ID: 1151329804

View in Genome Browser
Species Human (GRCh38)
Location 17:73400083-73400105
Sequence CCATCTACGCAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151329793_1151329804 29 Left 1151329793 17:73400031-73400053 CCAGCATGGCTGTAATTATCACT 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151329804 Original CRISPR CCATCTACGCAGCAGGTGGA GGG Intronic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
903950225 1:26992415-26992437 CCAGCTACTCAGCAGGCTGAGGG - Intergenic
904141432 1:28356824-28356846 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
904182889 1:28679290-28679312 CCATCTACTCAGGAGGCTGAGGG - Intronic
905051277 1:35053216-35053238 CCATCTACTCAGGAGGTAGAGGG - Intergenic
905428447 1:37902867-37902889 CCAGCTACTCAGGAGGTGAAGGG + Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
906202808 1:43970958-43970980 ACATCCACGCAGCAGCTGCAGGG - Exonic
906240351 1:44238804-44238826 GCATCTACCCTGCAGGAGGAGGG + Intronic
906406746 1:45548388-45548410 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
907464917 1:54628524-54628546 CCAGCTACCCAGGAGGTGGGAGG + Intronic
908428148 1:64029140-64029162 CCTTCCACCCAGCATGTGGAAGG - Intronic
909247007 1:73298936-73298958 CCAGCTACTCAGGAGGTTGAGGG + Intergenic
909399182 1:75207433-75207455 CCAACTAGCCAGCAGGTGGGTGG - Intronic
914418330 1:147505156-147505178 CCAGCTAGCCAGCAGGTGGTAGG - Intergenic
915298696 1:154939877-154939899 CCAGCTACTCAGCAGGCTGAAGG - Intergenic
916710479 1:167401573-167401595 CCATGTGCTCAGCAGGTGCATGG - Intronic
916807358 1:168271421-168271443 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
916955661 1:169831869-169831891 CCAGCTACTCAGCAGGGTGAGGG - Intronic
918393615 1:184091955-184091977 GCATCGACTCAGCAGTTGGATGG + Intergenic
919949070 1:202345667-202345689 CCAGCTACTCAGGAGGTAGAGGG + Intergenic
920513639 1:206568374-206568396 CCCTCAAAGCTGCAGGTGGAGGG + Intronic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
923017208 1:230136151-230136173 CCATCTTCTCAGGAGTTGGAGGG + Intronic
1062887837 10:1032513-1032535 GCAGCTACTCAGCAGGAGGAAGG - Intergenic
1064046764 10:12023875-12023897 CCAGCTACTCAGGAGGTTGATGG + Intronic
1064097214 10:12432851-12432873 CCATCTTGGGAGCAGGTGGGTGG - Intronic
1065872359 10:29966454-29966476 GCATCCAGCCAGCAGGTGGAGGG - Intergenic
1069464449 10:68625967-68625989 CCATCTACTCAGAAGGCTGAGGG + Intronic
1072054828 10:91744817-91744839 CCAGCTACGCAGGAGGCTGAAGG + Intergenic
1072589269 10:96812538-96812560 CCAGCTACTCAGGAGGTGGAAGG + Intergenic
1073571240 10:104582747-104582769 CCATCCTCACAGCAGGTGCAGGG - Intergenic
1074252519 10:111765889-111765911 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1074611069 10:115022273-115022295 CCAACTACTCAGGAGGTTGAGGG + Intergenic
1077066681 11:644156-644178 CCACCTGCGCAGTAGGAGGAAGG + Intergenic
1077263585 11:1636991-1637013 CCAACTATGCAGCAGGCTGAAGG - Intergenic
1077501756 11:2912580-2912602 CCACCTGGGCAGCAGGTGGGAGG + Intronic
1077637439 11:3853490-3853512 CCAGCTACTCAGCAGGCTGAGGG - Intergenic
1078554038 11:12303920-12303942 CCACCTACTCAGCAGGTGTGAGG + Intronic
1079573763 11:21977473-21977495 CCATCTTGGCAGCAGTTGGGAGG + Intergenic
1081666354 11:44919122-44919144 CCAACTCCCAAGCAGGTGGATGG + Intronic
1081857696 11:46314121-46314143 CCAGCTACTCAGGAGGTTGAGGG + Intronic
1084036838 11:66516663-66516685 CCAACTACTCAGGAGGTTGAAGG - Intronic
1084094646 11:66902988-66903010 GCAGCTGCTCAGCAGGTGGATGG - Intronic
1085132993 11:74057848-74057870 CCAGCTACTCAGGAGGTGGGAGG + Intronic
1085562231 11:77482713-77482735 CCAGCTACTCAGCAGGCTGAAGG - Intergenic
1085704003 11:78769769-78769791 GGATTTAGGCAGCAGGTGGAAGG + Intronic
1086157881 11:83687885-83687907 CCAGCTACTCAGCAGGCTGAGGG + Intronic
1086357659 11:86021234-86021256 CCAGCTACTCAGCAGGCTGAGGG + Intronic
1086737734 11:90327888-90327910 CCAGCTACTCAGCAGGCTGAAGG + Intergenic
1089022849 11:115234776-115234798 CCAGCTACTCAGCAGGCTGAGGG + Intronic
1089104471 11:115990744-115990766 CCAGCTCCCCAGCAGCTGGAAGG - Intergenic
1089247647 11:117134025-117134047 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
1089259114 11:117210818-117210840 CCAGCTACTCAGGAGGTTGAGGG + Intronic
1089423205 11:118347731-118347753 CCAGCTACTCAGGAGGTGGGAGG - Intronic
1090381005 11:126327890-126327912 CCCTCACAGCAGCAGGTGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1091722151 12:2821241-2821263 CCCTGTGCACAGCAGGTGGACGG - Exonic
1092369701 12:7906636-7906658 CCAGCTACTCAGCAGGCTGAGGG - Intergenic
1097587831 12:61536114-61536136 CCATCTACGCTGCTGGTGTGTGG - Intergenic
1098019686 12:66140650-66140672 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1098644689 12:72884046-72884068 CCAGCTACTCAGGAGGTTGACGG - Intergenic
1101586849 12:106092401-106092423 CCAGCTACTCAGGAGGTTGAGGG + Intronic
1101841788 12:108332863-108332885 CCACCTACTCAGGAGGTGGGAGG + Intronic
1102106765 12:110331452-110331474 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1102490435 12:113287079-113287101 CCATCACCTCAGCAGCTGGAGGG - Exonic
1104684966 12:130778893-130778915 CCATCTAGACAGGAGGTGGCGGG - Intergenic
1105015585 12:132784954-132784976 CCATCGAGGCAGCAAGTGGGCGG - Intronic
1105817559 13:24051042-24051064 ACAGCTACCCAGCTGGTGGATGG - Intronic
1106920589 13:34559109-34559131 CCATCTCCTCAGCTGCTGGAGGG - Intergenic
1107682600 13:42866970-42866992 CCATCTACTCAGCAGGTTGAGGG - Intergenic
1108325943 13:49331349-49331371 CCAGCTACTCAGGAGGTTGAGGG + Intronic
1109279652 13:60341330-60341352 CCATCTCCGCATCAGTTAGAAGG + Intergenic
1112892190 13:104251331-104251353 CCATCTACTCGGGAGGTGGAGGG + Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1113910368 13:113838635-113838657 CCAGCCCCGCAGCAGGAGGAAGG + Intronic
1115013701 14:28583669-28583691 CCAGCCACTCAGGAGGTGGAAGG - Intergenic
1116855011 14:49944505-49944527 CCCTCTACCCAGCAGCTGGATGG - Intergenic
1117258347 14:54003225-54003247 CCATCTGCTCAGCTAGTGGAAGG - Intergenic
1119136630 14:72227362-72227384 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1122334843 14:100965633-100965655 CCAGCTACGCAGGAGGCTGAGGG + Intergenic
1124420083 15:29513491-29513513 CCCTCCACGGAGAAGGTGGAGGG - Intronic
1124618359 15:31259184-31259206 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1124863198 15:33463050-33463072 CCAGCTACTCAGCAGGCGGTGGG + Intronic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1127455499 15:59152823-59152845 GCATCCAGGCACCAGGTGGATGG - Intronic
1127970133 15:63952123-63952145 CCAACTACTCAGGAGGCGGAGGG + Intronic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128611653 15:69078704-69078726 CCATCTACTCAGGAGGTGGGAGG - Intergenic
1129477922 15:75798971-75798993 CCAGCTACACAGGAGGTGGACGG + Intergenic
1132621324 16:869531-869553 TCAGCTACGCAGGAGGAGGAAGG - Intronic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1134053364 16:11153168-11153190 CCATCCAGGAAGCAGGCGGAGGG - Intronic
1134626755 16:15727856-15727878 CCAGCTACTCAGGAGGCGGATGG + Intronic
1135528804 16:23234752-23234774 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
1136506746 16:30709305-30709327 CCAGCTTCGCCTCAGGTGGAGGG - Intronic
1137431410 16:48420774-48420796 CCAGCTACTCAGGAGGTTGAAGG + Intronic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138337612 16:56265577-56265599 CCATCAACCCACCAGCTGGAGGG - Intronic
1140038897 16:71392278-71392300 CCAGCTACTCAGGAGGTTGAGGG + Intergenic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140379852 16:74476738-74476760 CCATCTAGGAAGCAGAGGGAAGG - Intronic
1141432237 16:83976209-83976231 CCACCTACCCAGCAGGGGGTGGG - Intronic
1142694777 17:1627829-1627851 CCATCGGCGCCGCTGGTGGATGG - Exonic
1143069840 17:4282195-4282217 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1147216656 17:38903472-38903494 CCAGCTACTCAGGAGGTTGACGG - Intronic
1147457534 17:40547591-40547613 CCACCATGGCAGCAGGTGGAGGG - Intergenic
1148030958 17:44620648-44620670 CCAGCTACTCAGGAGGTGAAGGG - Intergenic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1152521414 17:80858823-80858845 CCATCCACGCAGACGGTGCACGG + Intronic
1152645074 17:81465074-81465096 CCATCTACGCAGCAGGCCAGGGG - Exonic
1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG + Intronic
1154059021 18:11041269-11041291 CCATCTACTTAGCAGCTGGAGGG - Intronic
1154163390 18:11996393-11996415 GCCTCTACGCAGCAGCTGGATGG - Intronic
1154988594 18:21578973-21578995 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1156812895 18:41274009-41274031 CCAGGCACGCAGCAGGTGGATGG + Intergenic
1160187803 18:76688903-76688925 CCATCCCTGCTGCAGGTGGACGG - Intergenic
1160211425 18:76883536-76883558 CCAGCTACTCAGGAGGTCGAGGG - Intronic
1160459931 18:79031409-79031431 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1163670974 19:18628400-18628422 CCAGCTACTCAGGAGGTTGAGGG + Intergenic
1165768072 19:38362985-38363007 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1166309258 19:41953305-41953327 CCAGCTACTCAGCGGGAGGATGG - Intergenic
1168598944 19:57702665-57702687 CCAACTTCTCTGCAGGTGGAAGG + Exonic
926085944 2:10020416-10020438 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
928122100 2:28590878-28590900 CCAGCCACGCGGGAGGTGGAAGG + Intronic
928446752 2:31339670-31339692 CCATCCATCCTGCAGGTGGAAGG - Exonic
930182673 2:48379679-48379701 CCATCTACCCAGGAGGCTGAGGG + Intergenic
930444925 2:51458376-51458398 CCAGCTACCCAGCAGGCTGAAGG + Intergenic
931066096 2:58588919-58588941 CCAGCTACTCAGAAGGTTGAGGG + Intergenic
931254925 2:60562430-60562452 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
932131747 2:69193885-69193907 CCATCTTCCCAGCAGGTGTGGGG + Intronic
932214581 2:69958600-69958622 CCTTCTACCCAGCACGTGGCTGG + Intergenic
932333202 2:70912545-70912567 CCATCTACTCAGGAGGCTGAGGG + Intronic
937733912 2:125266411-125266433 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
938472230 2:131575476-131575498 GCATCCACGCCTCAGGTGGAAGG + Intergenic
938982810 2:136542635-136542657 CGTTCTAGACAGCAGGTGGAAGG + Intergenic
941404698 2:165074363-165074385 CCATCAACTCAGTAGGTGGTAGG - Intergenic
942306457 2:174612001-174612023 CCAGCTACTCAGGAGGTGGGAGG - Intronic
945920613 2:215751316-215751338 CCATCCAGGCAGCAGATGGATGG - Intergenic
948025635 2:234773914-234773936 CCATCCAGGCAGCAGTTGCATGG - Intergenic
948765033 2:240215222-240215244 ACAGCTGTGCAGCAGGTGGAAGG + Intergenic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1170014873 20:11769280-11769302 CCAGCTACTCAGAAGGTGGGAGG - Intergenic
1174483626 20:50847928-50847950 CCAGCTACTCAGGAGGTGGAAGG + Intronic
1175605367 20:60308240-60308262 CCTTCCACGCACCAGGTAGAGGG + Intergenic
1176033824 20:63026766-63026788 CCATTTAAGGAGCAGGTTGAAGG + Intergenic
1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG + Intergenic
1177327630 21:19612737-19612759 CCATCTTGGCAGAAGGTGAAGGG - Intergenic
1179208882 21:39309334-39309356 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1179743449 21:43430471-43430493 CCATTTAAGCAGCCCGTGGAAGG - Intergenic
1179771237 21:43619060-43619082 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1181060327 22:20279228-20279250 CCATCTTTGCAGCCGGTGAAGGG + Intronic
1181743678 22:24940873-24940895 CCAGCTACTCAGCAGGTGGGAGG - Intronic
1182878915 22:33716509-33716531 CCAGCTACTCAGGAGGTAGAAGG - Intronic
1183097484 22:35561911-35561933 CCATGTGCGAAGCCGGTGGATGG + Intergenic
1183173083 22:36202219-36202241 CCAGCTACTCAGAAGGTTGAAGG - Intronic
1183180134 22:36254450-36254472 CCAGCTACTCAGAAGGTTGAAGG + Intronic
1183489384 22:38108548-38108570 GCATCTAAGAAGCAGGGGGATGG + Intronic
1183496844 22:38150970-38150992 CCAGCTACTCAGGAGGTTGAGGG + Intronic
1183652372 22:39164810-39164832 CCAGCTACGCAGGAGGCTGAGGG - Intergenic
1184666192 22:45990347-45990369 CCATCTACCCAGCAGGGTGCTGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
951713222 3:25607894-25607916 CCAGCTACTCAGCAGGCTGAGGG - Intronic
952012549 3:28917049-28917071 CCATTTACGCTGTAGGAGGAAGG - Intergenic
954088197 3:48263642-48263664 CCAGCTACGCAGGAGGCTGAGGG + Intronic
955684560 3:61537104-61537126 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
958935614 3:100252477-100252499 CCAGCTACTCAGGAGGTTGAAGG + Intergenic
959546231 3:107599635-107599657 CCATCTAAGCAGCTGCTGGACGG - Intronic
960293146 3:115911464-115911486 CCAGCTACTCAGGAGGTGGGAGG - Intronic
960731031 3:120726627-120726649 CCATCTACTCAGGAGGCTGAGGG + Intronic
961379164 3:126486192-126486214 GCCTCTAGGCAGCAGGTGGGTGG - Intronic
962392757 3:134986554-134986576 CCATTTACGCATCTGGAGGATGG + Intronic
962562696 3:136623838-136623860 CCATCTACTCAGGAGGTTGAGGG + Intronic
962815633 3:138995422-138995444 CCAGCTACTCAGGAGGTAGAAGG - Intergenic
963174099 3:142280693-142280715 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
963900159 3:150726064-150726086 CCAGCTACTCAGGAGGTGGAAGG - Intergenic
964560687 3:157992556-157992578 CCATCTACTCAGGAGGCTGAGGG + Intergenic
965222546 3:165945298-165945320 CCAGCTACTCAGGAGGTGGGAGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966472206 3:180303369-180303391 TCATATAAGCAGCAGGTGGTGGG + Intergenic
967052287 3:185795801-185795823 GCATGAACCCAGCAGGTGGAGGG + Intronic
967708480 3:192679481-192679503 CCAGCTACTCAGGAGGTGGGAGG + Intronic
967944774 3:194795414-194795436 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
968946747 4:3668933-3668955 CCATCTGGGCACCAGGTGAACGG - Intergenic
970261522 4:14229967-14229989 CCATCTACTCAGCTTGTAGATGG + Intergenic
971121491 4:23709936-23709958 CCAGCTACTCAAGAGGTGGAAGG - Intergenic
973939126 4:55886436-55886458 CCATCTACTCAGGAGGCTGAGGG + Intronic
974227403 4:59064671-59064693 CCATGTACCCAGGAGATGGAGGG + Intergenic
977457283 4:97277424-97277446 CCAGCTACTCAGCAGGCTGATGG + Intronic
977826985 4:101544335-101544357 CCAACTACTCAGGAGGTTGAGGG + Intronic
978350238 4:107813637-107813659 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
979999059 4:127467444-127467466 CCAGCTACCCGGGAGGTGGAGGG - Intergenic
982734626 4:158992753-158992775 CCAACAGGGCAGCAGGTGGAAGG + Intronic
982882315 4:160734837-160734859 CCATCTATGAACCAGGTGGCAGG + Intergenic
983567063 4:169164495-169164517 CCAAGTACACAGCAGGTGGTGGG + Intronic
983844443 4:172499356-172499378 CCATCTGCAAAGCAGGAGGAAGG + Intronic
984065805 4:175046520-175046542 GCAACTTGGCAGCAGGTGGAGGG - Intergenic
985075541 4:186210355-186210377 ACATTTTCGCAGTAGGTGGAAGG - Intronic
985501631 5:251407-251429 CCATCTACGGAGCAGAGGCACGG + Exonic
986716470 5:10527716-10527738 CCAGCTACGCGGGAGGTGGGAGG - Intergenic
988518945 5:31929105-31929127 ACAGCCATGCAGCAGGTGGATGG - Intronic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
991474828 5:67008164-67008186 CCCTCAAAGCAGCAGGTGAATGG - Intronic
992254246 5:74905819-74905841 CCAGCTACTCAGGAGGTGGGAGG - Intergenic
993160242 5:84280827-84280849 CCATCTACACAGGAGGATGAGGG + Intronic
995014956 5:107299461-107299483 CCAGCTACTCAGAAGGTGGGAGG + Intergenic
996025957 5:118646099-118646121 CCAGCTACTCAGGAGGTTGAGGG + Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
999159683 5:149485070-149485092 CCAGCTACCCAGAAGGTGGAGGG - Intergenic
1001697114 5:173679123-173679145 CCATCCACACAGCAGGCAGAAGG - Intergenic
1006225568 6:32534263-32534285 CCAGCTACTCAGGAGGTGGGTGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1009788302 6:68366673-68366695 CCATCTACTCAGGAGGGTGAGGG - Intergenic
1010323594 6:74540609-74540631 CCATCTAGCCATCAGGTGGGTGG + Intergenic
1011502522 6:88006846-88006868 CCATCCCGGCAGCAGGAGGAAGG + Intergenic
1011703065 6:89973150-89973172 CCAACTACTCAGCAGGCTGAGGG + Intronic
1014256839 6:119169104-119169126 CCAGCTACCCAGGAGGCGGAGGG + Intergenic
1017334102 6:153234717-153234739 CAAACTACCCAGGAGGTGGAAGG - Intergenic
1022539684 7:31124156-31124178 CCAGCTACCCAGGAGGTGGTGGG - Intergenic
1026046625 7:66910032-66910054 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1026159132 7:67853254-67853276 CCATCTAAGCAGCATGTGCTGGG - Intergenic
1026506781 7:70991492-70991514 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
1027526746 7:79278792-79278814 CCACCTAAGTAGCAGGTGGTAGG - Intronic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1033325195 7:140371964-140371986 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1033712949 7:143968172-143968194 CCAGCTACTCAGGAGGTTGAGGG - Intergenic
1033799770 7:144887074-144887096 CCAGCTACGCAGGAGGCTGAGGG - Intergenic
1034182600 7:149149729-149149751 CCAGCTACTCAGGAGGTGGGAGG + Intronic
1037519378 8:19665126-19665148 CCACCTACTCAGGAGGTTGATGG - Intronic
1040776021 8:51044176-51044198 CCACCCACTCAGCAGGGGGATGG + Intergenic
1045153948 8:99444776-99444798 CCAGCTACTCAGGAGGTGGGAGG - Intronic
1047742260 8:127816007-127816029 CCAGCTACTCAGCAGGCTGAGGG + Intergenic
1048832825 8:138493028-138493050 CCATCCACACCGGAGGTGGAGGG + Intronic
1048842597 8:138578805-138578827 CCACTTACTCAGCAGGTGGGAGG - Intergenic
1050407688 9:5327315-5327337 CCGGCTACGCAGCAGCTTGATGG + Intergenic
1050986931 9:12093983-12094005 CCATCTACACACCAGGAAGAGGG + Intergenic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1051717124 9:19996625-19996647 CCAGCTACTCAGGAGGTTGAGGG + Intergenic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1057037483 9:91821820-91821842 CTATCTACTCAGCAGGTCCAAGG + Intronic
1058845726 9:108957234-108957256 CCAGCTACTCAGGAGGTGGAAGG - Intronic
1059139534 9:111839403-111839425 CCAGCTACTCAGCAGGCTGAGGG + Intergenic
1059162347 9:112047154-112047176 CCATCAAGGCAGAAGGTGAAGGG + Intronic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060917487 9:127399694-127399716 CCAGCTACTCAGGAGGTTGAGGG - Intronic
1186118297 X:6328449-6328471 CCAACTACTCAGGAGGTTGAGGG + Intergenic
1191603329 X:63034283-63034305 CCAGCTACTCGGGAGGTGGAGGG - Intergenic
1192061066 X:67826735-67826757 CCAGCTACACAGGAGGTGGGAGG + Intergenic
1195664671 X:107418079-107418101 CTATCTGACCAGCAGGTGGAAGG - Intergenic
1196420458 X:115515522-115515544 CCTTCTCACCAGCAGGTGGATGG + Intergenic
1197784829 X:130189026-130189048 CCAGCTACTCGGGAGGTGGAAGG - Intergenic
1197800112 X:130339596-130339618 CCTTCTACGCGCCAGGTGGGTGG + Intergenic
1198176660 X:134163049-134163071 CCATCTACTCAGGAGGCTGAAGG - Intergenic
1199213927 X:145245760-145245782 ACATCTACGCTGCAGATGTATGG + Intergenic
1201579109 Y:15492562-15492584 CCATCTACTCAGGAGGCTGAAGG + Intergenic
1201920323 Y:19226896-19226918 CCATCTACTCAGGAGGCTGAGGG - Intergenic