ID: 1151331313

View in Genome Browser
Species Human (GRCh38)
Location 17:73410874-73410896
Sequence GGCCACTGCCCTAATTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151331307_1151331313 5 Left 1151331307 17:73410846-73410868 CCACCTCCTCTTGCTCTGGGTCA 0: 1
1: 1
2: 4
3: 48
4: 505
Right 1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104
1151331303_1151331313 27 Left 1151331303 17:73410824-73410846 CCTGGGAATTCAGTGGCCTCTGC 0: 1
1: 0
2: 3
3: 23
4: 221
Right 1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104
1151331308_1151331313 2 Left 1151331308 17:73410849-73410871 CCTCCTCTTGCTCTGGGTCACCA 0: 1
1: 0
2: 4
3: 31
4: 286
Right 1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104
1151331309_1151331313 -1 Left 1151331309 17:73410852-73410874 CCTCTTGCTCTGGGTCACCATGG 0: 1
1: 0
2: 0
3: 19
4: 235
Right 1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104
1151331304_1151331313 11 Left 1151331304 17:73410840-73410862 CCTCTGCCACCTCCTCTTGCTCT 0: 1
1: 1
2: 10
3: 201
4: 1991
Right 1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151331313 Original CRISPR GGCCACTGCCCTAATTGTCC TGG Intronic
901149746 1:7093316-7093338 GGCCACTGGCCTAGTTTTCTGGG + Intronic
901557648 1:10044383-10044405 GACCACTGCCCTAATTCACTTGG - Intronic
901634773 1:10665383-10665405 GGCCACTGCGCTCTTGGTCCCGG + Exonic
903374719 1:22858669-22858691 GGCCACTGCCCACAGTGCCCGGG - Intronic
905044009 1:34982385-34982407 AGCCACTGCCCTATTTGGCTGGG - Intronic
905344891 1:37304616-37304638 GGCCACTTCCTGCATTGTCCTGG - Intergenic
907911379 1:58829866-58829888 AGCAACTGTCCTAATTGGCCTGG + Intergenic
911368593 1:96970322-96970344 AGCAATTGCCCTAATTTTCCAGG - Intergenic
913053058 1:115133706-115133728 GCCCACTGCTCTAATTCCCCAGG - Intergenic
915348654 1:155211315-155211337 GGCCACTGCCCTGATTGCTTAGG + Intronic
915351847 1:155231943-155231965 GGCCACTGCCCTGATTGCTTAGG + Intergenic
915567403 1:156723283-156723305 GTCCACTGCCCTGTTTCTCCTGG + Exonic
922754537 1:228088250-228088272 GGATTCTGCCCTGATTGTCCCGG - Intronic
1063015910 10:2076747-2076769 CTCCACTGCCCCCATTGTCCCGG + Intergenic
1065046617 10:21752057-21752079 GGGCACTGCCCTCATCCTCCTGG - Intergenic
1065965320 10:30766063-30766085 GGCCTCTCCCCTAATTGTAGGGG - Intergenic
1066681347 10:37939015-37939037 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
1066988068 10:42485848-42485870 GGCTACTGCCCTCAGTGTGCTGG + Intergenic
1069590302 10:69637334-69637356 GGCCACTGCCCCAAGTGCCCAGG + Intergenic
1072256869 10:93629546-93629568 GACCACTGCCGTAAATGACCAGG - Intronic
1074666434 10:115731279-115731301 GGCCACAGTCCACATTGTCCTGG - Intronic
1075439648 10:122469528-122469550 TCCCACTGCCCTAACTGTCCTGG - Intronic
1076294878 10:129376481-129376503 GGCCCCTCCCTTACTTGTCCTGG - Intergenic
1077242320 11:1517179-1517201 GGGCACTGGCCCAACTGTCCTGG - Intergenic
1078338412 11:10482101-10482123 GGCCAAGGCCCTAATGATCCGGG + Exonic
1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG + Intronic
1087194513 11:95292250-95292272 GGCCTCTGCTCTACCTGTCCTGG + Intergenic
1087480387 11:98693074-98693096 AGACACTGCCCTCATTGTCTTGG - Intergenic
1088863103 11:113820788-113820810 GTCCACTGCCCTATTTCTCCTGG + Intronic
1089663142 11:119998749-119998771 GGCCCCTGGCCTAACTGGCCTGG + Intergenic
1089867537 11:121644889-121644911 ATCCAGTGCCCTAATTGACCAGG - Intergenic
1090329592 11:125920606-125920628 ACCCACTGCCCAAATTGTACAGG - Intronic
1091100416 11:132867747-132867769 GCCCACTGCCCTAAGTGTAATGG + Intronic
1092048423 12:5450007-5450029 GGCCACTGCCCTAGTGGTTGGGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094343863 12:29444365-29444387 GCTCTCTTCCCTAATTGTCCTGG + Intronic
1101605587 12:106246189-106246211 GGCCACTGCCCTGTTCGTCAAGG - Intronic
1101962508 12:109260404-109260426 ACCCACTGCCCTAGTTGTCCTGG - Intronic
1117926194 14:60782255-60782277 GGCCATTTCCCCAATTTTCCAGG + Intronic
1123153256 14:106202546-106202568 GGCCACTGCCATACCGGTCCAGG - Intergenic
1123981897 15:25612430-25612452 GGCCACAGCCCCATTTCTCCAGG - Intergenic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1128820487 15:70648284-70648306 GGCCACTTCCATCTTTGTCCAGG - Intergenic
1129832922 15:78682343-78682365 GGCCACTGTCCTCACTGCCCTGG + Intronic
1131578597 15:93617636-93617658 CACCAGTGCCCTAATTGTGCAGG + Intergenic
1132952852 16:2574267-2574289 GTCTTCTTCCCTAATTGTCCTGG + Intronic
1132961499 16:2625901-2625923 GTCTTCTTCCCTAATTGTCCTGG - Intergenic
1133782641 16:8951918-8951940 GCCCACTGCCTGAATAGTCCAGG - Intronic
1135016822 16:18930459-18930481 GGCCCCTGCCCTGATTTTCCTGG + Intergenic
1135322457 16:21506312-21506334 GGCCCCTGCCCTGATTTTCCTGG + Intergenic
1136333935 16:29599438-29599460 GGCCCCTGCCCTGATTTTCCTGG + Intergenic
1137404435 16:48178647-48178669 GGCCACTGCCCGGATTGGCTTGG - Exonic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1151331313 17:73410874-73410896 GGCCACTGCCCTAATTGTCCTGG + Intronic
1153543339 18:6180649-6180671 GGCCACTGCCCAAATTCATCAGG + Intronic
1156226913 18:35118569-35118591 GGCTACTGCAGTAATTTTCCTGG - Intronic
1159178777 18:64874338-64874360 GGCCACAGCCCCATTTGTTCTGG + Intergenic
1160346928 18:78139733-78139755 GGCCACTGCCCGCTTTGTCCTGG + Intergenic
1163545074 19:17936464-17936486 GGCCTCTGCCCTACGTGCCCGGG - Exonic
1164063286 19:21693611-21693633 GGCCACTGCCTTGCTAGTCCAGG - Intergenic
1164758206 19:30706803-30706825 GGCCACTGTCCTAATTACCATGG - Intronic
1167101004 19:47404325-47404347 GCCCACTGCCCTACCTGGCCTGG + Intronic
1168098624 19:54129104-54129126 GCCCACTGCCCGACTTGCCCAGG - Exonic
932401223 2:71482319-71482341 GGCCTCTGCCCTCACTGGCCTGG - Intronic
933165217 2:79068090-79068112 GGCCACTTCCCAACTTCTCCAGG - Intergenic
934934777 2:98457161-98457183 GGCCAGTGCCCTGAGTGTCTGGG - Intronic
935069584 2:99682203-99682225 GGCCACTGCCTTAATTCTAACGG + Intronic
936993064 2:118386406-118386428 GCCCACTGCCCAAATGGTGCAGG - Intergenic
939045808 2:137248523-137248545 GACCAGTTCCCTAATTGACCTGG - Intronic
945955708 2:216084046-216084068 CGTCACTGCCCTCTTTGTCCTGG + Intronic
948428935 2:237906338-237906360 GGTCACTGCCCTGAGTGTGCAGG - Intronic
1173027601 20:39323833-39323855 AGCCACTGCCCTACTTCTCAAGG - Intergenic
1173158966 20:40638510-40638532 GGCCACTGCCCCCATTGTGCTGG + Intergenic
1174178259 20:48658320-48658342 GGCCACTTCCCTACTAGACCTGG - Intronic
1178270518 21:31185000-31185022 CGCCACTGCCTTTTTTGTCCTGG - Intronic
1182445337 22:30386648-30386670 GGCCACTGCCCTTATTCTCCTGG + Exonic
1183664161 22:39237786-39237808 GGTCACTGCCCCTATGGTCCTGG + Intronic
953215406 3:40913524-40913546 TGCCCCTGCCTTCATTGTCCGGG - Intergenic
954424076 3:50434232-50434254 GGACACTGCCCTCATGGTACAGG + Intronic
954464125 3:50644740-50644762 GGCCACAGCCAGAATTTTCCTGG - Intronic
959063607 3:101636592-101636614 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
959476133 3:106814459-106814481 GGCCATTGCCCTTATTGAACTGG - Intergenic
959619324 3:108382994-108383016 GGCCATTGCCCTGATTTTACTGG - Intronic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
971977530 4:33710110-33710132 GGCCACTGTCCTCAATGACCCGG - Intergenic
973262702 4:48180888-48180910 GGCAACTGCCGTAATAGTTCAGG + Intronic
973791429 4:54381408-54381430 TGCCACTGTCCTAAATCTCCAGG - Intergenic
979661383 4:123259504-123259526 GGCTATGGCCCTCATTGTCCTGG + Intronic
981989575 4:150901534-150901556 GGAAAATGCCCTCATTGTCCAGG - Intronic
982831285 4:160063812-160063834 GGCCACTGCCCTAAGTGAAATGG - Intergenic
988492509 5:31716893-31716915 GCCCCCTGCCCTAATCATCCAGG - Intronic
993884858 5:93404010-93404032 GCCAACTGCCATAAGTGTCCCGG - Intergenic
997266995 5:132500794-132500816 GGCCACAGCCCTAATATGCCTGG - Intergenic
998350142 5:141495038-141495060 GGCGACTGCCCTGACTGTTCAGG + Intronic
1001452117 5:171834964-171834986 GGCCACAGCCAGAATTGGCCTGG - Intergenic
1003803517 6:9699439-9699461 AGCCATTGCCCCAATGGTCCAGG - Intronic
1005078815 6:21936136-21936158 GGTCATTGCCCTCACTGTCCTGG + Intergenic
1005738657 6:28771651-28771673 GGCCACTGCCTTGCCTGTCCAGG - Intergenic
1018181675 6:161228534-161228556 TGCCAGTGACCTAATTGTCCTGG - Intronic
1019301434 7:306035-306057 GGCCTCTGCCCTCTCTGTCCCGG + Intergenic
1024497746 7:50067756-50067778 TGCCACTGCCCTACTGGTGCAGG - Intronic
1025021451 7:55483528-55483550 AGGCACTGCCCTATTTGGCCAGG - Intronic
1026808693 7:73444225-73444247 GGCCACTGCTTTCCTTGTCCAGG - Intronic
1047365788 8:124210140-124210162 GGCCTCTAGCCTAATTCTCCTGG + Intergenic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1049795976 8:144497425-144497447 GGCCGCTGCCCGAAATGACCTGG + Exonic
1051088377 9:13378658-13378680 GGCCCCTGTCCTAATTCACCCGG - Intergenic
1054938346 9:70713084-70713106 GACCACTGCCCTAATTTTGAAGG - Intronic
1054940037 9:70731077-70731099 GACCACTGCCCTAATTTTGAAGG - Intronic
1056210748 9:84362588-84362610 GGCCACTGCCCTTATAGCCTGGG + Intergenic
1060154840 9:121312413-121312435 GGCCACTCCGCTCGTTGTCCCGG - Exonic
1061193656 9:129095972-129095994 GGCCACTGCCCCAGGTGCCCCGG - Intronic
1186823322 X:13313438-13313460 GGACAGTGCCCTCTTTGTCCAGG - Intergenic
1190303440 X:49069147-49069169 GCCCACTGCCCCAACTGCCCTGG - Intronic
1195713409 X:107794277-107794299 GGCCACTGAACTGATGGTCCCGG - Exonic
1195858413 X:109355510-109355532 GGGCACTTCACTAATTGTCATGG - Intergenic
1199989820 X:152980517-152980539 TACCACTGCCATCATTGTCCAGG - Intergenic
1200846405 Y:7835557-7835579 GGCTACTGCCATACTGGTCCAGG + Intergenic