ID: 1151329457

View in Genome Browser
Species Human (GRCh38)
Location 17:73398314-73398336
Sequence CATTACCTGTAGCAGGTGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151329444_1151329457 16 Left 1151329444 17:73398275-73398297 CCCAGCCCTGAGGCTGCTGCCTT 0: 1
1: 0
2: 7
3: 65
4: 513
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329437_1151329457 26 Left 1151329437 17:73398265-73398287 CCCACCCACCCCCAGCCCTGAGG 0: 1
1: 0
2: 10
3: 116
4: 958
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329436_1151329457 27 Left 1151329436 17:73398264-73398286 CCCCACCCACCCCCAGCCCTGAG 0: 2
1: 0
2: 19
3: 222
4: 1668
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329452_1151329457 -10 Left 1151329452 17:73398301-73398323 CCCGGGCCAGTCTCATTACCTGT 0: 1
1: 0
2: 0
3: 19
4: 215
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329451_1151329457 -9 Left 1151329451 17:73398300-73398322 CCCCGGGCCAGTCTCATTACCTG 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329450_1151329457 -3 Left 1151329450 17:73398294-73398316 CCTTCTCCCCGGGCCAGTCTCAT 0: 1
1: 0
2: 2
3: 15
4: 206
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329445_1151329457 15 Left 1151329445 17:73398276-73398298 CCAGCCCTGAGGCTGCTGCCTTC 0: 1
1: 1
2: 5
3: 69
4: 596
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329443_1151329457 17 Left 1151329443 17:73398274-73398296 CCCCAGCCCTGAGGCTGCTGCCT 0: 1
1: 0
2: 10
3: 87
4: 645
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329440_1151329457 22 Left 1151329440 17:73398269-73398291 CCCACCCCCAGCCCTGAGGCTGC 0: 1
1: 2
2: 5
3: 111
4: 1366
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329446_1151329457 11 Left 1151329446 17:73398280-73398302 CCCTGAGGCTGCTGCCTTCTCCC 0: 1
1: 0
2: 5
3: 60
4: 472
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329439_1151329457 25 Left 1151329439 17:73398266-73398288 CCACCCACCCCCAGCCCTGAGGC 0: 1
1: 2
2: 15
3: 207
4: 1492
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329441_1151329457 21 Left 1151329441 17:73398270-73398292 CCACCCCCAGCCCTGAGGCTGCT 0: 2
1: 0
2: 6
3: 125
4: 1255
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329442_1151329457 18 Left 1151329442 17:73398273-73398295 CCCCCAGCCCTGAGGCTGCTGCC 0: 1
1: 0
2: 9
3: 68
4: 694
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329435_1151329457 28 Left 1151329435 17:73398263-73398285 CCCCCACCCACCCCCAGCCCTGA 0: 1
1: 2
2: 28
3: 268
4: 2172
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136
1151329447_1151329457 10 Left 1151329447 17:73398281-73398303 CCTGAGGCTGCTGCCTTCTCCCC 0: 1
1: 0
2: 3
3: 121
4: 3257
Right 1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151329457 Original CRISPR CATTACCTGTAGCAGGTGAA GGG Exonic
900632770 1:3645834-3645856 CGGTACCTACAGCAGGTGAATGG + Intronic
903474779 1:23612068-23612090 CATTAGTTGGAGCAGGTGACTGG + Intronic
904403232 1:30270463-30270485 CCTCACCTGTAACAGGTAAAAGG + Intergenic
907860295 1:58346169-58346191 CATTTCCTGCTGCAGATGAATGG + Intronic
907928020 1:58972954-58972976 CATTCTCTGAAGCATGTGAATGG + Intergenic
910616880 1:89208177-89208199 TATCACCTGGAGCAAGTGAATGG - Intergenic
910732186 1:90410130-90410152 GATGTCCTTTAGCAGGTGAATGG - Intergenic
912587499 1:110780277-110780299 CATTACCCCTGGCAGGTGCAGGG - Intergenic
912770262 1:112457133-112457155 CTTTCCCTGGAGTAGGTGAATGG - Exonic
919752602 1:201047621-201047643 AGTTACCTGGAGCAGGAGAAAGG + Exonic
920460709 1:206137633-206137655 CATTCCCTGAAGGAGGAGAAAGG - Intergenic
922142290 1:222900373-222900395 AATTAACTGTATCATGTGAATGG - Intronic
922351144 1:224735466-224735488 CATTACCTGTGGCAGGGCCATGG + Intronic
1065300426 10:24316139-24316161 CAGCACCTGAAGCAGGTGAGCGG - Intronic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1071758458 10:88572865-88572887 CATTCCCTGAGGCAGGTAAATGG + Intronic
1074355789 10:112781930-112781952 TAATACCTGTAGCAGATAAATGG - Intronic
1077303136 11:1856260-1856282 GTTTGCCTGTAGCTGGTGAATGG - Intronic
1077973351 11:7219962-7219984 CATTACCTGAATCAGGGAAATGG + Intergenic
1078173115 11:8944975-8944997 GATTTCCTTTAGTAGGTGAACGG - Intergenic
1081729643 11:45361273-45361295 CACTGCCTGTAGCAGGACAATGG - Intergenic
1082790230 11:57341957-57341979 CAATACATAAAGCAGGTGAAAGG + Intronic
1086781270 11:90909106-90909128 CATCACCTTTTGCAGGGGAATGG + Intergenic
1088271401 11:108038353-108038375 CACTAACTGTAGCAAGTAAAAGG - Intronic
1088965289 11:114714638-114714660 CTTTACATGTGGCAGCTGAAAGG + Intergenic
1089255087 11:117189935-117189957 CACCACCTGTAGCAGGAGCAGGG - Exonic
1090466114 11:126935477-126935499 GATGACCTTCAGCAGGTGAATGG + Intronic
1091237473 11:134031704-134031726 CCTTGTCTGTGGCAGGTGAATGG - Intergenic
1091469988 12:718227-718249 CTTTACCTGTACCATGTAAAGGG - Intergenic
1094083984 12:26568793-26568815 CATTTCCTGTATCATGTCAAAGG + Intronic
1095377183 12:41544139-41544161 CATTGCATGTAGCAGGTGCTAGG + Intronic
1098816452 12:75171235-75171257 CATTACCTGGCAAAGGTGAAGGG - Intronic
1099854948 12:88152240-88152262 TACTACCTGTAGAAGGTGAAGGG + Intronic
1102077398 12:110070629-110070651 AATTCCATGTAGCAGGTGATGGG - Intronic
1103465124 12:121136263-121136285 AATTTCATGTAGCAGGTGATGGG + Intronic
1106847538 13:33752286-33752308 CATTAGCTCAAGCAGGGGAAGGG + Intergenic
1107298912 13:38945568-38945590 CATTACCTGCTGCAGGTCAGAGG + Intergenic
1107612162 13:42126361-42126383 CAAGACCTGAAGGAGGTGAAGGG + Intronic
1110264925 13:73526765-73526787 CATGTCCTACAGCAGGTGAATGG + Intergenic
1112053692 13:95670600-95670622 CACTACCTGTAGCCGGGGGAGGG + Intergenic
1114966131 14:27962719-27962741 CAATATCAGTAGCAAGTGAATGG + Intergenic
1116975630 14:51112497-51112519 CAGTCCCTGCAGCAGGTGATGGG - Intergenic
1118883166 14:69845738-69845760 TGTCACCTGAAGCAGGTGAATGG - Intergenic
1122302809 14:100740731-100740753 CAGCACCTGGAGCAGGTGCATGG + Intergenic
1125494393 15:40177939-40177961 AATTACCAGTATCAGGAGAAAGG - Intronic
1126262195 15:46706242-46706264 GATGACCTTTAACAGGTGAATGG + Intergenic
1129103062 15:73284400-73284422 CATTACCAGTAGCAGTTACAGGG - Intronic
1131215509 15:90532102-90532124 GATTCCCTGTACCAGGTGAAGGG - Intronic
1131270187 15:90942519-90942541 CATAACCTGCAGCAGGTGGCAGG - Exonic
1131305211 15:91236765-91236787 CATTACCTGGGGCAGCTGGAAGG + Intronic
1131342897 15:91619465-91619487 CATGAGCTGGAGCAGGTGAAGGG - Intergenic
1131700394 15:94929289-94929311 CATTGCTTTTAGCTGGTGAAAGG + Intergenic
1131800147 15:96060007-96060029 GAGTACCAGGAGCAGGTGAAGGG + Intergenic
1137245373 16:46699018-46699040 CATTACCTGTAGCAGATAAAAGG - Intergenic
1137488383 16:48910315-48910337 CATTACCAGAGGCAGGAGAATGG + Intergenic
1137551751 16:49442184-49442206 AGTTACCTCTAGGAGGTGAAAGG - Intergenic
1138193982 16:55038985-55039007 CATCACCTGTATCAGGTTCAGGG + Intergenic
1139817999 16:69692627-69692649 CATTTGCTGAAGCAGTTGAAGGG - Exonic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1145009160 17:19357629-19357651 CACAGCCTGTAGCAGATGAAGGG + Intronic
1148178336 17:45585960-45585982 CATCGCCTGGTGCAGGTGAACGG + Intergenic
1148270825 17:46260507-46260529 CATCGCCTGGTGCAGGTGAACGG - Intergenic
1150349341 17:64430664-64430686 CATTGCCTGTAGCAGAGAAAGGG + Intergenic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1151434113 17:74083527-74083549 CACCACCTGTTGCAGGTAAAGGG + Intergenic
1155858410 18:30864985-30865007 GATATCCTTTAGCAGGTGAATGG + Intergenic
1162914386 19:13866097-13866119 CATTACCGGCAGCAGCTGCAGGG + Intronic
1163212528 19:15851820-15851842 CATTACCTCAAGCAGGAGCATGG + Intergenic
1164847440 19:31446059-31446081 CATTACCTCTAGATGGAGAAAGG + Intergenic
1165148421 19:33747257-33747279 CACTAACTGCAGCAGGGGAAGGG - Intronic
928477999 2:31651025-31651047 CATTTTCTGTTGCAGGTGATTGG - Intergenic
928922834 2:36542973-36542995 CATTACCATTTGCAGGTGCAGGG - Intronic
929611949 2:43277221-43277243 CATTACCTGCAGAAGGAGATCGG + Intronic
932058748 2:68473392-68473414 GATGACCTTTAGTAGGTGAATGG - Intronic
932116630 2:69056046-69056068 CATGAGTAGTAGCAGGTGAAGGG - Intronic
932754100 2:74393144-74393166 CATTATCTGTAGCAGGCAAGGGG - Intergenic
933010305 2:77053660-77053682 TATTACCTCTAGCAGATAAAAGG - Intronic
937244321 2:120482854-120482876 CATCACCTCCAGCAGGAGAATGG - Intergenic
939872879 2:147544456-147544478 CAATGCTTGTAGCAGGAGAAAGG - Intergenic
940072000 2:149699005-149699027 CAATATCTGGAGCAGGTGAGTGG + Intergenic
940554568 2:155207111-155207133 CGTTACCAGTGGCAGGTGGAAGG + Intergenic
942564630 2:177254324-177254346 CCTAACCTGAAGCAGGTGATGGG - Intronic
944837465 2:203593973-203593995 CCTTGCCTGTTGAAGGTGAAGGG + Intergenic
945707984 2:213259642-213259664 GATTACCAGAAGCAGGGGAATGG - Intergenic
947019900 2:225663502-225663524 CCTGAGGTGTAGCAGGTGAATGG - Intergenic
947928900 2:233946229-233946251 CATTGCCTTTAGCATGTTAAAGG - Intronic
948257621 2:236579284-236579306 CATTACCTGGGACAGGTGAGGGG + Intronic
1170291873 20:14779335-14779357 AATTACCTTTTGCAGGTAAAAGG - Intronic
1173392303 20:42646136-42646158 CATTGCCTGGAGCAAGGGAAGGG - Intronic
1177001090 21:15614067-15614089 GATGTCCTTTAGCAGGTGAATGG + Intergenic
1178140644 21:29679633-29679655 CATTACCTGAAACAGGTTATAGG - Intronic
1182253203 22:29018379-29018401 CATTACTTGTCTCAGGTTAAGGG - Intronic
1182951669 22:34381871-34381893 CAACACCTGTGCCAGGTGAAAGG + Intergenic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184629076 22:45761954-45761976 TCTTAACTGAAGCAGGTGAATGG + Intronic
1185186266 22:49402339-49402361 CATTACCTGGAGGAGGAGGAAGG - Intergenic
1185267794 22:49913596-49913618 CAAGACCTGGAGCAGGTGAGGGG - Exonic
952945580 3:38476311-38476333 CACTTCCTGCAGCAGGTGGAAGG + Intronic
958595498 3:96216913-96216935 CATGACCCCTAGCAGGGGAAGGG + Intergenic
959452108 3:106517130-106517152 AATCACCTGTAGGAGGTGACTGG - Intergenic
962082938 3:132159810-132159832 CATTCCCAGAAGCAGGGGAAGGG - Intronic
963280390 3:143378883-143378905 CAATACCTTTAGAATGTGAATGG - Intronic
968152609 3:196349328-196349350 CACTCTCTCTAGCAGGTGAAAGG + Exonic
968431301 4:560760-560782 CATAACCTTCAGCAGGTGACAGG + Intergenic
968733121 4:2281054-2281076 CCTTTCCTGTGGCAAGTGAAGGG - Intronic
969929445 4:10615598-10615620 CTATACCTGGAGCAGGTGCATGG - Intronic
970991434 4:22217837-22217859 CATCAACTGTAGCAAATGAATGG + Intergenic
976244291 4:82992121-82992143 CATTTCCTTTAGCAGATGTAGGG + Intronic
977270073 4:94907326-94907348 CATTGCCTATAACAGGTGAAAGG + Intronic
978415567 4:108472278-108472300 AATTTTCTTTAGCAGGTGAATGG + Intergenic
978898176 4:113915753-113915775 TTTTACCTGCAGCAGATGAAGGG - Intronic
981475796 4:145185412-145185434 CATCAAATGTAGCAGCTGAAGGG - Intergenic
981590929 4:146360099-146360121 GATTAGATGTAGCAGGTGAGAGG - Intronic
981990180 4:150909522-150909544 CATGTCCAGTAGCAGATGAATGG - Intronic
983763263 4:171441046-171441068 CATTACCTGAAGCAATTCAATGG + Intergenic
986466761 5:8033945-8033967 CATTATCTCTAACAGGTGAGTGG + Intergenic
989792089 5:45417527-45417549 CATTGCCTCCAGCAGGTGACTGG + Intronic
989807998 5:45635758-45635780 CATTACCTGTTGCAACTGAAGGG + Intronic
1001542297 5:172548063-172548085 CCTTACCTGCAAGAGGTGAAGGG + Intergenic
1003108278 6:3231723-3231745 GATTGCCTGTAGCAGGGAAATGG - Intronic
1004293735 6:14391499-14391521 CATTATCTGGAGCAGCAGAATGG + Intergenic
1004744726 6:18498494-18498516 CATGACCTCTACCAGGTGAGAGG - Intergenic
1005802706 6:29443498-29443520 AATTTCCTTCAGCAGGTGAATGG - Intronic
1008815851 6:55565195-55565217 CAGTACCTCTACCAGGTGAGTGG + Intronic
1010176390 6:73032899-73032921 CTTCACCTGTGGCAGGTGAAGGG + Intronic
1014092820 6:117423976-117423998 CATTCTCTGTAGGTGGTGAACGG + Intronic
1014861633 6:126474987-126475009 CATTACATGTGGCATGTGGAAGG + Intergenic
1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG + Intergenic
1020524526 7:9241906-9241928 CATTGCCTGTAAGAGTTGAATGG - Intergenic
1021921987 7:25494892-25494914 CCTTAGCTGTTGTAGGTGAATGG - Intergenic
1023473077 7:40546146-40546168 CATTACATGTAGCAGACCAATGG + Intronic
1026932245 7:74229852-74229874 TTTTACCTGAAGCAGGAGAAAGG - Intergenic
1028201252 7:87964668-87964690 CATTACCTGTATCTGGTATATGG - Intronic
1028680298 7:93521080-93521102 CATTAGATGTACCAGGGGAAGGG - Intronic
1030104412 7:105974866-105974888 CATTGCCTGTAGCAGGTAAGAGG - Exonic
1032513884 7:132492999-132493021 CAGTACCTGAAGCAGGGGGAGGG + Intronic
1037106314 8:15112392-15112414 CAATATCTGAAGCAGGAGAATGG - Intronic
1043590142 8:81822063-81822085 CATTACCTGTGGGTGATGAACGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045511910 8:102818192-102818214 CAGTGCCGGTAGCAGGGGAATGG - Intergenic
1046965195 8:120156651-120156673 CATTACATGAAGTAGGGGAAAGG + Intronic
1050352602 9:4754591-4754613 GATTACCTCTAGGAGGAGAAGGG + Intergenic
1051612083 9:18970987-18971009 CATTACCTGCAGCATGAGACAGG - Intronic
1053282111 9:36827126-36827148 CATTTCCTGAAACAGGGGAAAGG - Intergenic
1059089719 9:111342869-111342891 GATGACCTTTAGTAGGTGAATGG + Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1188897737 X:35689776-35689798 CATTGTATGTAGCAGGAGAAAGG + Intergenic