ID: 1151329669

View in Genome Browser
Species Human (GRCh38)
Location 17:73399322-73399344
Sequence ACATGGGGGGCCATTCTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151329669_1151329680 2 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329680 17:73399347-73399369 AACGGGACTGTTGGGCATGGAGG 0: 1
1: 0
2: 1
3: 9
4: 210
1151329669_1151329682 4 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329682 17:73399349-73399371 CGGGACTGTTGGGCATGGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 177
1151329669_1151329679 -1 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329679 17:73399344-73399366 TTGAACGGGACTGTTGGGCATGG 0: 1
1: 0
2: 0
3: 1
4: 79
1151329669_1151329683 5 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329683 17:73399350-73399372 GGGACTGTTGGGCATGGAGGGGG 0: 1
1: 0
2: 0
3: 46
4: 418
1151329669_1151329684 27 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329684 17:73399372-73399394 GCTGTGTGTCACGCTTTTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 145
1151329669_1151329678 -6 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329678 17:73399339-73399361 CCATGTTGAACGGGACTGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1151329669_1151329681 3 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329681 17:73399348-73399370 ACGGGACTGTTGGGCATGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 122
1151329669_1151329676 -7 Left 1151329669 17:73399322-73399344 CCGGTGAGAATGGCCCCCCATGT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1151329676 17:73399338-73399360 CCCATGTTGAACGGGACTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151329669 Original CRISPR ACATGGGGGGCCATTCTCAC CGG (reversed) Intronic
907776295 1:57519098-57519120 TTTTGGGGGGCCATTATCACAGG - Intronic
909397470 1:75186606-75186628 ACATGGTGTGCCCTTGTCACAGG + Intergenic
909493569 1:76252532-76252554 AAAGGGGGGGCCATCCTCAAGGG - Intronic
917223876 1:172761240-172761262 ACATGGGCAGCCTCTCTCACAGG + Intergenic
922944395 1:229499343-229499365 ACAAGGGAGGCTCTTCTCACAGG - Intronic
924556646 1:245124446-245124468 ATATGGTGAGCCATCCTCACAGG + Intronic
1063601002 10:7481374-7481396 TCATAGGGGGCCATTTTCATTGG + Intergenic
1065263757 10:23954116-23954138 ACATGGTGGGCCATTTCCAGGGG + Intronic
1067703152 10:48588167-48588189 GTATGGGGGGCCATGTTCACTGG + Intronic
1070787401 10:79169947-79169969 ACCTGGGGGTCCATTGTCTCTGG - Intronic
1072682075 10:97514843-97514865 CTTTGGGGGGCCATTCTCTCCGG - Intronic
1093874314 12:24330993-24331015 AAATGGGGAGCCAGTCTCCCCGG + Intergenic
1097171525 12:57116940-57116962 ACATGAGGGGCCAGTGTCAAAGG + Intronic
1105684304 13:22763107-22763129 ACAGGGAGGGCAATTATCACTGG + Intergenic
1106142765 13:27025152-27025174 ACTTGGGTGGCCCATCTCACAGG + Intergenic
1111399922 13:87721005-87721027 ACATGGGGGGCCAGGCGCAGTGG - Intergenic
1119599163 14:75963296-75963318 CCATGTGGGCCCAGTCTCACCGG + Exonic
1121210947 14:92207582-92207604 CCCTGGGAAGCCATTCTCACAGG - Intergenic
1124421623 15:29527865-29527887 ACAGGGGTCTCCATTCTCACGGG + Intronic
1129743515 15:78001880-78001902 ACCTGAGGGGCAATTTTCACTGG + Intronic
1138142125 16:54577869-54577891 ACTTGGCTGGCCATTGTCACAGG + Intergenic
1140661368 16:77193541-77193563 ACATGTGGGACTATTCTCAGGGG - Exonic
1146512275 17:33460313-33460335 GGATGGGCTGCCATTCTCACAGG + Intronic
1151329669 17:73399322-73399344 ACATGGGGGGCCATTCTCACCGG - Intronic
1152862513 17:82704257-82704279 ACGTGCGTGGCCCTTCTCACTGG + Intergenic
1155042492 18:22076288-22076310 CCATGAGGGGCCAGTCTCAGTGG - Intergenic
1155412860 18:25565361-25565383 ACATGTGGGTCCCTTCTCTCGGG - Intergenic
1160753634 19:747069-747091 ACATGGGGGGTCCTTGTCTCGGG - Exonic
1162377599 19:10314369-10314391 ACATGGGTCACCAATCTCACTGG + Intronic
1166106104 19:40598754-40598776 ACAGGTGGCGCCATTTTCACAGG - Intronic
929449091 2:42024813-42024835 ACCAGGGAGGCCATTCTTACTGG + Intergenic
931460816 2:62448663-62448685 ACATGGAGGGCCATTCTGAAGGG - Intergenic
935467074 2:103411253-103411275 ACATGTGGGGCCATATTCAGAGG - Intergenic
936248823 2:110851862-110851884 ACATGGAGCGCCTTTCTCACTGG - Intronic
948232127 2:236356296-236356318 AGGGCGGGGGCCATTCTCACTGG + Intronic
948232317 2:236359024-236359046 AGGGCGGGGGCCATTCTCACTGG - Intronic
948904723 2:240973415-240973437 GCATGGGGGGCCTTTCTGAGCGG - Intronic
1169377908 20:5081823-5081845 ACATGAGTGACCATTCTCCCAGG - Intronic
1170837983 20:19901359-19901381 ACATGGGTGGACATCCTCAGAGG + Intronic
1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG + Intergenic
1171555911 20:26082135-26082157 CCCTGGGGCGCCACTCTCACTGG - Intergenic
1176003729 20:62847890-62847912 GCATGGGAGGCCATGATCACAGG + Intronic
1176063968 20:63184689-63184711 ACAGGGGGTGCCACTCTCCCAGG - Intergenic
1178422883 21:32456259-32456281 ACATGGGGAGACATCCACACAGG + Intronic
1181271515 22:21661378-21661400 GCATGGGGAGCCATGCCCACAGG - Intronic
956812823 3:72880979-72881001 ACATTGGGGGCCAGTCGCAGTGG + Intergenic
963228529 3:142887745-142887767 ACATGTGGTGGCATTCTTACTGG - Exonic
963436635 3:145276960-145276982 ACATGGTGTTACATTCTCACTGG + Intergenic
968725510 4:2246111-2246133 TCATGCTGGGCCCTTCTCACAGG - Intergenic
975284652 4:72603336-72603358 TCATGGGGGGCAAATCTCTCAGG - Intergenic
977226032 4:94392726-94392748 AGATGGGGTGCCATTTTGACCGG - Intergenic
989167679 5:38446810-38446832 ACTTGGGGGCCCATTGTCATAGG + Intronic
993797520 5:92285839-92285861 ACATGCCTGGCCATTCTGACTGG - Intergenic
1001017612 5:168155451-168155473 ACATGGGGGCCCTTTCTCTTGGG - Intronic
1005732158 6:28708751-28708773 AGATGAGGGACCATTCTGACAGG - Intergenic
1006295539 6:33168534-33168556 CCCTGGGGGTCCATTCTCCCCGG + Exonic
1006934124 6:37705596-37705618 ACAGGGGGCGCCATTCACATAGG + Intergenic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1016035644 6:139380181-139380203 ACAACTGGGGTCATTCTCACAGG + Intergenic
1017218116 6:151934070-151934092 ACAAGGGAGGCCAATCCCACAGG - Intronic
1023791416 7:43756731-43756753 ACATGGAGGGCCCCTCTCACAGG + Intergenic
1025281490 7:57629291-57629313 CCCTGGGGCGCCACTCTCACTGG + Intergenic
1025303240 7:57836224-57836246 CCCTGGGGCGCCACTCTCACTGG - Intergenic
1028986151 7:97009977-97009999 ACATGCCTGGCTATTCTCACTGG + Exonic
1033227478 7:139573069-139573091 ACCCGGGGGCCCATGCTCACGGG + Exonic
1033667925 7:143461054-143461076 ACCTGGTGTGCCATTTTCACAGG + Intergenic
1034872123 7:154694322-154694344 ACATGGGAGGCCAGGCTCAGTGG + Intronic
1037483699 8:19328003-19328025 ACATGGCAGGACATTCTCCCTGG + Intronic
1040079244 8:43270923-43270945 CCAAAGGGTGCCATTCTCACTGG - Intergenic
1045497137 8:102718285-102718307 ACATGGGGGGCCAGGCACAGTGG + Intergenic
1045741489 8:105365715-105365737 TGATGGGAGGCCATTCTGACTGG - Intronic
1050180147 9:2913560-2913582 ACAAGAGGGGCCATTCTTGCAGG + Intergenic
1057427423 9:94964126-94964148 ACATGGGGCTGCATTCCCACAGG - Intronic
1057922577 9:99109445-99109467 ACATGAGCGGCCCTCCTCACAGG - Intronic
1060207326 9:121689746-121689768 ACATGGGGGGGGAGTCTCCCGGG - Intronic
1061218976 9:129237887-129237909 ACATAGTAGGCCATTGTCACAGG - Intergenic
1199761894 X:150911278-150911300 ACTTTGGGGGCCAGCCTCACTGG + Intergenic