGGAGGGGCAGGGG + Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170220365 20:13935620-13935642 GAGTGAGTGGGGTGGGGAGAGGG + Intronic
1170404011 20:16017582-16017604 TTGTGATTGGAGAGTGGAGAAGG - Intronic
1170573173 20:17643861-17643883 ATGTGTGTGGGGAGGGGCGTGGG - Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170888987 20:20363789-20363811 GTGTGAGTGGGGTGGGAGGAAGG + Intergenic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171241143 20:23568132-23568154 ATGGGAGTGGGGTGGGGACAGGG - Intronic
1171462040 20:25303459-25303481 CTGGGAGTGGGCAGGCGGGAAGG - Intronic
1172008065 20:31830925-31830947 CTCTGAGTTGGCAGGGGACAGGG + Intronic
1172331080 20:34076679-34076701 CTGGGAGTGGAGGGGGGACAGGG - Intronic
1172463028 20:35134550-35134572 CTTGGAGTGGGGAGGAGAGTGGG - Intronic
1172523203 20:35582468-35582490 CTAGGTGTGGGGAGGGGATATGG + Intergenic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172749433 20:37239775-37239797 CAGGGAGTGGGGGTGGGAGAAGG - Intronic
1172844496 20:37921690-37921712 CTGAGAGAGGGTGGGGGAGAAGG + Intronic
1173072151 20:39778836-39778858 CTGTAAGTGGAGAGGAGAGCTGG - Intergenic
1173347712 20:42216103-42216125 ATGTGAGTGTGGAACGGAGAAGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173869594 20:46332944-46332966 CTGGAAGAGGGGAGGGGAGGGGG + Intergenic
1174020832 20:47526783-47526805 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174145313 20:48449173-48449195 ATGTGAGTGGGAAGGGGTGAGGG - Intergenic
1174182550 20:48683940-48683962 CTGCCAGTGGGGAGGGGCGCTGG + Intronic
1174332725 20:49832589-49832611 CCGTGAGTGGGGAGAGGGGAAGG - Intronic
1174506971 20:51023175-51023197 CTGAGCGCGGGGCGGGGAGAAGG + Intergenic
1174519679 20:51119824-51119846 CTCTGAGGGGTGAGAGGAGATGG + Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175372603 20:58502047-58502069 CTGTGAGAGGAGAGGAGAAAGGG - Intronic
1175430622 20:58900066-58900088 ATCTGAGGGGGGAGGGGGGATGG + Intronic
1175483089 20:59325487-59325509 CTGTGACTGGGTTGGGGAGATGG - Exonic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175901327 20:62361011-62361033 CTGGGCTGGGGGAGGGGAGATGG - Intronic
1175936133 20:62514895-62514917 CTGGGAGAGGTGAGGGGAGTCGG + Intergenic
1175944606 20:62552814-62552836 CTGGGAGCGGGGAGAGGAGGAGG - Intronic
1175958195 20:62622043-62622065 CTGAGAGTGGGGAGGACAGCTGG + Intergenic
1175984631 20:62758500-62758522 CTGTGACTGGGGCCGGGAGAAGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176283238 20:64327398-64327420 GAGTGAGCGGGGAGGGGAGATGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176349281 21:5778335-5778357 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176356095 21:5898919-5898941 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176543602 21:8176405-8176427 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1176562553 21:8359450-8359472 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1177280177 21:18971876-18971898 GTGGAAGTGGGGAAGGGAGAAGG + Intergenic
1178111788 21:29376452-29376474 CTTTGAGTGGGGAAGAAAGATGG + Intronic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179170882 21:38971898-38971920 CGGAGAGTAGGGAAGGGAGAGGG - Intergenic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179236342 21:39550402-39550424 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179452018 21:41474040-41474062 GGGTGAGTGAGGAGGTGAGAGGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179531004 21:42019642-42019664 CTGGCAGTCGGGAGGTGAGATGG - Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179597943 21:42455670-42455692 CTGGGAGAGGGAAGGAGAGAGGG + Intergenic
1179659756 21:42866690-42866712 ATGCGAGTGGGGCAGGGAGAGGG - Intronic
1179839111 21:44058789-44058811 CAGTGAGGGGCGAGGGGAGCAGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180012174 21:45058520-45058542 CGCAGAGTGGGGAGGGGAGTGGG + Intergenic
1180137591 21:45871370-45871392 CTGTGACTGGGGTGGGGAAGGGG + Intronic
1180246887 21:46554482-46554504 CTGCGAGAGAGGAGGGGAGGTGG - Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180558454 22:16596537-16596559 CTGTGAGTGGGGAAAGCACAAGG + Intergenic
1180594815 22:16966184-16966206 CTGTGAGTGGGGAGCCAAGCAGG + Exonic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1180844311 22:18973063-18973085 AGGTGAGTGGAGAGGGGACAGGG + Intergenic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181057160 22:20265648-20265670 AGGTGAGTGGAGAGGGGACAGGG - Intronic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181534651 22:23535066-23535088 CTGGGAGTGGGCAGGGGGGCTGG + Intergenic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181845913 22:25708414-25708436 CTCTGAGTGGGCTGGGGAGTAGG + Intronic
1181854351 22:25771548-25771570 CTGTGAGGGGCGGGGGGAAAGGG - Intronic
1181947501 22:26529479-26529501 CTGGGAGGGGAGAGGGGAGAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182542119 22:31049336-31049358 AGGGGAGTGGGGAGGTGAGATGG - Intergenic
1182583406 22:31328702-31328724 CTGGGCGTGGGGAGGCGGGAAGG - Intronic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1182585432 22:31341994-31342016 CTGTTGGTGGCAAGGGGAGAGGG - Intronic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183080724 22:35454389-35454411 AAGAGAGAGGGGAGGGGAGAAGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183188211 22:36304624-36304646 CTGGGAGTGGGGAGGGAGGGAGG + Intronic
1183198207 22:36367856-36367878 CTTGGACTGGGGAGGGGAGGAGG - Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183348245 22:37319648-37319670 GTGGGAGTGGGGAGAGGAGGAGG - Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183417964 22:37693387-37693409 TTGTCACTGGAGAGGGGAGAAGG - Exonic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183847502 22:40554276-40554298 CTGTGATTTGGGAGGGGCCAGGG + Intronic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184390853 22:44202309-44202331 ATGTGAGCGGTGAGGAGAGAAGG + Intronic
1184391956 22:44207802-44207824 CTGTGAATTGGGAGCTGAGAAGG - Exonic
1184538149 22:45101525-45101547 GGGTGAGGGGGGAGGGGAGAAGG - Intergenic
1184589277 22:45470843-45470865 CGGGGAGGGGGGAGGGGGGAGGG - Intergenic
1184760415 22:46540653-46540675 AAGTAAGTGGGGAGGGGAGAGGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203248471 22_KI270733v1_random:92624-92646 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949279827 3:2332728-2332750 GGGGGAGTGGGGAGGGGGGAGGG + Intronic
949474603 3:4431503-4431525 CTCTCAGTGGAGAGGGGACATGG - Intronic
949551332 3:5114690-5114712 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
949879898 3:8652935-8652957 CTGGGAGTGGGGAGGAGACTGGG + Intronic
949919803 3:8991723-8991745 CTAGAAGTGGTGAGGGGAGAGGG + Intronic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950123314 3:10496085-10496107 CTGGGGGTGGGATGGGGAGAAGG + Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950254472 3:11493161-11493183 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950421667 3:12903187-12903209 GGGTGAATGGGGAGGGGTGAGGG + Intronic
950421789 3:12903745-12903767 CTGGGAGTGGGGATGGGAAGAGG + Intronic
950566796 3:13774103-13774125 CTGTGAGTGCGCAGGGGTGAAGG + Intergenic
950704872 3:14773414-14773436 AAGTGAGGGGGGAGGGGAGGGGG + Intergenic
950947415 3:16964163-16964185 TGGGGAGGGGGGAGGGGAGAGGG - Intronic
950997471 3:17518522-17518544 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
951238663 3:20264959-20264981 CTGTCAGTGGAGAGGAGAGCTGG - Intergenic
951651826 3:24959330-24959352 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952624865 3:35392083-35392105 CTCTGATGGGGGAGTGGAGAAGG - Intergenic
952660942 3:35846057-35846079 CAGGGAGTGGGGAGGAGTGAGGG - Intergenic
952694585 3:36250365-36250387 CAGTGAGTAGGGATGGGACATGG - Intergenic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953479221 3:43235105-43235127 CAGGGAGTGGGGAATGGAGATGG + Intergenic
953567133 3:44042308-44042330 CTGTTAGAGGAGAGGGGAAATGG + Intergenic
953703073 3:45211462-45211484 TGGTTAGTGGGGAGGGGGGATGG + Intergenic
953733669 3:45472324-45472346 GTGTCAGTGGGGAAGGGAGTGGG + Intronic
954392504 3:50274989-50275011 CTGAGAGGGAGGAGGGGCGACGG - Intronic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954466693 3:50659290-50659312 CTGGAAGTGGGCAGGGGATAGGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954675006 3:52310902-52310924 ATGTGGGTGGGCAGGGGCGATGG + Intergenic
954683797 3:52359776-52359798 GTCTGAGTTGGGAGGGGAGCAGG - Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
955063131 3:55511407-55511429 GTGGGAGTGGGGAGGGGGTAAGG + Intronic
955592341 3:60551472-60551494 CAGAGAGAGGGTAGGGGAGAGGG + Intronic
955592346 3:60551484-60551506 AGGGGAGAGGGGAGGGGAGACGG + Intronic
956214277 3:66832242-66832264 CTTTGTGTGGGGGGGGGAGTGGG + Intergenic
956301274 3:67775163-67775185 CTCTTAGTGGAGAGGGGAGCTGG + Intergenic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
956894288 3:73643950-73643972 CTGTGAGTGGGGATGGGACTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957060720 3:75479350-75479372 CGGGGAGTGGGGCTGGGAGATGG + Intergenic
957583349 3:82105026-82105048 GTGGGTGGGGGGAGGGGAGAGGG - Intergenic
957609583 3:82449708-82449730 ATGTGATTTGGGAGGGGACAGGG + Intergenic
957613971 3:82505422-82505444 CTGGGAGTGGGGAGAGGCCAGGG - Intergenic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958973408 3:100638301-100638323 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
959087602 3:101868116-101868138 CAAAGAGAGGGGAGGGGAGAGGG - Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
960465863 3:117996535-117996557 CGGTGAGTGGGGTGGGGGGAGGG - Intergenic
960688087 3:120313901-120313923 TTGTGACGGGGGAGGGGAGCAGG - Intergenic
961063129 3:123849884-123849906 TAGGGTGTGGGGAGGGGAGAGGG - Intronic
961330637 3:126135947-126135969 CTGGGTGTGGTGAGGGGAGCCGG + Intronic
961366242 3:126401749-126401771 CTGTGAGTGGGAAGGAGACGTGG + Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961658941 3:128458181-128458203 GTGTGAGTAGGAAGGGGAGGAGG + Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962027600 3:131564966-131564988 TTGTGAGTGGGAAGTGGAGAAGG + Intronic
962588219 3:136862851-136862873 GTGGGTGGGGGGAGGGGAGAGGG - Intronic
962902414 3:139772816-139772838 CCGTGACTGGTGGGGGGAGAGGG + Intergenic
963729571 3:148958309-148958331 GTGTGGCTGGGCAGGGGAGATGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964282187 3:155079511-155079533 ATGTGAGGGGGCCGGGGAGACGG - Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964922548 3:161914873-161914895 ATGCGAAGGGGGAGGGGAGACGG + Intergenic
965216296 3:165868574-165868596 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
965519822 3:169661300-169661322 GTGTGTGTGGGGGGGGGAGTTGG - Intronic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
967531729 3:190555317-190555339 CTGAGAGTAGGGAGTAGAGAAGG - Intronic
967712774 3:192727957-192727979 AAGTCAGTGGGGAGAGGAGAGGG - Intronic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968367616 3:198199156-198199178 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968369218 3:198211958-198211980 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968576310 4:1367842-1367864 GTGTGTGTGGGGTGGGGACAGGG - Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968965714 4:3768158-3768180 CAGGGAGTGGGGAGGAGAGAGGG + Exonic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
969594285 4:8140096-8140118 CTGTCAGAGGGGTGGGGGGAGGG + Intronic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
970960991 4:21871235-21871257 CGGGGAGGGGGGAGGGGGGAGGG - Intronic
971313415 4:25546515-25546537 CAGTGAGTGGGGAGGTGGTAGGG + Intergenic
971412093 4:26384913-26384935 AAGAGAGAGGGGAGGGGAGAGGG - Intronic
971412102 4:26384937-26384959 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971412108 4:26384949-26384971 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
971412114 4:26384961-26384983 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
971645800 4:29200845-29200867 CTGTCAGTGGGGTGGAGGGAGGG + Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973136157 4:46709160-46709182 CTCTCAGTGGGGAGGTGAGCTGG - Intergenic
973570479 4:52233939-52233961 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
974890354 4:67874579-67874601 ATGGGAGTGAGGAGGTGAGAAGG + Intronic
975592349 4:76012436-76012458 CCCTGCGTGGGGAGAGGAGAGGG - Intronic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
976432623 4:84980831-84980853 ATGGGTGGGGGGAGGGGAGAGGG - Intergenic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977844737 4:101755052-101755074 GTGGGAGTGGGGTGGGGATAAGG + Intronic
978147997 4:105399707-105399729 CTGTTAGGAGGCAGGGGAGAGGG + Intronic
978577722 4:110202805-110202827 CTGAGAGTGGGCAGGGGCTAGGG + Intergenic
978730997 4:112026116-112026138 CTGTCAGCAGGGAGGGGAAAGGG + Intergenic
979256031 4:118608868-118608890 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979257643 4:118621686-118621708 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979330704 4:119418876-119418898 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979332313 4:119431669-119431691 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979858543 4:125664813-125664835 CTGTCAGTGGGAAGGGGAGCTGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980076629 4:128300711-128300733 ATGTGAGTTGGGAGTGGACAAGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980137511 4:128872937-128872959 CTGTGAGTGGGTTGTGGATATGG + Exonic
980448109 4:132938214-132938236 CAGTGACTGGGAAGGGTAGATGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980492935 4:133552794-133552816 CTTTCAGTGGGAAGGGGAGCTGG + Intergenic
980604457 4:135071218-135071240 GTGGGAGGGGGGAGGGGGGAGGG + Intergenic
980627489 4:135391922-135391944 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
980749679 4:137071831-137071853 CTAGGAGTGGGGATGGGGGAAGG - Intergenic
980896941 4:138869004-138869026 AGGGGAGAGGGGAGGGGAGAGGG + Intergenic
980980684 4:139652238-139652260 CTGAGAGTTGGGAGGGCAGGAGG + Intergenic
981443942 4:144813007-144813029 CTGTCAGTGGGTAGGGGGAAAGG + Intergenic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
981910799 4:149979480-149979502 CTGTCAGGGGGTAGGGGACAAGG + Intergenic
981978726 4:150765491-150765513 CTATGAGTGTGTAGGGGAAAGGG + Intronic
982085294 4:151829511-151829533 CTGGGAGTGGGGTGTGGTGAGGG + Intergenic
982481009 4:155909921-155909943 AGGGGAGAGGGGAGGGGAGAGGG - Intronic
982671045 4:158320404-158320426 CTCTGAGTGGGAAGGGGAGCTGG + Intronic
982745386 4:159100978-159101000 GTGCAAGTGGGGTGGGGAGAGGG + Intergenic
983172528 4:164552101-164552123 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
983749315 4:171245541-171245563 CTGTCAGCGGGGCGCGGAGAGGG - Intergenic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
984245939 4:177275344-177275366 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
984417220 4:179477214-179477236 CTCTCAGTGGGGTGGGGAGCTGG - Intergenic
985174400 4:187186085-187186107 CTGTGTGTGGGTAGTGGTGATGG - Intergenic
985658048 5:1142282-1142304 GGGCGAGGGGGGAGGGGAGAGGG - Intergenic
985658097 5:1142406-1142428 GAGAGAGTGAGGAGGGGAGAGGG - Intergenic
985658125 5:1142483-1142505 AGGGGAGTGGGGAGGGGAAAGGG - Intergenic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985836851 5:2277947-2277969 CTGTGAGTCGTCACGGGAGAGGG + Intergenic
986076192 5:4340428-4340450 CTCTCAGTGGAGAGGGGAGTTGG + Intergenic
986222966 5:5787050-5787072 ATGTGAGTGGGGAGGAGTGGGGG + Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987524770 5:19032998-19033020 CAGAGACTGGGGAGGGGAGGTGG + Intergenic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988361329 5:30239864-30239886 CTCTCAGTGGAGAGGGGACATGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
988631536 5:32936886-32936908 GGGGGAGTGGGGAGGGGGGAGGG - Intergenic
988635006 5:32973705-32973727 AACTGAGTGGGGAGGGGAAATGG - Intergenic
988782733 5:34538140-34538162 CTTTCAGTGGAGAGGGGACAGGG + Intergenic
988860190 5:35269311-35269333 CTAAGATTGGGGAGGGGTGAAGG - Intergenic
989775657 5:45204083-45204105 TTGTGAGTGGGTAGTGGACAAGG - Intergenic
990167594 5:53011729-53011751 ATGTGAGTGGGGGGGAGTGAGGG + Intronic
990598774 5:57336644-57336666 TGGAGAATGGGGAGGGGAGATGG - Intergenic
990605926 5:57410078-57410100 TTGTGAGTGGGGTGGGGGTAGGG + Intergenic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
991039749 5:62162918-62162940 CTGGGAGTGGGGAGAGGCCAGGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
992549004 5:77844193-77844215 CTCTCACTGGGGAGGGGGGAAGG - Intronic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
993170666 5:84415166-84415188 CTGGGAGAGGGGAGTGGAAATGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993525737 5:88963448-88963470 GGGGGAGGGGGGAGGGGAGAGGG + Intergenic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
993644205 5:90443160-90443182 TGGGGAGTGGGGAGGGGGGAGGG - Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
994139874 5:96330352-96330374 GTGTCAGTGAGGAAGGGAGAAGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
996287187 5:121808205-121808227 CTGTTAGTGGTGGGGGGCGAGGG - Intergenic
996321467 5:122222169-122222191 CTGGGAGTGGGGAGTTGGGAAGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996361093 5:122647642-122647664 CTGTGAAGGGTAAGGGGAGAAGG + Intergenic
996462336 5:123760668-123760690 CTGTGAGTGGTTGGGGGAGTGGG - Intergenic
996496846 5:124168151-124168173 CTGTCAGGGGGCTGGGGAGAGGG - Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997249963 5:132380928-132380950 AGGGGAGTGGGGAGGGGAGGGGG + Intronic
997321816 5:132983941-132983963 CCGTGGGGGGGGGGGGGAGAGGG + Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
997731895 5:136187568-136187590 CTGTGATTGGGGAGGCAATATGG + Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
998590902 5:143477113-143477135 CTGTAAATGGGAAGAGGAGAGGG - Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999103697 5:149049891-149049913 CTGGTAGTGGGGAGGTGAGGAGG - Intronic
999418836 5:151422941-151422963 TTGTGTGTGGGGAGTGGAGTGGG - Intergenic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000400609 5:160823384-160823406 CAGGGAGTGGGGTGGGGTGAGGG + Intronic
1000421206 5:161039897-161039919 CTGTCAGTGGGTAGGGGGCAAGG + Intergenic
1000421256 5:161040362-161040384 CTGTCAGTGGGTAGGGGGCAAGG + Intergenic
1000444452 5:161302641-161302663 TTGTGTGTGGGTAGAGGAGATGG + Intronic
1000621384 5:163489904-163489926 CTGGGAGTGGGAAGAGGGGAAGG + Intronic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001501172 5:172235890-172235912 CAGCGAGTGGGAAGGAGAGAGGG + Intronic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1001995366 5:176153107-176153129 CAGGGAGTGGGGAGGGGAATAGG - Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002467768 5:179416336-179416358 CTGGGTGTGGGGAGGGGCGTGGG - Intergenic
1002726839 5:181304385-181304407 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002728496 5:181317543-181317565 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003116449 6:3286838-3286860 CCGTGAGTGGGTCGGGGAGGTGG - Exonic
1003256682 6:4481276-4481298 GTGTGAGTGGGGAGAGCACAAGG - Intergenic
1003435825 6:6087095-6087117 CTGTGAGTGGGGCAATGAGATGG + Intergenic
1003480000 6:6522158-6522180 GTGTGAGTGCAGTGGGGAGAAGG - Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003564931 6:7214805-7214827 GTGTTGGTGGGGAGTGGAGAAGG - Intronic
1003779767 6:9411451-9411473 AAGAGAGGGGGGAGGGGAGAGGG + Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004653071 6:17630730-17630752 AGGGGAGAGGGGAGGGGAGAAGG + Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1005046996 6:21652290-21652312 TGATGTGTGGGGAGGGGAGATGG + Intergenic
1005057269 6:21741356-21741378 GGTGGAGTGGGGAGGGGAGAGGG + Intergenic
1005070651 6:21859219-21859241 AGGACAGTGGGGAGGGGAGAGGG + Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005673006 6:28125853-28125875 CTGTGAGTGATCAGGGGATATGG + Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006417467 6:33913212-33913234 CTGTGCCTGGGTAGGGGAGCAGG - Intergenic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1006683699 6:35814997-35815019 CTGAGAGTGTAGAGGGGTGAGGG - Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006952217 6:37832212-37832234 CTGGCAGTGGGGAGTGAAGAGGG + Intronic
1006984178 6:38166615-38166637 CTGTGAGGGCGGCGGGGAGGTGG - Intergenic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007147821 6:39654270-39654292 CTGAGAGTGGAGAGAGGAGCTGG - Intronic
1007371954 6:41431953-41431975 CTGGGAGAGGTGAGAGGAGATGG + Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007589456 6:43012666-43012688 CGGGGATTGGGGAGGGGAGCTGG - Intronic
1007593480 6:43037566-43037588 ATTTGAGTGGGGAGGTGGGAGGG - Intergenic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007693919 6:43719713-43719735 CTGGCAGTGGGGCGGGGAGAGGG + Intergenic
1008717351 6:54305284-54305306 CTGGGAGTAGGGGAGGGAGAAGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1009994964 6:70887501-70887523 CTGTGAGTGGGGCTGAGTGACGG - Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010556156 6:77281947-77281969 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1011032679 6:82940675-82940697 CTGAGAGTGGGTAGGGAAGAAGG - Intronic
1011046222 6:83086393-83086415 CTGTGAGTGGGCAGAGGAAGAGG + Intronic
1011300006 6:85863931-85863953 GTGGGAGTGGGGAGTGGACAAGG + Intergenic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011863106 6:91785587-91785609 CTCTGAGTGGGGTGGGGACTTGG - Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012082524 6:94779579-94779601 CTGTCAGTGGGTAGGGGGCAAGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012402148 6:98849551-98849573 CTGGGAGGGGGTGGGGGAGATGG - Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012692725 6:102335103-102335125 CTTTCAGTGGGAAGGGGAGCTGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012925512 6:105263357-105263379 CTGTGAGAGGGGAGGACACAGGG + Intergenic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1012950982 6:105517605-105517627 CTGTGAGGGAGGCGGGGAAATGG + Intergenic
1012967555 6:105691249-105691271 ATGTGTGTGGGGAGGGGTCAGGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013627948 6:111956312-111956334 CAGAGAGTGGGGAGAGGAGATGG + Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013911274 6:115278778-115278800 CAGCTTGTGGGGAGGGGAGAAGG + Intergenic
1013974370 6:116060189-116060211 CTGTGACTGGGGAGAGCAAAGGG + Exonic
1014151890 6:118066899-118066921 CTTTCAGTGGGGCGGGGTGAAGG - Intronic
1014740507 6:125143440-125143462 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
1015334568 6:132022491-132022513 GTGAGAGTGGGGAAAGGAGAAGG + Intergenic
1015631319 6:135234838-135234860 CTTTGAGGCGAGAGGGGAGAAGG - Intergenic
1015912520 6:138183149-138183171 CCGTGACTGGGAAGGGCAGAGGG + Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016205773 6:141466743-141466765 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016301809 6:142640125-142640147 ATGTGATTGGGGAAGGCAGATGG + Intergenic
1016546423 6:145229267-145229289 GTGGGAGAGGGGAGGGGAGGAGG - Intergenic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1016839196 6:148508802-148508824 CTCCGAGTGGGGAGGGGGGTGGG + Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017115932 6:150976243-150976265 CTGGGAGCTGGGAGGGGAGCTGG + Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017410402 6:154161967-154161989 CTGCGAGTGAGGATGAGAGAGGG - Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1017770390 6:157639725-157639747 CCGTGCCTGGGGAGGGGTGAGGG + Intronic
1017791900 6:157807196-157807218 ATTTGAGTGGGGCAGGGAGAAGG + Intronic
1017804850 6:157935788-157935810 CTGCCAGTGGGGAAGGCAGATGG + Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1019205192 6:170355560-170355582 CTGTGAGGGGGTCGGGGAGGGGG + Intronic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019474816 7:1238941-1238963 GTGGGAGTGGGGGCGGGAGAAGG - Intergenic
1019529359 7:1495851-1495873 GCGGGAGTGGGGAGGGGAGGTGG - Intronic
1019564962 7:1674591-1674613 CAGTGAGGGGGGTGGGGAGAGGG + Intergenic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1020007416 7:4789987-4790009 AGGGGAGGGGGGAGGGGAGAGGG - Intronic
1020032243 7:4941055-4941077 CTGTGAGTGGGGTTAGGAGGAGG + Intronic
1020140236 7:5607788-5607810 CTTTCATGGGGGAGGGGAGAGGG - Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021340877 7:19460851-19460873 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021784247 7:24136520-24136542 CCCTCAGTGGGGAGGGGAGGTGG - Intergenic
1021859723 7:24894558-24894580 CTGTGCTTGGGGCGGGGAGGGGG + Intronic
1021940779 7:25677158-25677180 CTGGGACTGGGGACGGGAGGTGG + Intergenic
1021993219 7:26155982-26156004 CAGTGAGTGGGGACAGGTGAAGG - Intronic
1021994006 7:26162343-26162365 AATTGAGTGGGGAGGGGTGAAGG + Intronic
1022204206 7:28147773-28147795 CTGGGAGTGGGCTGGGGGGAGGG + Intronic
1022221430 7:28317417-28317439 CTTTGAGTGGGCAGGGGAAGAGG + Intronic
1022245118 7:28551686-28551708 TGGTGAGTCGGGAGGGGACAAGG + Intronic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022578834 7:31527154-31527176 CTTTGCATGGGGTGGGGAGAAGG - Intronic
1022580912 7:31553225-31553247 CTGTGAGTGGTGAGGGATGTGGG + Intronic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1023062680 7:36343454-36343476 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023062686 7:36343466-36343488 AGGGGAGAGGGGAGGGGAGAGGG + Intronic
1023405234 7:39826727-39826749 TTGTGACTGGTGAGGGGAGGGGG + Intergenic
1023500491 7:40844387-40844409 CTCTCAGTGGGAAGGGGAGCTGG + Intronic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023841406 7:44100634-44100656 CGGGGAGTGGGGAGGGGGGCAGG - Intergenic
1023878386 7:44305326-44305348 CTGTGCCTGGCTAGGGGAGAGGG - Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024071732 7:45791998-45792020 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1024118274 7:46213038-46213060 CTCCCAGTGGGGAGGTGAGAAGG + Intergenic
1024320484 7:48062205-48062227 CTGTGAGTGCTGAGAGGAAAAGG + Intergenic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1024570908 7:50722206-50722228 ATGAGAGTGGGCAGGGCAGAGGG - Intronic
1024650769 7:51401433-51401455 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1024728501 7:52228720-52228742 GTGGGTGTGGGAAGGGGAGAGGG + Intergenic
1024971765 7:55078165-55078187 TGGCGTGTGGGGAGGGGAGAAGG + Intronic
1025054890 7:55757013-55757035 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025132963 7:56387239-56387261 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025909515 7:65817104-65817126 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025911028 7:65828827-65828849 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026375108 7:69742127-69742149 TTTTGAGGGGGGAGGGCAGATGG + Intronic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1026829176 7:73600754-73600776 CTCTGAGTGGGGTGGGGCAAGGG + Intronic
1026830189 7:73605879-73605901 CTGAGAAAGGGCAGGGGAGAGGG - Intronic
1026918708 7:74139429-74139451 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027050030 7:75016122-75016144 CCCTGAGTGGGGAGGGGGCACGG - Intronic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027583472 7:80026545-80026567 CTGTCAGGGGGCAGGGGAAAAGG + Intergenic
1028261479 7:88672184-88672206 CTAAGAGTTGGGAGCGGAGAAGG + Intergenic
1028467006 7:91163757-91163779 CTGGGAGTGGGGTAGGGTGAGGG - Intronic
1028705582 7:93841189-93841211 GTGGGAGTAGGGAGAGGAGAGGG - Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028896315 7:96045882-96045904 CTGGGAATGGGAAGGGGAGACGG + Intronic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029383008 7:100225546-100225568 CCCTGAGTGGGGAGGGGGCACGG + Intronic
1029475972 7:100784833-100784855 CTGTGAGTGGGCATGGGAAATGG + Exonic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1030787864 7:113684694-113684716 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1031466249 7:122115775-122115797 CTGTGATTGGGGAAATGAGAAGG + Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1031966702 7:128032309-128032331 CGGGGAGGGGGGAGGGGGGAGGG - Intronic
1032048349 7:128629604-128629626 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032049950 7:128642427-128642449 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032115182 7:129110871-129110893 CTGTGAGTGGGCAGTGGAGGAGG + Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032836886 7:135682916-135682938 CAGTAAGATGGGAGGGGAGAGGG + Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1032928414 7:136636803-136636825 GGGTGAGGGGAGAGGGGAGAGGG + Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1033681636 7:143601087-143601109 CTGTCAGTGGGGTGGGTAGCGGG + Intergenic
1033703256 7:143860726-143860748 CTGTCAGTGGGGTGGGTAGCGGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034618864 7:152441459-152441481 CTGTGAGTGGGGAAAGCACAAGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034975950 7:155449393-155449415 CCGTGCGAGGGGAGGGGAGGGGG - Intergenic
1035127018 7:156616307-156616329 CTGAGACTGTGGAGGGGTGACGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035379434 7:158428180-158428202 CTGTAAGAGGGCAGGGGAGCTGG + Intronic
1035435891 7:158858912-158858934 AGGGGAGGGGGGAGGGGAGAGGG - Intronic
1035572062 8:679216-679238 CTGTGAGTTGGGAGCTGTGAGGG - Intronic
1035656756 8:1313771-1313793 TTATGTCTGGGGAGGGGAGAAGG + Intergenic
1035768451 8:2127263-2127285 ACCTGACTGGGGAGGGGAGATGG + Intronic
1035825887 8:2643813-2643835 TTGTGTGTGGGGGGGAGAGAAGG + Intergenic
1035955160 8:4069542-4069564 CTGTGAATGGGAGGCGGAGAGGG - Intronic
1036108439 8:5870586-5870608 CTTTGAATGGAGAGGAGAGATGG + Intergenic
1036217125 8:6889918-6889940 CTGAGACTGGGGAGGGGACGGGG - Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036608348 8:10328244-10328266 CAATGAGTGGGGAGGGGGGAGGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037594496 8:20343532-20343554 CTGTCAGTGGAGGGGGGAGCTGG + Intergenic
1037609650 8:20465301-20465323 CTGTGAGTAGGCAGGGGTGTTGG + Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1037772414 8:21810349-21810371 CAGTGAGGGGGGTGGGCAGAGGG - Intronic
1037802577 8:22043569-22043591 ATGGGAGTGGGGTGGCGAGAAGG - Intronic
1037808237 8:22070103-22070125 GTGTGAGGGGGGAGGGGTGAAGG + Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1038215975 8:25562074-25562096 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1038228411 8:25678251-25678273 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1038286008 8:26207026-26207048 CTGTCAGTAGAGAGGGGAGCTGG - Intergenic
1038336361 8:26648915-26648937 CAGTGAGTGGTGGTGGGAGAGGG - Intronic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038761037 8:30384470-30384492 CGGAGAGGAGGGAGGGGAGAGGG + Intronic
1038942000 8:32315232-32315254 CTGTCAGGGGGGTGGGCAGAGGG - Intronic
1038956158 8:32470628-32470650 GTGTGAGTGGGGGAGAGAGAAGG + Intronic
1039085534 8:33776144-33776166 GTGACAGTGGGGAGGAGAGAAGG + Intergenic
1039103973 8:33970598-33970620 CTGTCAGTGGGATGGGGAGCTGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039601805 8:38845307-38845329 ATGGGAGTGGGAAGGGGACAGGG - Intronic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039620045 8:38988472-38988494 CTGGCAGTGGGTAGGGTAGAGGG + Exonic
1039868989 8:41529448-41529470 CTGAGAGGGAGGAGGGGAGGGGG + Intronic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041131957 8:54710653-54710675 CTGTCAGCGGAGAGGGGAGCTGG + Intergenic
1041314706 8:56549171-56549193 GGGGTAGTGGGGAGGGGAGAGGG - Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042166673 8:65952222-65952244 CTTTCAGTGGGGAGCAGAGATGG - Intergenic
1042238700 8:66640791-66640813 CTCTCAGTGGGGTGGGGAGCTGG - Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042324799 8:67517355-67517377 ATGTTAGTGGGGCGGGGTGAAGG - Intronic
1042339720 8:67666410-67666432 CTGAGAGAGGGGTGGGGAGGGGG + Intronic
1042476011 8:69247909-69247931 CTAGGAGTGAGGAGAGGAGATGG - Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043722672 8:83565584-83565606 GTGCGGGTGGTGAGGGGAGATGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044361014 8:91283728-91283750 CTGAGAGTTGGGAGTGGAGATGG - Intronic
1044418337 8:91961660-91961682 CTATGAGTGTGGTGGGGAGGGGG + Intronic
1044554656 8:93549791-93549813 CTGTCAGGGGGTCGGGGAGAGGG + Intergenic
1044935681 8:97291500-97291522 GTGGGAGTGGGGAGAGGAAATGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1046975838 8:120276352-120276374 CTCAGAGTGGGGAGGGTGGAAGG + Intronic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1047811832 8:128418782-128418804 GGGTGAGTCGGGATGGGAGATGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048483035 8:134819235-134819257 CTGGGAGTGGGAAGGGGAAGAGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048800412 8:138189279-138189301 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049163925 8:141115342-141115364 GTGGCAGTGGGGATGGGAGAGGG + Intergenic
1049307968 8:141917359-141917381 CGGGGAGTGGGGTGGGGGGAGGG + Intergenic
1049422652 8:142523773-142523795 CTGGGAGGGGGGTGGGGAGGGGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049634827 8:143682057-143682079 CTTTCAGTGGAGAGGGGACATGG + Intergenic
1049659320 8:143812668-143812690 CTGTCCCTGGGGAGGGGAGGTGG - Intronic
1049712411 8:144071256-144071278 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1049737698 8:144218674-144218696 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1051357748 9:16255102-16255124 CAGGGAGTGGGGAGTGGAGCAGG - Intronic
1051376804 9:16410269-16410291 GTGTGAGGGGAGAGGGGAAATGG + Exonic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051561107 9:18441160-18441182 CTGGGAGTGGGGAGAGGAATGGG + Intergenic
1051996126 9:23219941-23219963 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1052165366 9:25319786-25319808 CTGTCAGGGGGGTGGGGGGAGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052608172 9:30732552-30732574 CTGGGAGTGGGGAATGGAGTGGG + Intergenic
1052903792 9:33817217-33817239 CTGCGCGGGGGGAGGGGCGACGG - Intergenic
1053152552 9:35752158-35752180 CTGTTACTGGAGAAGGGAGAGGG + Intronic
1053281926 9:36826124-36826146 CTGGGGGTGGGGGGGGGAGGGGG - Intergenic
1054832562 9:69643045-69643067 CTGTGTGTGGAGGGGGGAGGAGG - Intronic
1054901143 9:70370745-70370767 TTGTCAGAGGGGAGGGGAGGGGG + Intergenic
1055237703 9:74143876-74143898 ATGGGAATGGGGAAGGGAGATGG - Intergenic
1055246156 9:74246177-74246199 ATGTGAGTTGGCAAGGGAGAAGG + Intergenic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1055447118 9:76394432-76394454 GTGTGAGCGGGGTGGGGGGAGGG + Exonic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1056059560 9:82870235-82870257 CTCTTAGTGGAGAGGGGAGCTGG - Intergenic
1056332598 9:85534259-85534281 CTGTGAGTAGGGGGGCGAGGAGG - Intergenic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056551526 9:87656924-87656946 GAGTAAGGGGGGAGGGGAGAAGG + Intronic
1056891420 9:90497071-90497093 CTGTCAGGGGGTTGGGGAGAGGG + Intergenic
1056897693 9:90566350-90566372 TGGTGATGGGGGAGGGGAGATGG - Intergenic
1056990536 9:91406225-91406247 CTGTGAGTGGGAAGGAGAGGCGG + Intergenic
1057291988 9:93812714-93812736 GTGTGAGTGGGGAGTGGACGTGG + Intergenic
1057310218 9:93938345-93938367 CAGTGAGTGGGGAGAGGGGGTGG + Intergenic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057498498 9:95578587-95578609 AGGGGAGTGGGGAAGGGAGACGG - Intergenic
1057517277 9:95732408-95732430 CTGAGTGTGGGGAGTGGTGAGGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057652628 9:96931802-96931824 CTGTGTGTTGGGCCGGGAGAGGG - Exonic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057869566 9:98708167-98708189 GTGTGTGTGGGGAGGGGTGGGGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1058669336 9:107347449-107347471 CTCAAAGTGGGGAGGTGAGATGG + Intergenic
1058729790 9:107838793-107838815 CTGTGAAGGGGCAGGGGATAAGG + Intergenic
1058763611 9:108160497-108160519 ATGTGAGCAGGGAGTGGAGAGGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059182292 9:112228704-112228726 CTGGGAGTGGGGAGAGGAAAGGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059447586 9:114348490-114348512 CTGTGAGTGGAGAGCGGACAGGG + Intronic
1059700284 9:116769334-116769356 CTGTGAGTGATGAGTGTAGAAGG + Intronic
1059907417 9:119003615-119003637 GTGTGTGTGGGCAGGGGAGGTGG - Intergenic
1060068816 9:120528935-120528957 CTTTGGGTGGGGTGGAGAGAGGG - Intronic
1060183213 9:121547920-121547942 ATGGGAGTGGAGAAGGGAGATGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1060278393 9:122199378-122199400 CTTTCAGTGGGGAACGGAGAGGG - Intronic
1060686873 9:125622808-125622830 CGGAGAGGGGAGAGGGGAGAGGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061559487 9:131393847-131393869 CTGGGAGTGGGGAGGGGCCCGGG - Intergenic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1061674839 9:132209813-132209835 GGGGGAATGGGGAGGGGAGAGGG + Intronic
1061742897 9:132720290-132720312 CTGGGAGTGGGGTGGGGAGGAGG + Intergenic
1061762164 9:132858424-132858446 CTGAGAGTGGGGCCTGGAGATGG - Intronic
1061916679 9:133759236-133759258 CAGGGAGTGGGGAGGGGTGGGGG - Intergenic
1062185649 9:135216871-135216893 GTGTGAGTGAGGAGGGGGAAGGG + Intergenic
1062389175 9:136327355-136327377 CGGGGAGGGGGGAGGGGGGAGGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062722176 9:138050253-138050275 CTGGGAGCGGGGCGGGGAGCTGG + Intronic
1062751957 9:138261861-138261883 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1062753559 9:138274642-138274664 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203782453 EBV:108185-108207 CTGGGAATGGAGAGGGGAGTGGG + Intergenic
1203464872 Un_GL000220v1:75875-75897 TGATGAGGGGGGAGGGGAGAAGG + Intergenic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1203576071 Un_KI270745v1:9421-9443 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1185459548 X:328353-328375 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459565 X:328381-328403 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459576 X:328401-328423 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459587 X:328421-328443 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459638 X:328525-328547 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459655 X:328553-328575 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459666 X:328573-328595 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459677 X:328593-328615 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459708 X:328655-328677 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459725 X:328683-328705 CGGGGAGAGGGGAGGGGGGATGG - Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185503684 X:617451-617473 TTTTGAGGGGGGTGGGGAGATGG + Intergenic
1185600641 X:1336687-1336709 CTGGCAGTGGGGAGGGGTGGGGG - Exonic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186068724 X:5794432-5794454 GGGGGAGTGGGGAGGGGGGAGGG - Intergenic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187108450 X:16269843-16269865 CGGTGGGTGGGGTGGGGGGAGGG - Intergenic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1187936482 X:24341187-24341209 AGGTGAGTGGGCAGGGAAGATGG + Intergenic
1188368153 X:29335273-29335295 CGGAGAGGGGAGAGGGGAGAGGG + Intronic
1188656693 X:32706233-32706255 GGGGGAGTGGGGAGGGGGGAGGG + Intronic
1189235099 X:39480871-39480893 AGGGGAGTGGAGAGGGGAGATGG + Intergenic
1189450299 X:41122793-41122815 CTGTCAGTGGGATGGGGAGCTGG + Intronic
1189843894 X:45114157-45114179 TTTTGTGGGGGGAGGGGAGAGGG + Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1189900340 X:45699973-45699995 TTGTGAGTGGGGAGTACAGAAGG + Intergenic
1189917892 X:45875051-45875073 CAGTGACTGGGGAGAAGAGAAGG - Intergenic
1190122459 X:47673204-47673226 CTGTCAGGGGGTAGGGGACAAGG - Intergenic
1190190328 X:48271672-48271694 CGGTGCATGGGGAGAGGAGAGGG + Intronic
1190244413 X:48681757-48681779 CTGTGAGTGGGGACACGGGAGGG + Intronic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190309461 X:49106547-49106569 CTGTGAGTGGGGACATGGGAGGG + Intergenic
1190598458 X:52067898-52067920 CTGTGAATGGGGGAGGGAGGAGG - Intronic
1190610366 X:52186175-52186197 CTGTGAATGGGGGAGGGAGGAGG + Intronic
1190659064 X:52638164-52638186 CGGTGCATGGGGAGAGGAGAGGG + Intergenic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1191016274 X:55813464-55813486 CTGGGAGTGGGGAGAGGCCAGGG - Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193669733 X:84369515-84369537 CTGTTAGTGGGAATGTGAGATGG - Intronic
1193761560 X:85473180-85473202 GTGTGAATGGGAAGTGGAGATGG + Intergenic
1193790117 X:85807585-85807607 CTTTGAATGGGGTGGGGAGGTGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194803049 X:98294928-98294950 CTGTAAGTTGTGAGGGCAGAGGG + Intergenic
1194871735 X:99140980-99141002 CGATCCGTGGGGAGGGGAGAGGG - Intergenic
1195093427 X:101485297-101485319 CTGTGCGTGCGGAGTGGAGGAGG + Intronic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195310705 X:103629441-103629463 CGGGGAGTGGGGAGGAGGGACGG - Intronic
1195803561 X:108737052-108737074 GTGAGAGGGGAGAGGGGAGAGGG + Intergenic
1195818455 X:108915172-108915194 AAGGGAGTGGGGTGGGGAGAAGG + Intergenic
1195858768 X:109358491-109358513 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1196033177 X:111113759-111113781 GGGGAAGTGGGGAGGGGAGAGGG - Intronic
1196067405 X:111479683-111479705 CAGAGACTGGGGAGGGGATAAGG - Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196237463 X:113299815-113299837 AGGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196237479 X:113299851-113299873 GAGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196816054 X:119666387-119666409 CCCAGAGTGGGGAGGGGAGATGG - Intronic
1196818253 X:119682446-119682468 ATGTAATTGGGGAGGGGAGTGGG - Intronic
1196819587 X:119692591-119692613 CGGTGAGTGGCGAGGGGGGCGGG - Intronic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1197321019 X:125031104-125031126 CTTAGAGTGGGGAGGGAGGAGGG - Intergenic
1197527291 X:127578264-127578286 CAGTGAGTGGTGGTGGGAGAGGG - Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1197554984 X:127942084-127942106 CTGTGGGTGGGGAGTGGTGGGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197795077 X:130289801-130289823 CTGTCAGGGAGCAGGGGAGAGGG + Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198372795 X:136007352-136007374 CTGTGATGGGGGTGGGGTGAGGG - Intronic
1198383509 X:136105700-136105722 CTTTAAGTGGAGAGGGGTGAGGG + Intergenic
1199219893 X:145305912-145305934 CTTTCAGTGGGAAGGGGAGGTGG + Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199438711 X:147843918-147843940 CTATGAGTGGGAGAGGGAGAGGG + Intergenic
1199663386 X:150076520-150076542 CTGTTAGTGGGAATGGAAGATGG - Intergenic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199894534 X:152117781-152117803 GTGGCAGTGGGGAGGGGGGAAGG + Intergenic
1199928105 X:152490726-152490748 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1200040168 X:153359265-153359287 ATGAGATTTGGGAGGGGAGAGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200644907 Y:5770395-5770417 CTGTCAGTGGGTGGGGGAAAAGG - Intergenic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201320509 Y:12693581-12693603 CTTTCAGTGGGGAGGGGACAAGG + Intergenic
1201578037 Y:15481239-15481261 CGGTAAATGGGTAGGGGAGATGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201634305 Y:16105103-16105125 CTGTCAGTGGGATGGGGAGCTGG - Intergenic
1202069711 Y:20978323-20978345 CTCTGAGGGGGGTGGAGAGAAGG + Intergenic
1202302006 Y:23426543-23426565 CTGGGAGTAGGGAGAAGAGATGG - Intergenic
1202568805 Y:26244055-26244077 CTGGGAGTAGGGAGAAGAGATGG + Intergenic