ID: 1151328680

View in Genome Browser
Species Human (GRCh38)
Location 17:73394145-73394167
Sequence CCTTGGATGGAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 389}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151328665_1151328680 28 Left 1151328665 17:73394094-73394116 CCTGTATCCACTCTAGGAGGCAG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 389
1151328663_1151328680 30 Left 1151328663 17:73394092-73394114 CCCCTGTATCCACTCTAGGAGGC 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 389
1151328670_1151328680 2 Left 1151328670 17:73394120-73394142 CCTAGAGGGTGATAAGGACAAGG 0: 1
1: 1
2: 1
3: 13
4: 190
Right 1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 389
1151328664_1151328680 29 Left 1151328664 17:73394093-73394115 CCCTGTATCCACTCTAGGAGGCA 0: 1
1: 0
2: 3
3: 11
4: 167
Right 1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 389
1151328666_1151328680 21 Left 1151328666 17:73394101-73394123 CCACTCTAGGAGGCAGAGACCTA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151328680 Original CRISPR CCTTGGATGGAGAGGCTGGA GGG Intronic
900278386 1:1848465-1848487 TCTTGGATGGAGGTGGTGGAAGG - Intronic
901159232 1:7162461-7162483 CCTGGGCTGGAGGGGCTGGGGGG - Intronic
901402879 1:9026300-9026322 CCCTGGATGGAATGGGTGGAGGG + Exonic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901510392 1:9715503-9715525 CCTTGGGTGGAGGGGCTGACCGG + Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
901919793 1:12527922-12527944 CCATGGTTGGAGATCCTGGAGGG - Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
903005543 1:20295734-20295756 CCATTGAGGGAGTGGCTGGAGGG + Intronic
903057155 1:20644227-20644249 CATGGGATGGATAGGATGGATGG + Intronic
903140936 1:21338910-21338932 CCTTGGCTGGGAAGGCAGGAGGG - Intronic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905279001 1:36837052-36837074 CCTGGGCTGGCAAGGCTGGAGGG - Intronic
907661950 1:56401402-56401424 CCCAGGAAGGAGATGCTGGAGGG - Intergenic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
911010723 1:93278060-93278082 CCTTGGAGGGGGAGGTTGCAGGG - Intronic
911704616 1:100997122-100997144 TATTGTATGGAGAGGCAGGAAGG - Intronic
913105870 1:115613555-115613577 GTTTGGCTTGAGAGGCTGGAAGG - Intergenic
914959764 1:152196076-152196098 TCTTGGATGGGGTGGCTGGCCGG + Intergenic
915140280 1:153763678-153763700 GCTTGGATGGGGAGGCTTTAGGG - Intronic
915367563 1:155324342-155324364 CCGAGGATTGGGAGGCTGGAAGG - Intronic
916857239 1:168762646-168762668 CGTTGGTTGCAGAAGCTGGAAGG + Intergenic
919793220 1:201305699-201305721 AGTTGGAGGGAGAGGCTGGCTGG - Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920667963 1:207980191-207980213 CCTTGGAGGCAGAGGTTGCAGGG - Intergenic
921709528 1:218359767-218359789 GTTTGTGTGGAGAGGCTGGAGGG + Intronic
922042272 1:221908095-221908117 CCTTGGAGGCTGAGGCCGGAGGG + Intergenic
922425028 1:225484579-225484601 GCTGGGAGGGAGTGGCTGGAAGG + Intergenic
922750374 1:228067451-228067473 CCTTGGATGGAGTGGGGAGAGGG - Intergenic
922987451 1:229876999-229877021 CCTTAGCTGGACAGGCTGGTTGG + Intergenic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
1062832399 10:614501-614523 CCTTGGCTGGAGAGCCTCGTGGG - Intronic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063955272 10:11259675-11259697 CCTTGGCTGGTGAGGCTGTTTGG - Intronic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067105746 10:43365050-43365072 CCTTGGGTGATGAGACTGGAAGG + Intergenic
1067358090 10:45549787-45549809 CCTGGGATGGAGAGAAGGGAAGG - Intronic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1067695677 10:48534072-48534094 CCTTGGAGGGGGAGGCAGTAGGG + Intronic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1073148253 10:101294414-101294436 GCTTGAATGAAGAGGCAGGAGGG + Intergenic
1074445995 10:113521328-113521350 GCCTGGATGGAGAGGCTGGTCGG + Intergenic
1075259480 10:120950007-120950029 CCTTGGAAGGAAAGGCAAGAGGG + Intergenic
1075570298 10:123536772-123536794 CTTTGGATCGAGTGACTGGAAGG + Intergenic
1075643103 10:124079569-124079591 CCTGGGATGGAGAGGCAGCCTGG + Intronic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1076318391 10:129559924-129559946 CCTTGGATGGTCAGCATGGAAGG + Intronic
1077010983 11:379230-379252 CCCTGGAGGGGGTGGCTGGAAGG + Intronic
1077347618 11:2071273-2071295 CCTTGGGTGGAGTGCCTTGAGGG - Intergenic
1079132497 11:17755661-17755683 CATGAGATGGAGAGGCTGCAGGG + Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1081099977 11:38989324-38989346 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1081827426 11:46070404-46070426 CCCTGGAGGCAGAGGCTGCAGGG - Intronic
1082233654 11:49798225-49798247 TCCTGGATGGAGCGGCTGGCTGG + Intergenic
1083839287 11:65294567-65294589 CCGTTTATGGAGAGGCTGCAGGG - Exonic
1084118409 11:67055280-67055302 CCTTGGGTGGCAAGGCTGGAAGG - Intergenic
1084480292 11:69416018-69416040 CCTTGGAAGGTCTGGCTGGAGGG + Intergenic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1085643812 11:78209815-78209837 CCTTCGATGTACAGGCTGGTGGG - Exonic
1086110508 11:83193732-83193754 ACTTGGCTGGAGAGGCAGCAGGG - Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1089527782 11:119108123-119108145 CCCTGGAAGGAAAGGCTGAAGGG - Exonic
1089602576 11:119624532-119624554 CCTTTGATGAGGAGGCAGGAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091244597 11:134081447-134081469 CCATGGCTAGAGTGGCTGGAAGG - Intronic
1092132665 12:6123547-6123569 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1092401836 12:8184316-8184338 TCCTGGATGGAGCGGCTGGCCGG - Intronic
1093090118 12:14911351-14911373 CCCTGGGTGGAGTGGCTGGGTGG - Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093407170 12:18818678-18818700 CCTTGGATGAATAAGATGGAAGG - Intergenic
1096496500 12:52042140-52042162 TCTTGGCAGGATAGGCTGGAGGG + Intronic
1096741326 12:53695935-53695957 CCTTGGGTGGAGAGGCCAGGAGG + Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102002412 12:109565757-109565779 CCTTGGCTAGAGAGGCAGGGAGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1102895254 12:116593542-116593564 CCTGGGAAGTAGAGGCTGCAGGG + Intergenic
1105358752 13:19686552-19686574 CCCTGGATAGAGAAGTTGGATGG + Intronic
1105576232 13:21654963-21654985 CCTTTGATGGAGAGTCTGGTGGG - Intergenic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108147750 13:47497801-47497823 ACTTTGATGGTGAGTCTGGAGGG - Intergenic
1108719032 13:53111182-53111204 CCCTGGATGTAAAGGCAGGAGGG + Intergenic
1109206331 13:59487023-59487045 CGTTGGAGGTATAGGCTGGAAGG - Intergenic
1111235274 13:85400812-85400834 CATGGGATGGAGTGCCTGGAGGG - Intergenic
1111792899 13:92881259-92881281 TCTGGGATGGGGAAGCTGGAAGG - Intergenic
1111918153 13:94383193-94383215 CATAGGGTGGGGAGGCTGGATGG + Intronic
1112056096 13:95691035-95691057 TCCTGGATGGAGCGGCTGGCCGG + Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113304633 13:109064324-109064346 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1113513251 13:110872327-110872349 GCTTGGATGCAGAGGCTCCAGGG + Intergenic
1114222577 14:20710073-20710095 CCTTGGATGAAAAGGGTGAAGGG + Intergenic
1114524075 14:23357302-23357324 TCTTGGATGGCAGGGCTGGATGG + Exonic
1114962245 14:27908061-27908083 AATTGAATGGAGAAGCTGGAGGG + Intergenic
1115372856 14:32638131-32638153 CCTTAGATGTAGAGGCTGCTCGG - Intronic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1116467705 14:45253034-45253056 CCTTGGATGAAGAGCCTGGCAGG + Exonic
1117659241 14:57986874-57986896 CTTGGGATGGTGAGGCTGGCAGG + Intergenic
1117921762 14:60732003-60732025 CCTTGGATGAACACGTTGGAAGG + Intergenic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1120393977 14:83944435-83944457 CCATGGCTGGAGAGGCTGGGAGG + Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121377742 14:93430196-93430218 CCACGGATGGTGAAGCTGGAAGG - Intronic
1122460290 14:101888915-101888937 AGATGCATGGAGAGGCTGGAAGG - Intronic
1124085904 15:26550217-26550239 CCCTTGATGGAAAGGCTGTAGGG + Intronic
1125706863 15:41745678-41745700 CCTGAGATGTAGAGGCTGCAGGG - Intronic
1128541910 15:68541925-68541947 CCCTGGGTTGAGAGGGTGGAAGG - Intergenic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1129927294 15:79375914-79375936 CCTTGGATGCAGAGGATGACAGG - Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132259274 15:100407945-100407967 CCTTGGAGGCAGAGGTTGCAGGG - Intronic
1132439217 15:101841966-101841988 CCCTGGGTGGTGAGGCTGGCTGG + Intergenic
1132503175 16:293599-293621 TCTTGGATGAAGAGGTGGGAGGG + Exonic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132826860 16:1909475-1909497 CCTGGGATGGAGAGGCCTGTGGG + Intergenic
1133987408 16:10678940-10678962 GCTTTGCTGGAGAGGCAGGAAGG + Intronic
1135817847 16:25652244-25652266 CCATGGATGGAAGGGATGGAGGG + Intergenic
1136468729 16:30464065-30464087 CCCTGGATTTAGAGGCTGCAAGG - Intergenic
1137593811 16:49710559-49710581 CCGGGGATGGAGAGGATGCAGGG - Intronic
1137713488 16:50583410-50583432 CCTTGGTAGGGGTGGCTGGAAGG - Intronic
1137858922 16:51826492-51826514 CCCAGGAAGTAGAGGCTGGAGGG + Intergenic
1137974970 16:53023509-53023531 CCATGGGAGGACAGGCTGGAGGG + Intergenic
1138489415 16:57367457-57367479 CCTTGGATGGATGGGATTGATGG - Intergenic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1139359196 16:66386998-66387020 ACTTTGATGGTGAAGCTGGAAGG - Exonic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1139650459 16:68359647-68359669 CTTTGCCTGGTGAGGCTGGAGGG - Exonic
1140816445 16:78625313-78625335 CCTTGGATGGGGAGGCTCCAGGG - Intronic
1141082267 16:81062614-81062636 TGTTGCTTGGAGAGGCTGGAGGG + Intronic
1141337063 16:83165926-83165948 CAGTGGTGGGAGAGGCTGGAGGG + Intronic
1141576383 16:84966589-84966611 CCAGGGAAGGAGGGGCTGGAGGG + Intergenic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141671708 16:85495570-85495592 CCCTGGAGGTAGAGGCTGCAGGG - Intergenic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1142073403 16:88103647-88103669 CCTGGGATGCCGAGGCTGGGTGG + Intronic
1142093142 16:88225789-88225811 CCCAGGATGGAGATGCTGGCAGG - Intergenic
1143102899 17:4513993-4514015 CCCTGGAGGGAGGGGCTGGTGGG - Intronic
1143261414 17:5601445-5601467 CTTGGGATGGAGAGACTGGGAGG + Intronic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146659896 17:34658797-34658819 CCCTGGATGCAGAGGCTACAGGG - Intergenic
1147136093 17:38434908-38434930 GGCTGGAAGGAGAGGCTGGAGGG + Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1150106285 17:62464805-62464827 CTGTGGGTGGAGGGGCTGGAGGG + Intronic
1150446735 17:65232163-65232185 CCAGGGATGGGGAGGCTGGGAGG + Intergenic
1151002443 17:70393364-70393386 CCTTAGAAGGAAAGGCAGGAAGG + Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151412235 17:73938695-73938717 CCTTGGAGGTGGATGCTGGAAGG + Intergenic
1151707024 17:75774510-75774532 CCTTGGAGGAGGATGCTGGAAGG + Intergenic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1152074539 17:78150747-78150769 CATTAGATGTAGAGGATGGAGGG + Intronic
1152257742 17:79249912-79249934 GCTAGGATGGTGAGGCTGGTGGG - Intronic
1152405804 17:80097134-80097156 CCCTGGATGGAGTGTGTGGAAGG + Intronic
1152493496 17:80653979-80654001 CCCTGGATGGCCAGGCTGTACGG + Intronic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1153793657 18:8602847-8602869 CCATGGATGGAGATGCTGGTGGG + Intergenic
1153947068 18:10027544-10027566 TCTGGGATGGGGAGGCTGGATGG + Intergenic
1154401842 18:14046223-14046245 CCTTGGGTGGGGAAGCTGGGAGG - Intergenic
1155464642 18:26120956-26120978 CCTGGGATGGAGTGCCTGGAGGG + Intergenic
1155553904 18:26996582-26996604 CATTGGCTGGAGAGGCTGCAAGG + Intronic
1157504437 18:48216750-48216772 CATAGGATGGAGAGGAGGGATGG - Intronic
1159914853 18:74179809-74179831 ACTTGGCTGGTGAGGCCGGAGGG + Intergenic
1160008880 18:75088876-75088898 CTATGGACTGAGAGGCTGGAGGG - Intergenic
1160429853 18:78803921-78803943 TGGTGGAGGGAGAGGCTGGAAGG - Intergenic
1160514819 18:79472422-79472444 CCTGGGAAGGAGAGGCTGCCGGG - Intronic
1160691795 19:463763-463785 CTTTGGCTGGAGGGGCTAGAAGG - Exonic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1161628485 19:5339936-5339958 CCCTGGGTGGGGAGGCTGGAAGG + Intronic
1161636487 19:5392568-5392590 CCTCCGCTGGAGAGGCAGGAAGG - Intergenic
1161862788 19:6810805-6810827 TGTTAGATGAAGAGGCTGGAGGG + Intronic
1162121626 19:8473165-8473187 CCTGGGATGTTGAGGCTGTAGGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1164401533 19:27905417-27905439 CCTTAGATGGGGAGGTTGGTGGG - Intergenic
1164460343 19:28442212-28442234 CCTTGAAACTAGAGGCTGGAAGG + Intergenic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1164708015 19:30334786-30334808 TCATGGATGGAGTGGATGGATGG + Intronic
1166235017 19:41449550-41449572 CCTTGGCTGGAGGGGCTGCAGGG - Intergenic
1166690274 19:44818339-44818361 TTTTGGTTGGAGAGCCTGGATGG + Intronic
1166887279 19:45969781-45969803 ACTTGGGTGAAGAGGTTGGACGG - Intronic
1167922862 19:52796540-52796562 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1168277225 19:55284728-55284750 CCCTGGATGGAGGGGGTGGGGGG + Intronic
925255703 2:2485251-2485273 CCTCTCCTGGAGAGGCTGGAGGG + Intergenic
926315110 2:11703987-11704009 CCTTGGTGGGGGTGGCTGGAAGG + Intronic
926322081 2:11755547-11755569 CCCTGGATGGCTGGGCTGGAGGG + Intronic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
929078441 2:38097720-38097742 GCTGGGAAGGAGAGGCTGGGTGG - Intronic
929435877 2:41927924-41927946 CTTTAGAAGGATAGGCTGGAGGG + Intergenic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
932478672 2:72024999-72025021 GCGTGGCTGGAGAGGCAGGAAGG - Intergenic
932553831 2:72799987-72800009 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
935334603 2:102004887-102004909 CCTTGGCTGGAGATGGTGGTGGG + Intronic
935443517 2:103131661-103131683 CCTAGGAGGTGGAGGCTGGAGGG + Intergenic
936042199 2:109158507-109158529 CCTTGGCTGGGGGAGCTGGATGG + Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
936698603 2:114982674-114982696 CCTGGGACGTAGAGGCTGCAGGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
942140342 2:172971251-172971273 ACTTGGAAGGAGTGGTTGGAAGG - Intronic
942337202 2:174901293-174901315 CCTTGCATGGACATGCTGGTCGG + Intronic
942988414 2:182169571-182169593 CCTTGGATGAAGAGGATTGGTGG + Intronic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
946104999 2:217361295-217361317 ACTTGGCTGGGGAGCCTGGAGGG + Intronic
947546152 2:231011733-231011755 CCTTGGCAGGACAGGCTGCATGG - Intronic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
948298702 2:236885616-236885638 CCATGGGTGAAGAGGGTGGATGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948796547 2:240405756-240405778 CCTCGGATGGAGTTGCTGGGTGG + Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
1169344790 20:4821646-4821668 CCTGTGCTGGGGAGGCTGGAAGG - Intronic
1169353916 20:4892148-4892170 CCTTGGATGCAGAGGCGGCTGGG - Intronic
1170523411 20:17212251-17212273 ACATGGATGGAGCTGCTGGAGGG + Intergenic
1170529926 20:17281107-17281129 CCTCAGATGGAGAGTCTTGAAGG - Intronic
1171321583 20:24248980-24249002 CCTTGGTGGGGCAGGCTGGAAGG - Intergenic
1172876928 20:38170066-38170088 CCATGCCTGGTGAGGCTGGAAGG - Intergenic
1173868833 20:46329497-46329519 CCTTGGAGGGAAGGGCTGGCTGG + Intergenic
1174033774 20:47652661-47652683 TTTTGGATGGAGAGGTTGAAAGG + Intronic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1176164110 20:63663933-63663955 CCTTGGAGGGACAGGGTGGGCGG + Intronic
1179054149 21:37916134-37916156 ACCTGGCTGGAGAGGCTGGGCGG - Exonic
1179633317 21:42691954-42691976 CTTTGGATGGAGATGGTGAAGGG - Intronic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1181174387 22:21027555-21027577 GGCTGGATGGAGTGGCTGGAAGG + Exonic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1181265010 22:21625854-21625876 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1182384672 22:29927731-29927753 CCTTGGATGGAGACTCTTTAAGG + Intronic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184418672 22:44366704-44366726 AATAGGATGGAGAAGCTGGAGGG - Intergenic
1184516754 22:44966914-44966936 AGTTGGATGGAGAGGCTGGGGGG - Intronic
1184980084 22:48089710-48089732 CCTGGGACGGAGACGCTGGGAGG - Intergenic
1185150183 22:49159793-49159815 CCTTTGATGGTGAAGCAGGAAGG - Intergenic
1185275854 22:49949970-49949992 CCTTGGCTGGAGAGGGGGGTGGG + Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
950939923 3:16883337-16883359 CCTGGGATGGAGAGGTGGGTGGG + Intronic
952739694 3:36723593-36723615 CCATGGCTGGAGCGGCTGGGAGG - Intronic
953034075 3:39196611-39196633 ACTTGGAGGGAGGGGCTGGTAGG - Intergenic
953993559 3:47502446-47502468 TCTTGGGTTGAGAGGCTGTATGG - Intronic
954245745 3:49330093-49330115 CCTGGGAGGGAGAGGTTGCAGGG + Intronic
954290631 3:49648177-49648199 CCTTGGAAGGGTAGTCTGGATGG - Intronic
954580173 3:51698988-51699010 CCTGGGATGGAAAGTCTGGTAGG + Intronic
954618139 3:51980728-51980750 CCTTGGATGGAAGAGTTGGATGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
956198241 3:66675444-66675466 GCTTGGGTGGATAGGCTGGGAGG - Intergenic
956319170 3:67976373-67976395 AATTTCATGGAGAGGCTGGAAGG - Intergenic
958611924 3:96436887-96436909 CCATGGCTGGAGTGGCTGGGAGG + Intergenic
961211698 3:125130744-125130766 GCCTGGAGGGAGAAGCTGGAGGG + Intronic
961642101 3:128371230-128371252 CCTTGGATGGATGGGGAGGAGGG + Intronic
961659270 3:128459777-128459799 CGAGGGATGGAGAGGCTGGGAGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962901226 3:139763563-139763585 TCCTGGATGGAGGGGCAGGAGGG - Intergenic
963519270 3:146345072-146345094 CCTTGGATGGAGCACCTGAAGGG - Intergenic
963947661 3:151163995-151164017 CCCGGCATGGGGAGGCTGGACGG - Exonic
964604296 3:158542653-158542675 CCTAGGATGGAAAGGTTGGAAGG + Intronic
967397506 3:189024133-189024155 CCTGGGATGGAGTGCCTGGAGGG - Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968912027 4:3481270-3481292 GCTTGGAGGAAGAGGCTGGCAGG + Intronic
969239450 4:5889118-5889140 GCTAGGATGGAGAGGGTGGCAGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
969333815 4:6495099-6495121 CCTTGGCAGGGCAGGCTGGATGG - Intronic
969352277 4:6604588-6604610 CGTTGGATGGGGATGCTGCAGGG + Intronic
970155663 4:13139537-13139559 TCTTGGAATGAGAAGCTGGAAGG - Intergenic
973973383 4:56238187-56238209 CATTGGCTGGGGAGGCTTGAAGG + Intronic
977545026 4:98367162-98367184 CCATAGCTGGAGTGGCTGGAAGG - Intronic
978265873 4:106823454-106823476 CCATGGCTGGAGTGGCTGCAAGG + Intergenic
979152754 4:117341412-117341434 CCTTGGAAGGAGACCCTAGAGGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981505522 4:145495117-145495139 AATTGGAGGGAGACGCTGGAGGG + Intronic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982371943 4:154643127-154643149 CCCTGGAGGGATATGCTGGAGGG + Intronic
983713488 4:170749208-170749230 ACTTGGAGGGAGAGGGGGGAAGG - Intergenic
985278994 4:188268793-188268815 ACTTGGAGGAAGAGGATGGAAGG + Intergenic
985545813 5:508450-508472 CCTGGGATGGAGATGCCGCAGGG + Intronic
985766007 5:1779926-1779948 CCCTGGAAGGACAGGCTGGGTGG - Intergenic
985836128 5:2273153-2273175 CCTTCGCAGGAAAGGCTGGAGGG + Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986266908 5:6198507-6198529 CCATGGATGGGGAGACTGTAGGG + Intergenic
987261824 5:16211923-16211945 CCTTGGAGACAGTGGCTGGAAGG - Intergenic
988124050 5:27006014-27006036 ACTTGGAGGTGGAGGCTGGAAGG + Intronic
988140422 5:27232224-27232246 CCCTGGAGGCAGAGGCTGCAAGG - Intergenic
988239987 5:28596837-28596859 TCCTGGATGGAGCGGCTGGCCGG + Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988890469 5:35610871-35610893 CCTTGGAGGCAGAGGTTGCAGGG + Intergenic
989160786 5:38388682-38388704 CCTAGGAGGGAGAGGTTGCAGGG + Intronic
989828931 5:45890873-45890895 TCTGGGATGGGGAGGCTGGCCGG - Intergenic
992465792 5:77002755-77002777 CCCTGGAGGCAGAGGCTGTAGGG + Intergenic
993451258 5:88074296-88074318 CCATGGCTGGAGTGGCTGGGAGG - Intergenic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997894731 5:137705842-137705864 CTTGGGATGGAGGTGCTGGATGG + Intronic
998460005 5:142302851-142302873 CCCGGGATGGAGAGGTTGTAGGG + Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002401981 5:178996018-178996040 CCTTGGATGGAGGGAGGGGAGGG + Intronic
1002523443 5:179803631-179803653 CCTCAGATGGACAGGCTGGGTGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005445693 6:25920226-25920248 CCTAGGAGTGAGAAGCTGGATGG + Intronic
1006409600 6:33864960-33864982 CATTGCATGGTGTGGCTGGAGGG - Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1007301562 6:40871739-40871761 CCTTGGAGAGAGGTGCTGGAGGG - Intergenic
1009042082 6:58190914-58190936 CCCTGGATGGGGCGGCTGGCCGG - Intergenic
1009289784 6:61868337-61868359 CCTGGGATGGAGTGCCTGGCAGG - Intronic
1010230423 6:73529959-73529981 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1011459722 6:87590283-87590305 CCCTGGCTGGAGAGGAGGGAGGG + Intronic
1011772659 6:90692069-90692091 GCTTGGATGGATAGGCAAGATGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1015378113 6:132533869-132533891 CCCTGAATGGAGAGACTGGCTGG + Intergenic
1017404321 6:154102013-154102035 CCTGGGAAGTAGAGGCTGCAGGG - Intronic
1018086314 6:160303921-160303943 CCATGGCTGGAGTGGCTGGGAGG + Intergenic
1019073872 6:169371249-169371271 CCTGGGAGAGAGAGGCTGGTAGG + Intergenic
1019103537 6:169650596-169650618 GCATGGATGGAGGGGATGGAGGG - Intronic
1019435533 7:1020446-1020468 CCTTGGGTGGAGACGCAAGATGG - Intronic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1021050405 7:15976395-15976417 CATTGGATTGAGAGGCTTCATGG + Intergenic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1023458502 7:40367890-40367912 GCATGGATGGAGAGGCTGTGAGG - Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1025607728 7:63051380-63051402 CCCAGGATGTAGAGGCTGTAGGG - Intergenic
1025957830 7:66196363-66196385 CCCTGGTTAAAGAGGCTGGAAGG - Intergenic
1026339313 7:69421704-69421726 CATTGGGTGATGAGGCTGGAAGG - Intergenic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1029133630 7:98352564-98352586 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
1030315126 7:108106508-108106530 CCTTGGATGTAGGGGCTATAAGG + Exonic
1032035350 7:128517393-128517415 CTGTGGGTGGAGGGGCTGGAGGG + Intergenic
1033299097 7:140170526-140170548 CCCAAGATGGAAAGGCTGGAAGG - Intronic
1034087268 7:148331622-148331644 CGATGGATGGAGTGGATGGATGG + Intronic
1034499091 7:151438722-151438744 CCTTCACTGGAGAGGCTGAATGG + Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035429495 7:158807971-158807993 CTCTGGAGAGAGAGGCTGGACGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036565585 8:9935257-9935279 CCTAGGATGGTGAGCTTGGAGGG + Intergenic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038158288 8:25011962-25011984 ACTAGGAAGGGGAGGCTGGAGGG - Intergenic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1039835169 8:41250105-41250127 CCTTGGAGGGGGAGGCTGCCTGG + Intergenic
1039888871 8:41671252-41671274 CCTTTGAAGGAGGGGCTGGTGGG - Intronic
1040029389 8:42810479-42810501 CCTAGGAGGTAGAGGCTGCAGGG + Intergenic
1045175919 8:99724778-99724800 ACTTAGAAGGACAGGCTGGAAGG - Intronic
1045270783 8:100659309-100659331 CCCAGGCTGGAGAGGCTGGAGGG - Intronic
1045989981 8:108295689-108295711 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1048178348 8:132172692-132172714 CCCTGGAGGGAGAGGCAGGCAGG + Exonic
1048767005 8:137855630-137855652 CTCAGGATGGAGAGTCTGGAGGG - Intergenic
1048831850 8:138485348-138485370 CCTTGAATGGAAACTCTGGATGG - Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049586101 8:143433038-143433060 CCTTGGGTTGGGAGGCTGGCGGG - Intergenic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614224 8:143569196-143569218 CCTGGGAGGGAGAGACTGTAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1051817912 9:21131482-21131504 GCTAGGATGGAGAGTATGGAGGG + Intergenic
1055343309 9:75308611-75308633 CCTGGGATGGAGCCCCTGGAGGG - Intergenic
1055343538 9:75310519-75310541 CCTGGGATGGAGCCTCTGGAGGG - Intergenic
1056486322 9:87061832-87061854 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1056698459 9:88880550-88880572 ACCTGGATGAAGAGGCTGCAGGG - Intergenic
1057952639 9:99382115-99382137 CCTGGGTTGGGGAGGCAGGATGG - Intergenic
1058147430 9:101427525-101427547 TCCTGGATAGCGAGGCTGGATGG + Exonic
1059023274 9:110598844-110598866 CCTGGGATGGAGTGCCTGGGGGG - Intergenic
1060202730 9:121661135-121661157 CCTTGGATGCTGATGCTGCAGGG + Intronic
1060233126 9:121840342-121840364 CGATGGATGCACAGGCTGGAGGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1061402951 9:130378377-130378399 GCTGGGATGGGGAGGCTGGGAGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186175443 X:6921306-6921328 CCTTGGAGGTTGAGGCTGCAGGG + Intergenic
1187341443 X:18425270-18425292 CCTGGGCTGGAGAGGCTGAGAGG - Intergenic
1187681189 X:21769448-21769470 CCTTGGCAGGGGTGGCTGGAAGG + Intergenic
1189295318 X:39913659-39913681 CCTTGGCAAGGGAGGCTGGAGGG + Intergenic
1189310155 X:40013057-40013079 CCTTGGCCGGAGAAGCTGGGAGG - Intergenic
1189442766 X:41051957-41051979 CCCAGGCTGGAGAGGCTGGAGGG - Intergenic
1189469619 X:41303585-41303607 AATTGGATGGGGAGGCTGGAGGG - Intergenic
1189675302 X:43455277-43455299 CTTTTGATGGAGAGACTAGAAGG - Intergenic
1191209705 X:57871969-57871991 CTTGGGATGGAGTGCCTGGATGG - Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1192025914 X:67451253-67451275 CCTGTGCTGGGGAGGCTGGAGGG + Intergenic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1194435878 X:93868221-93868243 CCCTGGATGGAGCCCCTGGAGGG + Intergenic
1195349931 X:103986180-103986202 CCTTGGAGGGGCTGGCTGGAGGG + Intergenic
1195357512 X:104052659-104052681 CCTTGGAGGGGCTGGCTGGAGGG - Intergenic
1195599478 X:106728635-106728657 ACTTGTATTGAGTGGCTGGATGG + Intronic
1196163330 X:112510767-112510789 CCAAGGATTGAGAGTCTGGAAGG + Intergenic
1197867888 X:131037771-131037793 ACTTTGAGGGATAGGCTGGAAGG - Intergenic
1198636720 X:138710363-138710385 CCTTGGAGGTGGAAGCTGGAGGG + Intronic
1199594168 X:149493568-149493590 GAGTGGATGGAGAGGCTGCAGGG + Intronic