ID: 1151331268

View in Genome Browser
Species Human (GRCh38)
Location 17:73410605-73410627
Sequence GCAGCATTATCGGCCGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151331268 Original CRISPR GCAGCATTATCGGCCGGGGG TGG (reversed) Intronic
902826309 1:18976705-18976727 GCAGCTTTATTGGCCGGGCACGG + Intergenic
903925004 1:26826021-26826043 CAAACATTATCGGCCGGGCGCGG - Intergenic
909705399 1:78576813-78576835 ACAGCATTATTGGCCGGGCATGG - Intergenic
911203647 1:95071255-95071277 GCAGGATTTTAGGCCAGGGGTGG + Intronic
911610703 1:99956556-99956578 GAATCATTATAGGCCGGGCGCGG - Intergenic
911664547 1:100538814-100538836 GCAGAATAATGGGCTGGGGGAGG - Intronic
918731310 1:188000881-188000903 AAACCATTATCGGCCGGGCGCGG + Intergenic
919904893 1:202071676-202071698 GAAGAATTATGGGCCGGGCGTGG + Intergenic
920484853 1:206360094-206360116 AGAGCAATATCGGCCGGGCGCGG - Intronic
920789676 1:209077832-209077854 GCAGCATTATTGGCCAGGCGCGG - Intergenic
1064348133 10:14551433-14551455 GTAAGATTATCGGCCGGGTGAGG - Intronic
1064671100 10:17714601-17714623 GCAGCAGTAGCGGCAGGAGGAGG - Exonic
1065360795 10:24887258-24887280 GGAGTATTAACGGCCGGGCGCGG - Intronic
1065883184 10:30054957-30054979 GATGCATTTTCGGCCGGGCGCGG - Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1067111826 10:43406798-43406820 GAGTCATTATCGGCCGGGCGAGG - Intronic
1069310819 10:67034060-67034082 GAAGCAGTATAGGCCGGGCGCGG - Intronic
1070536221 10:77379792-77379814 GCAGCATTATGGGGCAGGGATGG - Intronic
1072490147 10:95897387-95897409 GTAGTATTATAGGCCGGGTGCGG + Intronic
1072977860 10:100074705-100074727 GCAGGGTTTTCGGCCGGGCGTGG - Intronic
1073460376 10:103662328-103662350 TCACCATTATTGGCGGGGGGGGG + Intronic
1073860347 10:107731837-107731859 GCAGCATCATTGGCTGGGGTGGG + Intergenic
1075775196 10:124978906-124978928 GAAGAATTATCGGCCGGGCCTGG + Intronic
1076368264 10:129935979-129936001 GCTGCATTGTTGGGCGGGGGGGG - Intronic
1078552301 11:12289079-12289101 GCAGCATGATCAGCTGGGGAGGG - Intronic
1079932867 11:26586789-26586811 GGAGCATTAGAGGCCGGGCGTGG - Intronic
1080540204 11:33257677-33257699 GCAGCAGCAGCGGTCGGGGGAGG + Exonic
1081965385 11:47166150-47166172 AGAGCATTTTCGGCCGGGTGTGG - Intronic
1083443643 11:62692788-62692810 GCAGCATCACCTGCCGGGGGTGG + Exonic
1085308791 11:75503882-75503904 GCAGCATTCAGGGCTGGGGGAGG - Intronic
1086396532 11:86421598-86421620 GAAGGATGATCGGCCGGGCGCGG - Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1090164409 11:124532238-124532260 GAAGGATAATCGGCCGGGTGTGG + Intergenic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG + Intergenic
1095203747 12:39415545-39415567 GAAGCATTCTCGGCCGGGCGCGG - Intronic
1101761139 12:107660073-107660095 GCAGCATTATGGGATGGGGGTGG + Intergenic
1102094858 12:110230022-110230044 GCTGCATTACAGGCCGGGCGCGG + Intergenic
1103388234 12:120550884-120550906 GCCGCATTCTGGGCCGGGTGTGG - Intronic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1108508172 13:51132150-51132172 GCAGGATAAGCGGCCGGGCGCGG + Intergenic
1109213773 13:59564408-59564430 GCTACATAATCGGCCGGGCGCGG - Intergenic
1110211541 13:72979631-72979653 GAAGCATAATTGGCCGGGCGTGG + Intronic
1112327365 13:98450940-98450962 GCAGCATTTCCTGTCGGGGGAGG - Intronic
1112479709 13:99763841-99763863 TCACCATGATCGGCCGGGTGCGG - Intronic
1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1120133612 14:80837426-80837448 TAAGCCTTATCGGCCGGGCGTGG + Intronic
1120304150 14:82746678-82746700 CCTGCATTATCGGGCGGGTGCGG + Intergenic
1120894200 14:89515211-89515233 GGAGCATTCTTGGCCGGGCGTGG - Intronic
1122365298 14:101191603-101191625 GCAGCATTATTGCCAGGGAGGGG - Intergenic
1124358122 15:29013569-29013591 GACTCATTTTCGGCCGGGGGCGG - Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1134566647 16:15257463-15257485 AGAGCATCATCGGCCGGGCGCGG + Intergenic
1134735849 16:16499236-16499258 AGAGCATCATCGGCCGGGCGCGG - Intergenic
1137448716 16:48550611-48550633 GCAGGCTTATAGGCCGGGTGTGG + Intronic
1138274618 16:55724765-55724787 GCAGCATCATGGGCCTGGGAAGG + Intergenic
1139582532 16:67881888-67881910 GCAGCATTCTTGGCCTGGGAAGG + Intronic
1140435148 16:74940992-74941014 ACAGCATTTTCGGCTGGGCGCGG - Intronic
1143456324 17:7070202-7070224 GAGGCATTGTCGGCCGGGCGCGG + Intergenic
1143753463 17:9048944-9048966 GAAGCATTTTCCGCCGGGCGCGG - Intronic
1143790070 17:9287667-9287689 GAAGCATTATCAGGCAGGGGAGG - Intronic
1149720248 17:58836729-58836751 CCAGGATTATTGGCCGGGCGCGG + Intronic
1150680136 17:67277978-67278000 GCAGCTCTTTCGGCCGGGCGCGG - Intergenic
1150751844 17:67871059-67871081 GAAGCATTTTCGGCCGGGCGCGG - Intronic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1154005909 18:10526897-10526919 TCAGCATTGTGGGCCGGGCGCGG + Intronic
1155573145 18:27217214-27217236 GTATGATTATCGGCCGGGCGCGG + Intergenic
1166818612 19:45562398-45562420 GAAACATGATAGGCCGGGGGCGG + Intronic
924982313 2:235374-235396 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982401 2:235636-235658 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982422 2:235699-235721 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982533 2:236049-236071 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982553 2:236109-236131 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982560 2:236131-236153 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982587 2:236216-236238 GCAGCAGCATGGGCCAGGGGAGG + Intronic
924982594 2:236238-236260 GCAGCAGCATGGGCCAGGGGAGG + Intronic
927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG + Intergenic
929085514 2:38163884-38163906 GCAGCATTAGCAGCTGGTGGTGG + Intergenic
929191962 2:39148403-39148425 ACAGCATTATAGGCTGGGCGTGG - Intergenic
929891958 2:45925584-45925606 GCAGCATGCTTGGCCGGGCGCGG - Intronic
942285651 2:174413160-174413182 AGAGCACTATCGGCCGGGTGTGG - Intronic
946416316 2:219541772-219541794 GTGGCAGTAGCGGCCGGGGGTGG + Exonic
1170688762 20:18592970-18592992 GCATCATTATGGGCCGGGCATGG - Intronic
1174261519 20:49299102-49299124 ACAGCACTATAGGCCGGGCGTGG - Intergenic
1175443801 20:59007264-59007286 GCAGCCTTAAGGGCCGGGCGGGG - Intergenic
1177256149 21:18665054-18665076 CCAGCATTATCGTCAGGGCGCGG - Intergenic
1180689971 22:17705585-17705607 AAAGCAATATCGGCCGGGCGCGG - Intronic
1182463462 22:30499179-30499201 GCAGCATGACTGGCCGGGCGCGG - Intronic
1182856867 22:33525303-33525325 GCAGTACTATGGGCCTGGGGTGG - Intronic
1184640572 22:45867943-45867965 GCAGCCAGCTCGGCCGGGGGTGG - Intergenic
949635438 3:5976839-5976861 GAAGCATTTTCGGCCGGGCGTGG - Intergenic
950750417 3:15123872-15123894 GCAGCACTTTTGGCCAGGGGGGG - Intergenic
950890178 3:16397954-16397976 GAAGCATCATGGGCCGGGCGCGG + Intronic
951210973 3:19974441-19974463 GTAGCATTATAGGCCAGGCGTGG - Intronic
955329570 3:58035853-58035875 ACAACATTCTCGGCCTGGGGCGG + Intronic
960161048 3:114350883-114350905 GCAGCAGTTTGGGCCTGGGGCGG - Exonic
965534432 3:169810772-169810794 GCTGCATTTCCGGCCGGGTGCGG + Intronic
966379168 3:179326038-179326060 AGAGCATTATAGGCCGGGCGCGG + Intronic
968133108 3:196203664-196203686 GCAGCATTCTGGGCAGGGGAGGG + Intronic
968786980 4:2629839-2629861 TGTGCATTATCGGCCGGGTGCGG + Intronic
969015673 4:4102650-4102672 GCAGCACTTTCGGCTGGGCGGGG + Intergenic
972174272 4:36384202-36384224 GCAGCATAGTCGGAGGGGGGGGG - Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
975909317 4:79248722-79248744 GCAGCAGTATTGGCACGGGGTGG - Intronic
976257314 4:83111900-83111922 GCAGCTGTATCGGCTGGGTGTGG + Intronic
977662074 4:99600651-99600673 GCAGCATTATCCTCCAGGAGAGG + Exonic
978385371 4:108172054-108172076 GCAGCAAAATCGCCGGGGGGAGG - Intergenic
980952161 4:139391747-139391769 ACAGCATTATTGGCTGGGTGCGG - Intronic
984773005 4:183454548-183454570 GAAGCAGGATCGGCCGGGCGTGG - Intergenic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
990530235 5:56666409-56666431 GAAGCATTATAGGCTGGAGGTGG - Intergenic
993179621 5:84535276-84535298 GCTGCACTATTGGCCGGGTGCGG - Intergenic
997446533 5:133944282-133944304 GCATGATTATCGGCCAGGCGCGG - Intergenic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1014802383 6:125791097-125791119 GCAGCATCAGCGGCGGGCGGCGG - Intronic
1015415387 6:132941878-132941900 AAAGAATAATCGGCCGGGGGCGG + Intergenic
1015767604 6:136735537-136735559 GTAGCATGATAGGCCGGGTGAGG + Intronic
1015970135 6:138735297-138735319 TCAGCATACTCGGCCGGGCGCGG + Intergenic
1018246881 6:161832331-161832353 ACATCAATATCGGCCGGGTGGGG + Intronic
1023356409 7:39371467-39371489 GAACCATTCTCGGCCGGGCGTGG - Intronic
1026250854 7:68669280-68669302 ACAACATTCTCGGCCGGGTGCGG - Intergenic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1029074338 7:97924283-97924305 GTAGCACTTTCGGCCAGGGGGGG + Intergenic
1032783938 7:135186100-135186122 GCAGTATTATCTGCGGTGGGGGG - Exonic
1035747259 8:1971256-1971278 ACAGCTTTATTGGCTGGGGGAGG + Intergenic
1036243367 8:7097007-7097029 GCAGCACTTTTGGCCAGGGGAGG - Intergenic
1036257444 8:7217062-7217084 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036309490 8:7675658-7675680 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036360047 8:8070461-8070483 GCAGCACTTTCGGCAAGGGGAGG - Intergenic
1036731383 8:11268640-11268662 ACAGCATTTTCGGGGGGGGGGGG + Intergenic
1036890917 8:12596507-12596529 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036898463 8:12654423-12654445 GCAGCACTTTTGGCCAGGGGAGG + Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1039885908 8:41653892-41653914 GGCGCCTTGTCGGCCGGGGGTGG - Intronic
1041633169 8:60111043-60111065 GCATAATTATAGGCCGGGCGTGG - Intergenic
1047010724 8:120669740-120669762 CAAGCATTTTCGGCCGGGCGCGG - Intronic
1049082491 8:140454346-140454368 GCAGCATAATCAGCCGGGTGTGG + Intronic
1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG + Intergenic
1052962897 9:34316059-34316081 GTTCCATTATCGGCCGGGCGTGG + Intronic
1056588872 9:87949160-87949182 GAAACATTATCGGCTGGGCGCGG - Intergenic
1056789215 9:89614903-89614925 GCAGCATTCTCTGCTGGGGAAGG + Intergenic
1058127430 9:101211055-101211077 CCATAATTATAGGCCGGGGGCGG - Intronic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1059759016 9:117320798-117320820 GCAGCATGATCAGGTGGGGGTGG - Intronic
1062153843 9:135035048-135035070 GCAGGATTACCAGCCGGGTGTGG + Intergenic
1062390574 9:136332090-136332112 GCAGCAGCAGCGGGCGGGGGCGG - Intronic
1195396399 X:104415054-104415076 GCAGCAGTAGAGGCCGGGCGCGG + Intergenic
1195722411 X:107879092-107879114 GCAGCAGCATCTGGCGGGGGTGG + Intronic
1198082611 X:133253333-133253355 GTAGCATTCTGGGCCGGGCGTGG + Intergenic
1198522699 X:137468949-137468971 ACTGGATTATCGGCCGGGTGAGG - Intergenic
1200171856 X:154082540-154082562 AAAGCATTTTCGGCCGGGTGTGG - Intronic