ID: 1151338731

View in Genome Browser
Species Human (GRCh38)
Location 17:73456161-73456183
Sequence CAGGATGACCACAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 430}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151338718_1151338731 27 Left 1151338718 17:73456111-73456133 CCAGCTCCCAGGTTGGGAGTGGT 0: 1
1: 0
2: 1
3: 36
4: 215
Right 1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG 0: 1
1: 1
2: 5
3: 50
4: 430
1151338716_1151338731 28 Left 1151338716 17:73456110-73456132 CCCAGCTCCCAGGTTGGGAGTGG 0: 1
1: 0
2: 4
3: 23
4: 230
Right 1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG 0: 1
1: 1
2: 5
3: 50
4: 430
1151338721_1151338731 20 Left 1151338721 17:73456118-73456140 CCAGGTTGGGAGTGGTGGCTATG 0: 1
1: 0
2: 1
3: 28
4: 306
Right 1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG 0: 1
1: 1
2: 5
3: 50
4: 430
1151338720_1151338731 21 Left 1151338720 17:73456117-73456139 CCCAGGTTGGGAGTGGTGGCTAT 0: 1
1: 0
2: 3
3: 54
4: 593
Right 1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG 0: 1
1: 1
2: 5
3: 50
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151338731 Original CRISPR CAGGATGACCACAGGGAAGG AGG Intronic
900132192 1:1091886-1091908 CAGGGCCACGACAGGGAAGGTGG + Intronic
900397527 1:2459305-2459327 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397532 1:2459321-2459343 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397546 1:2459369-2459391 AAGGAGGACCACCGGCAAGGAGG - Intronic
900397560 1:2459417-2459439 AAGGAGGACCACCGGCAAGGAGG - Intronic
900397565 1:2459433-2459455 AAGGAGGACCACCGGCAAGGAGG - Intronic
900397579 1:2459481-2459503 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397584 1:2459497-2459519 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397589 1:2459513-2459535 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397594 1:2459529-2459551 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397599 1:2459545-2459567 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397604 1:2459561-2459583 AAGGAGGACCACCGGCAAGGAGG - Intronic
900397609 1:2459577-2459599 AAGGAAGACCACCGGCAAGGAGG - Intronic
900397617 1:2459609-2459631 AAGGAGGACCACAGGCAAGGAGG - Intronic
900397621 1:2459625-2459647 AAGGAAGACCACAGGCAAGGAGG - Intronic
900397629 1:2459657-2459679 AAGGAAGACCACAGGCAAGGAGG - Intronic
900821433 1:4892347-4892369 CAGGATGAACACACACAAGGTGG + Intergenic
903128643 1:21264005-21264027 CAGGATGGCGGCAGAGAAGGGGG + Intronic
903680996 1:25096816-25096838 GGCGATGACCACAGGGAAGAAGG + Intergenic
903975300 1:27145873-27145895 CAGCATGATCCCAGGGAAGGCGG + Intronic
904480695 1:30791557-30791579 AAGGAGGAAGACAGGGAAGGAGG + Intergenic
904596857 1:31652231-31652253 CTGGCTGACCACAGGCAAGGAGG + Exonic
904598009 1:31658784-31658806 GAGGCTGACACCAGGGAAGGAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905870594 1:41402016-41402038 CACTATGACCACAGGGCTGGAGG - Intergenic
905908780 1:41639647-41639669 AAGGCTGACCACAGAGAGGGAGG - Intronic
906230885 1:44163053-44163075 CATAATGACATCAGGGAAGGTGG - Intergenic
907919049 1:58895994-58896016 CAGGATGGGCACAGGGCTGGGGG + Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908292503 1:62682500-62682522 CAGTATAAAAACAGGGAAGGGGG + Intronic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
909520971 1:76567031-76567053 AAGAATGAGGACAGGGAAGGAGG + Intronic
909776845 1:79493028-79493050 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
911523704 1:98959562-98959584 CAGTATGACTCCAGGGAAAGAGG - Intronic
911642448 1:100303556-100303578 CAGGTTGACCACAGTGGAGGAGG + Intergenic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
913218077 1:116637173-116637195 CAGGATGTCCACAGGCACAGGGG - Intronic
915443604 1:155962021-155962043 CGGTATGACCACAGGAAGGGTGG - Intronic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
918112074 1:181464839-181464861 CAGGATGGTCAGAGGTAAGGTGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919805537 1:201379129-201379151 GAGGACCACCACAGGGAAGCAGG + Intronic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920093720 1:203472163-203472185 CAGGACCACCACGGGGGAGGTGG + Intergenic
920118308 1:203636875-203636897 CAGGATGACCAGGGGAAAAGAGG + Intronic
921464953 1:215476706-215476728 CAGGAGGAAGACAGAGAAGGGGG + Intergenic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
922998134 1:229983145-229983167 GAGGATTCCCAAAGGGAAGGAGG + Intergenic
923621739 1:235585133-235585155 AAGGAAGACCAGAGGGAGGGAGG - Intronic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
924628552 1:245715700-245715722 CAGGAAGCCCACAGTGATGGAGG - Intergenic
1063073937 10:2695534-2695556 CAGGATGGCAGCAGGCAAGGGGG + Intergenic
1063084207 10:2800376-2800398 CAGAATGACGTCAGGGAAGAAGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1067703301 10:48588944-48588966 TGGGATGACCTCAGGGGAGGTGG + Intronic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069784289 10:70977875-70977897 CAGGATGACTGCAGGGATGATGG + Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070306989 10:75245612-75245634 CAGGATCTCCTCAGGGCAGGGGG + Intergenic
1070788838 10:79177856-79177878 CAGGATGACCTCTGGGTGGGAGG - Intronic
1072341180 10:94452221-94452243 CAGGATGCTGACAGTGAAGGAGG - Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073072455 10:100803316-100803338 GAGGATAAGCTCAGGGAAGGAGG - Intronic
1073183684 10:101602332-101602354 CACGAGGCCCACAGGGAAGCAGG + Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1075999475 10:126904159-126904181 CAGGATGGCCACAGGGCCTGGGG - Intergenic
1076357763 10:129865464-129865486 CCAGAAGACCACAGGGGAGGTGG - Intronic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1077353415 11:2103548-2103570 CAGGAAGCCCACTGGGAGGGTGG - Intergenic
1078114039 11:8426936-8426958 CATGAGGAGCACTGGGAAGGGGG - Intronic
1078416819 11:11172860-11172882 CAAGTGGACCACAGGGAATGAGG + Intergenic
1078870744 11:15342317-15342339 GAGGCTGGCCAAAGGGAAGGCGG - Intergenic
1079112168 11:17611009-17611031 AAAGAGCACCACAGGGAAGGTGG + Exonic
1079792902 11:24761270-24761292 CAGGAGGAAGACAGAGAAGGGGG + Intronic
1081203603 11:40248548-40248570 TAGGAAGACCACAGGCATGGTGG + Intronic
1082648323 11:55755758-55755780 CAGGATGACCCCATGGAAAATGG - Intergenic
1082679641 11:56152450-56152472 CAAGATGGCCACTGGGATGGCGG - Intergenic
1083723399 11:64614978-64615000 CTTGATGACCACAGGCAAGCCGG + Intronic
1083756972 11:64797013-64797035 CAGGATGACCTCTGGGAGGGAGG + Exonic
1083776371 11:64896075-64896097 CAGAAGGACCCCAGGGAAGCTGG - Intronic
1084146777 11:67269192-67269214 CAGGATCACCACTGGGGCGGCGG - Intronic
1084167054 11:67379919-67379941 TGGGATGGCCCCAGGGAAGGCGG - Intronic
1084486357 11:69450474-69450496 CAGGAGGCCCACAGGGCTGGGGG - Intergenic
1084652431 11:70496952-70496974 CCAGATGTCCACAGGCAAGGTGG - Intronic
1084719224 11:70893377-70893399 GGGGGTGACCACAGGGGAGGGGG + Intronic
1084900023 11:72302665-72302687 CAGGATGCCCTCAGGAAACGTGG - Intronic
1085760973 11:79241294-79241316 AAGGAGGAAGACAGGGAAGGAGG + Intronic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1087283004 11:96233216-96233238 TAACATGACCACAGGAAAGGAGG + Intronic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1089612510 11:119677383-119677405 CAGGAGGGCGACAGGGAAGGAGG + Intronic
1090772763 11:129936020-129936042 CAGCCTGACCTCATGGAAGGAGG + Intronic
1091773520 12:3169242-3169264 CAGGTTGACCTCAGGGCTGGGGG + Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094115541 12:26908194-26908216 AAGGATGACTACAGGGATTGAGG + Intronic
1097520105 12:60656701-60656723 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
1098613481 12:72491639-72491661 CATGATGAACACAGAGAAAGTGG - Intronic
1099474530 12:83092290-83092312 CAGGATGCCAACATGGTAGGAGG - Intronic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1101303443 12:103504274-103504296 CAGGTTGGCCACAGGTGAGGTGG - Intergenic
1101919758 12:108922870-108922892 CTGAATCACCCCAGGGAAGGAGG - Intronic
1103228609 12:119309087-119309109 CAGGATGATAGAAGGGAAGGAGG - Intergenic
1103362766 12:120363401-120363423 AAGGACTAACACAGGGAAGGGGG + Intronic
1103699482 12:122841416-122841438 CCTGATGACCCCAGGGTAGGTGG - Intronic
1103890117 12:124232288-124232310 CCAGATGATCCCAGGGAAGGAGG - Intronic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104034915 12:125091553-125091575 CAGGATGCTCACAGGGCAAGGGG - Intronic
1104053413 12:125211428-125211450 CAGGAAGCCCACAGGGTTGGAGG - Intronic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104727158 12:131085166-131085188 GAAGATGACCTCAGGGAACGAGG + Intronic
1104876583 12:132039104-132039126 CAAGCTGAGCACAGGCAAGGAGG - Intronic
1105285021 13:18996421-18996443 AAGGAGGAACACAGGAAAGGGGG + Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1107237699 13:38192757-38192779 CAGGATGAGGTCAGGGAAGGAGG - Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1108730254 13:53227906-53227928 CAGGAAGACCTCAGGGAATAGGG - Intergenic
1109032741 13:57214072-57214094 CAGGATGTGGACAGGGAAAGGGG + Intergenic
1110076415 13:71250018-71250040 CAGGGAAGCCACAGGGAAGGTGG - Intergenic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1111254666 13:85651010-85651032 AAGGAGGATCTCAGGGAAGGCGG - Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114693582 14:24607105-24607127 CAGAAAGACCACAGGGAGAGAGG - Intronic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1115718242 14:36129326-36129348 CAGGCTGCCCCCAGGGTAGGAGG - Intergenic
1117176815 14:53153477-53153499 CATGAAGACCGCAAGGAAGGAGG - Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1117588384 14:57238465-57238487 TAGGATGAAGACAGGGTAGGGGG + Intronic
1117955966 14:61123849-61123871 AAGGAAGACCATAGGGGAGGGGG - Intergenic
1119783596 14:77296076-77296098 CAGGATGAGCAAAGGATAGGAGG + Intronic
1119976360 14:79028709-79028731 TAGGATGTTGACAGGGAAGGGGG + Intronic
1120251543 14:82065561-82065583 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
1120279809 14:82424787-82424809 CAGGATGCCCACAGGTAAGAAGG + Intergenic
1120526062 14:85578542-85578564 GAGGCAGAGCACAGGGAAGGAGG + Intronic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121740837 14:96251346-96251368 CAGGATGGCCAGCGAGAAGGTGG + Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122781228 14:104144407-104144429 CAGGTAGAGGACAGGGAAGGAGG + Intronic
1123003432 14:105309258-105309280 CAGGATAACCACAGTCAAGAGGG + Exonic
1123114440 14:105888177-105888199 TGGGAAGAGCACAGGGAAGGAGG - Intergenic
1123116595 14:105897582-105897604 TGGGAAGAGCACAGGGAAGGAGG - Intergenic
1123118651 14:105906833-105906855 TGGGAAGAGCACAGGGAAGGAGG - Intergenic
1123643810 15:22422957-22422979 TAGCATGACAGCAGGGAAGGGGG + Intergenic
1123665090 15:22602570-22602592 TAGCATGACAGCAGGGAAGGGGG + Intergenic
1123734502 15:23172408-23172430 TAGCATGACAGCAGGGAAGGGGG - Intergenic
1124136725 15:27042065-27042087 CAGGCTGACCTCAGTGAACGAGG + Intronic
1124285008 15:28393716-28393738 TAGCATGACGGCAGGGAAGGGGG - Intergenic
1124297689 15:28517898-28517920 TAGCATGACGGCAGGGAAGGGGG + Intergenic
1124318922 15:28696992-28697014 TAGCATGACAGCAGGGAAGGGGG + Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1124678674 15:31710530-31710552 CAGCAAGACCTCAGGGCAGGGGG + Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125744435 15:41989067-41989089 CAGGGAGACCACAGGGTAAGGGG - Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126210764 15:46098275-46098297 CAGGATGACGGCCGGGAAGAGGG + Intergenic
1127568300 15:60215094-60215116 CAAGCTGACCACATGGGAGGGGG - Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1130134798 15:81173641-81173663 CAGTATGATCTCAGGGAAAGAGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131832926 15:96365854-96365876 CAGGATGACCGCAAGGGAGCAGG + Intergenic
1132121639 15:99180935-99180957 CTGGAGGGACACAGGGAAGGAGG + Intronic
1132363681 15:101239896-101239918 CAGGAAGAACACAGTGAAAGAGG + Intronic
1132702580 16:1228435-1228457 CAGGCTTAGGACAGGGAAGGGGG + Exonic
1132705746 16:1242433-1242455 CAGGCTTAGGACAGGGAAGGGGG - Exonic
1132744394 16:1430670-1430692 CAGGAGGACCCTGGGGAAGGGGG - Intergenic
1133137323 16:3720987-3721009 CAGCATGTCCTCAGGGAATGGGG + Intergenic
1133417023 16:5614890-5614912 GAGGAAGAACACAGGGAGGGTGG + Intergenic
1133639829 16:7706008-7706030 CAGGATGTCCACAGGAATGATGG - Intronic
1134006606 16:10822339-10822361 CAGAACAACCCCAGGGAAGGAGG + Intergenic
1137480932 16:48851497-48851519 CAATATCACCCCAGGGAAGGGGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139353719 16:66354195-66354217 CAGGATGAAAGCAGAGAAGGAGG + Intergenic
1139513622 16:67440956-67440978 TTGGCTGGCCACAGGGAAGGAGG - Intronic
1139591580 16:67936051-67936073 CGAGATGACCACACGGATGGTGG - Exonic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140408277 16:74725343-74725365 CAGACAGACCACAGGGCAGGTGG + Intronic
1141147992 16:81545216-81545238 CAGGCTGACCACAGGTACTGTGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141361051 16:83395396-83395418 CAGGATGACCACTGGCAAACAGG - Intronic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1142199542 16:88754517-88754539 CTCGATCACCACAGGGAACGAGG - Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142945548 17:3423395-3423417 CAGGTGGAACACAGGAAAGGAGG - Intergenic
1143407434 17:6686704-6686726 GAGGAGGTCCACAGGGAAGCTGG - Intronic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1145305649 17:21673621-21673643 GAGGCTGACCACAGGAAAGGTGG + Intergenic
1146652259 17:34614016-34614038 CAGGATGACCACGAGGGAAGGGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146839057 17:36136879-36136901 TAGGATAACCACAGGGAAGCAGG + Intergenic
1147553995 17:41464750-41464772 CAGGATGAACACAGGTGGGGAGG - Intronic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152177954 17:78800275-78800297 CTGGATGGCCACAGGGGTGGAGG + Intronic
1152453745 17:80400768-80400790 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156202714 18:34852680-34852702 CAGGAGGAACACATGGGAGGTGG - Intronic
1157049970 18:44152038-44152060 CAGGAAGAGAATAGGGAAGGTGG + Intergenic
1157231289 18:45918710-45918732 CATGATGACCAAAGGCAATGTGG + Intronic
1158397124 18:57088214-57088236 CAGGGAGACCACAGGGCTGGGGG + Intergenic
1160155250 18:76429027-76429049 CAGGCTGACCCCGGGGAAGTTGG + Intronic
1160536867 18:79599123-79599145 CGGGATGACCACAGAGCTGGGGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1161852843 19:6746548-6746570 GAGGTTGACCAGAGGTAAGGTGG + Exonic
1161870967 19:6869655-6869677 CAGGATGATGACAGGATAGGGGG - Intergenic
1162013803 19:7832796-7832818 CAGGAGGACCACGGGGAACAGGG + Intronic
1162014078 19:7834573-7834595 CAGGATCACCACAGAAAGGGAGG + Intronic
1162554913 19:11380922-11380944 CAGGATGACCACGAGGATGAGGG + Exonic
1162936469 19:13983996-13984018 CAGGGTCACCCCAGAGAAGGTGG - Intronic
1163111137 19:15161417-15161439 CAGGAGGCCCCCCGGGAAGGCGG - Exonic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164597049 19:29537204-29537226 AAGCACGACCCCAGGGAAGGAGG - Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
1166411085 19:42555748-42555770 CAGGCTGACCCCAGGCCAGGAGG - Intronic
1166714957 19:44961070-44961092 CAGAATGACAGAAGGGAAGGGGG - Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167342599 19:48924715-48924737 CAGGATGACTTCAGGGAACCAGG + Intergenic
1168065219 19:53915383-53915405 GAGGCTGACCATGGGGAAGGGGG - Exonic
925210986 2:2045876-2045898 ATGGAGGACCACAGGGAGGGAGG - Intronic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925841357 2:7995181-7995203 CAGGTAGATCACAGGGAAGGTGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926826096 2:16906303-16906325 CAGAATCACCAAAGGGGAGGTGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927574159 2:24187379-24187401 CAGGATGTCAACAGTGGAGGAGG - Intronic
928141755 2:28735500-28735522 TTGGATGACCACAGGAAAGGAGG + Intergenic
928255225 2:29716501-29716523 TAGAATGAGCACAGAGAAGGAGG + Intronic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
931571937 2:63678460-63678482 CAGGAAGACAAAAGGGAATGGGG + Intronic
933559603 2:83874301-83874323 CAAGATGGCCACTGGGATGGTGG + Intergenic
933560467 2:83879387-83879409 CAAGATGGCCACTGGGATGGCGG + Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
935597495 2:104890598-104890620 CAGGATAGCCACAGAGAAGGAGG - Intergenic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938766630 2:134464243-134464265 CAGCATCTCCCCAGGGAAGGTGG - Intronic
939176695 2:138757390-138757412 GAGGAGGACCCAAGGGAAGGTGG - Intronic
939460881 2:142494334-142494356 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
941723218 2:168834415-168834437 CAGGAATCCCACAGAGAAGGAGG - Intronic
945195354 2:207232381-207232403 CAGGATTCCCTCAGGAAAGGGGG - Intergenic
946183427 2:217962815-217962837 CACGATGACCACATGCAATGTGG + Intronic
946438112 2:219672589-219672611 CAACATGACCCCAGGGGAGGAGG + Intergenic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947739780 2:232479858-232479880 CAGCAAGAACACAGCGAAGGTGG + Exonic
947868778 2:233420472-233420494 TAGGATGCCCCCAGGGAAGGGGG - Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948699264 2:239750245-239750267 CAGGATGAGCGCAGGGGACGAGG - Intergenic
948807817 2:240460529-240460551 CAGGATGTCCCCAGGCCAGGAGG - Intronic
948860445 2:240750268-240750290 CAGGTTGACCCCAGGGAGAGTGG + Intronic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
1168840343 20:906044-906066 CAGGATGACCCCAGGGATCCTGG + Intronic
1169522017 20:6384486-6384508 CAGGATGAGCTCATGGAAGAGGG - Intergenic
1169613494 20:7411290-7411312 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
1170350233 20:15432459-15432481 CAGGATGAGCACTGGGCTGGAGG + Intronic
1170480781 20:16762927-16762949 CAGGATGACAATAGCAAAGGTGG - Intronic
1171523168 20:25791111-25791133 GAGGCTGACCACAAGAAAGGCGG + Intronic
1171530910 20:25853089-25853111 GAGGCTGACCACAAGAAAGGCGG + Intronic
1171553658 20:26064772-26064794 GAGGCTGACCACAAGAAAGGCGG - Intergenic
1172108136 20:32528685-32528707 CAGGGAAACCACAGGGCAGGAGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173516668 20:43669288-43669310 CAGGATGGCGCCAGGCAAGGTGG - Intronic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1175817915 20:61893223-61893245 ATGGGTGACCACAGGGATGGTGG + Intronic
1175828493 20:61949966-61949988 CCAGAGGCCCACAGGGAAGGCGG - Intergenic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1178095417 21:29209955-29209977 AATTATGAACACAGGGAAGGAGG + Intronic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178418762 21:32426465-32426487 GAGCAGGAACACAGGGAAGGAGG - Intronic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1178977465 21:37232008-37232030 GAGGATGACAACAGGCCAGGGGG + Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179495594 21:41769487-41769509 CAGGAGGAACACAGGGTAGTGGG - Intergenic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1180135344 21:45858690-45858712 CAGGAAGACCTCACTGAAGGGGG - Intronic
1180610634 22:17095435-17095457 CATGAAGACCACAAGGAAAGTGG - Intronic
1180819384 22:18815257-18815279 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181116320 22:20634475-20634497 CAGTCTGGCCTCAGGGAAGGGGG - Intergenic
1181205609 22:21249702-21249724 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1183247990 22:36708754-36708776 GAGGATGAACACAGGGACTGTGG - Intergenic
1183588416 22:38766413-38766435 CAGGCTGGGCCCAGGGAAGGGGG + Intronic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
1184995909 22:48207477-48207499 CAGGATGACCACAGAGACCCAGG - Intergenic
1185277915 22:49957728-49957750 CAGGATAGCCCAAGGGAAGGAGG + Intergenic
1203221314 22_KI270731v1_random:45711-45733 CAGGATGTCCACAGGCACAGGGG + Intergenic
1203269512 22_KI270734v1_random:41110-41132 CAGGATGTCCACAGGCACAGGGG - Intergenic
949219832 3:1618523-1618545 AAGGAGGAACATAGGGAAGGAGG + Intergenic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
950442205 3:13016580-13016602 CAGGAGGAGCACAGAGGAGGAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
950575695 3:13830816-13830838 AAGGATGACTACAGGGATGTGGG - Intronic
950626159 3:14248651-14248673 AAGGATGAGCACAGGAAGGGAGG - Intergenic
951140160 3:19148612-19148634 CCTGATGACGGCAGGGAAGGGGG - Exonic
951285496 3:20807913-20807935 CAGGATGACCTCTGGGGAGCTGG - Intergenic
951894718 3:27599953-27599975 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
953024682 3:39138035-39138057 CAGGAGGGCTACAGGGAAAGGGG + Intronic
954326474 3:49866862-49866884 CAGGATGATCTCAGCGGAGGAGG - Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955366697 3:58316522-58316544 TAGGATGTCCAAAGGTAAGGCGG - Exonic
955566946 3:60257621-60257643 CAGGAGGAGGACAAGGAAGGTGG + Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956320661 3:67992878-67992900 AAGGAAGAACACAGGGGAGGAGG - Intergenic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958187706 3:90144489-90144511 CAGGAAAACCACAGGAAAGGGGG + Intergenic
958456456 3:94337880-94337902 CAGGATGACAACAGGGATTTTGG - Intergenic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
960087970 3:113611104-113611126 CATGATGACCACAGCAAAGGAGG - Exonic
960182543 3:114598108-114598130 CAGAATGGCCACAGGCAAAGTGG - Intronic
960958705 3:123053760-123053782 GACAATGACCACAGGGGAGGAGG - Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962445054 3:135456449-135456471 CAGGAGGATCCCTGGGAAGGGGG + Intergenic
962485483 3:135838526-135838548 CTGGATGACCCCAGGGTAGGAGG + Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965286878 3:166828558-166828580 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
967984045 3:195082338-195082360 CAGGAAGACCACCAGGGAGGGGG - Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
970056598 4:11980320-11980342 AAAGATGATCACAGGGAAGATGG + Intergenic
970454181 4:16205620-16205642 CATGCACACCACAGGGAAGGAGG + Intronic
972573296 4:40329833-40329855 CAGGAAGACAATAGGGAAGGTGG + Intergenic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
974752651 4:66160767-66160789 CAGGATGGCAACAGGGATGATGG + Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
978381695 4:108135518-108135540 CAGGATGGCGAGAGTGAAGGTGG + Intronic
979952149 4:126906625-126906647 CAGAATGGCCACACAGAAGGAGG + Intergenic
981482869 4:145256019-145256041 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
981835708 4:149050968-149050990 GAGCAGGACCTCAGGGAAGGAGG - Intergenic
983088061 4:163472023-163472045 GAGGATCACTACAGGGAAGGTGG - Exonic
983443728 4:167821601-167821623 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
983495715 4:168440275-168440297 CAAAATGCCCACATGGAAGGTGG + Intronic
983942043 4:173544364-173544386 CAAGGTAACCTCAGGGAAGGGGG - Intergenic
985680730 5:1254316-1254338 AAGGATGACCCCTGGGCAGGTGG + Intronic
986299681 5:6468123-6468145 CAGCATGAGAACAGGGACGGGGG - Intronic
987295529 5:16547143-16547165 CAAGACACCCACAGGGAAGGTGG + Intronic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
990977633 5:61573296-61573318 CAGGCTGGCCTCAGGGAAGGGGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
992771348 5:80051104-80051126 CAAGATGAGCACCGGGAAAGGGG + Intronic
993096947 5:83490365-83490387 CAGCTTGACCACAGTGAGGGAGG - Exonic
993455035 5:88118072-88118094 CAGGAGGAAGACAGAGAAGGGGG + Intergenic
993972198 5:94433118-94433140 CAGGATGTCAACCCGGAAGGTGG - Intronic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995301267 5:110586027-110586049 CAGCTTAATCACAGGGAAGGGGG + Intronic
997251945 5:132395912-132395934 CAGGAGGAGAACAGGGAAGGAGG + Intergenic
997881879 5:137599006-137599028 CAGTATGTCCACATGGCAGGAGG + Intergenic
998537549 5:142948547-142948569 CAGCATGGCCACAGGGATGCTGG - Intronic
999373124 5:151068284-151068306 CTGGATGACCACTGGGCAGACGG + Intronic
1000327502 5:160183559-160183581 AAGCAGCACCACAGGGAAGGGGG + Intergenic
1000903242 5:166933615-166933637 CAGGATGGACCCAGGGCAGGCGG - Intergenic
1002134356 5:177098735-177098757 CAGGATGGGGCCAGGGAAGGAGG - Intergenic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1003007074 6:2392173-2392195 GAGGATGCCCACAGAGAGGGAGG + Intergenic
1006394629 6:33779076-33779098 CAGGATGACCATATTGAAAGTGG - Intronic
1007687006 6:43672947-43672969 CAGGATGATGACTGTGAAGGAGG + Intronic
1008648347 6:53539232-53539254 CAGGATGAGGAGAGGTAAGGGGG - Intronic
1008899078 6:56590798-56590820 TAGGATGAGAGCAGGGAAGGAGG - Intronic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1012701001 6:102457745-102457767 CAGGTTAAACACAGAGAAGGAGG - Intergenic
1013808287 6:114017169-114017191 AAGGCTGCCCACAGTGAAGGAGG + Intergenic
1014177837 6:118349505-118349527 CCAGATGACCTCAGGGAGGGCGG + Intergenic
1015591515 6:134827240-134827262 CAGGCTGACCGCAGGGAGGTGGG + Intergenic
1015591729 6:134829110-134829132 CATGATGGCTACAGTGAAGGTGG + Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1019655279 7:2190769-2190791 CAGGATGGCTAAAGTGAAGGTGG + Intronic
1020618061 7:10484622-10484644 AAGGATGACCACAGGTAGGAGGG - Intergenic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1021905577 7:25329925-25329947 CATGGTGACCTCAGAGAAGGTGG + Intergenic
1021968230 7:25943153-25943175 CAGGAAGCCCAGAGGTAAGGAGG - Intergenic
1022190263 7:28010545-28010567 GAGGATGACCACAGAAAAGCAGG - Intronic
1022479561 7:30734034-30734056 AAGCATGACCACAAGGAAGGAGG - Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1024146473 7:46522437-46522459 CAGAAAGACCCCAGGGAGGGCGG + Intergenic
1024381253 7:48698805-48698827 CAGGAATACCCCAGGCAAGGGGG + Intergenic
1024614557 7:51100032-51100054 CAGGATTACCACAGTGGAGGTGG - Intronic
1025283603 7:57646026-57646048 GAGGCTGACCACAAGAAAGGAGG + Intergenic
1025617148 7:63130624-63130646 CAGGCTAAACACAGGGAATGAGG + Intergenic
1025921717 7:65919624-65919646 CAAGATGACCGCAGTGGAGGTGG - Intronic
1026137764 7:67678474-67678496 CAGGCTGACACCAGGGAAAGAGG - Intergenic
1026464508 7:70642613-70642635 CAGTATGGACACAGGGAAGTAGG - Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1028456488 7:91043654-91043676 CTGGATGACGAAGGGGAAGGAGG - Intronic
1031076831 7:117221118-117221140 CATCATGAGCACAGAGAAGGAGG + Intronic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1031991752 7:128203144-128203166 CAGGAGGGACACGGGGAAGGTGG + Intergenic
1032566534 7:132952833-132952855 AATTATGACAACAGGGAAGGTGG + Intronic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1034978152 7:155459642-155459664 GAGGATGCACACAGGGAAGGAGG + Intronic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1035073758 7:156163630-156163652 TAGGAAGCCCACAGAGAAGGAGG + Intergenic
1035242175 7:157539458-157539480 CAAGATGATCACATGGAAGGCGG - Exonic
1035255635 7:157624701-157624723 CAGGATGACCACAGTATAGACGG - Intronic
1035260666 7:157659451-157659473 GAGGATGGTCACAGGGATGGGGG + Intronic
1038012577 8:23486737-23486759 CAGGATTAACACCTGGAAGGGGG + Intergenic
1038423017 8:27445680-27445702 CATGAGCACCACAGGGAATGGGG - Intronic
1038463693 8:27740290-27740312 GAGAAAGTCCACAGGGAAGGAGG + Intronic
1038589905 8:28827386-28827408 CAGAAGGACCACTTGGAAGGTGG + Intronic
1039526601 8:38222054-38222076 CATGATGACCAAATGTAAGGTGG - Intergenic
1039613495 8:38937207-38937229 GAGAATGACCTCAGGGAAGGAGG + Intronic
1039884286 8:41646467-41646489 CAGGCTGAGCACCGAGAAGGCGG + Exonic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042639942 8:70922681-70922703 CAGGATGCTCACAGGGACAGAGG + Intergenic
1043348323 8:79326442-79326464 AAGGATGACTACAGTGAATGAGG - Intergenic
1043571061 8:81602696-81602718 CAGGAGGACCACTAGGCAGGGGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1047768745 8:128013067-128013089 CAGGATGGCTTCAGGGAAGAAGG - Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1048019405 8:130524680-130524702 TACGGTAACCACAGGGAAGGAGG + Intergenic
1048270349 8:133023182-133023204 CTGGATGACCACATGGCATGAGG + Intronic
1048476424 8:134745980-134746002 CAGGAAGAGCACAGGCAAAGGGG - Intergenic
1048955655 8:139533876-139533898 CAGGCTGACCTCAGGACAGGGGG + Intergenic
1048971448 8:139647183-139647205 CAGGATGGCAACTGGGAAGAAGG + Intronic
1049131168 8:140843938-140843960 CAGGATGATTACAGGTAATGTGG - Intronic
1049166137 8:141127785-141127807 CAGGCTGACCCCAGAGAAAGAGG - Intronic
1049212325 8:141392400-141392422 CAGGATGAACTCAGGGTAGGAGG - Intronic
1049353512 8:142176721-142176743 CTGGAAGACCACAGGGACTGTGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049757379 8:144316739-144316761 CATGGTGACCACAGGGCTGGGGG + Intronic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053667279 9:40325108-40325130 CTGGAGGATCACAGGGCAGGTGG + Intronic
1054378424 9:64465136-64465158 CTGGAGGATCACAGGGCAGGTGG + Intergenic
1054517331 9:66051175-66051197 CTGGAGGATCACAGGGCAGGTGG - Intergenic
1056111247 9:83397246-83397268 GCGGAAGACAACAGGGAAGGCGG - Intronic
1056713142 9:89007809-89007831 CATGAGGACCACAGGGATTGGGG - Intergenic
1058764463 9:108167958-108167980 CAGGATTACCTCTGGGCAGGTGG - Intergenic
1059202439 9:112430631-112430653 CAGGATGACAGCAGTAAAGGTGG + Intronic
1060491084 9:124084816-124084838 CAGGAGGGTCACAGGGGAGGTGG + Intergenic
1060525093 9:124315918-124315940 CATGATGACAACAGGGACGCTGG + Intronic
1060801624 9:126548931-126548953 CAGGAAGGCCAGAGGAAAGGGGG - Intergenic
1061436408 9:130565540-130565562 CAGGTTGGCCACAGGAAAGAAGG + Intergenic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062138316 9:134941550-134941572 GAGGATGGCCCCAGGCAAGGTGG + Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062552718 9:137097444-137097466 CAGGATGGCCACACAGACGGGGG - Intronic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1185506193 X:633548-633570 CAGGGTGTCTACAGGGAACGGGG - Intronic
1185546869 X:953122-953144 GAGAATGACCCCAGGGCAGGAGG - Intergenic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186341795 X:8653458-8653480 CAGGATGACTCCAAGGATGGAGG - Intronic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1186977563 X:14924498-14924520 CAGGAGGAAGACAGAGAAGGGGG + Intergenic
1187299021 X:18030097-18030119 GAGGATGACCACTGGGAAAATGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188411721 X:29881050-29881072 GAGGAGGACCACAAGGGAGGGGG - Intronic
1189325107 X:40107046-40107068 CCGAATGACCAAAGGGAAAGAGG - Intronic
1189695766 X:43660276-43660298 AAGGGTGGCCACTGGGAAGGGGG - Intronic
1190025017 X:46914025-46914047 CAGACTGAACACAGGGAATGAGG - Intronic
1190723746 X:53172507-53172529 AAGGAAGACCCCAGAGAAGGTGG - Intergenic
1192440241 X:71169052-71169074 AAGGATGAGCGCCGGGAAGGAGG + Intronic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1196124167 X:112082033-112082055 GCGGATGAGCACAGGGAAAGGGG + Exonic
1198320471 X:135514594-135514616 GAGGAATAACACAGGGAAGGAGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199810314 X:151342613-151342635 CAGGAAAATCACAGGGAAAGTGG + Intergenic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic