ID: 1151340823

View in Genome Browser
Species Human (GRCh38)
Location 17:73469624-73469646
Sequence ACGTGTGTGGTCCCTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151340823_1151340838 30 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340838 17:73469677-73469699 ACCCTGGGTTTGTGTGTATGTGG 0: 1
1: 0
2: 3
3: 27
4: 328
1151340823_1151340829 -3 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340829 17:73469644-73469666 CGTGTCTGGCCTGGTGTGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 182
1151340823_1151340832 15 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340832 17:73469662-73469684 GAGGGAGTTCCCCCCACCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 177
1151340823_1151340827 -7 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340827 17:73469640-73469662 CACACGTGTCTGGCCTGGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 173
1151340823_1151340828 -4 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340828 17:73469643-73469665 ACGTGTCTGGCCTGGTGTGGAGG 0: 1
1: 0
2: 10
3: 117
4: 957
1151340823_1151340831 14 Left 1151340823 17:73469624-73469646 CCAGGGGAAGGGACCACACACGT 0: 1
1: 0
2: 0
3: 2
4: 97
Right 1151340831 17:73469661-73469683 GGAGGGAGTTCCCCCCACCCTGG 0: 1
1: 0
2: 1
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151340823 Original CRISPR ACGTGTGTGGTCCCTTCCCC TGG (reversed) Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
912557397 1:110525987-110526009 ATGTGTGTGGGCACTGCCCCTGG - Intergenic
915645067 1:157264707-157264729 GCTTCTGTGGTGCCTTCCCCTGG + Intergenic
916582492 1:166121392-166121414 ACCTGTGTGGACACTTTCCCTGG - Intronic
916688695 1:167170945-167170967 ACTTGTGTGGTCTTTTTCCCAGG + Intergenic
920194049 1:204214156-204214178 AGGTGGGCGGTGCCTTCCCCGGG - Intergenic
920940423 1:210477085-210477107 CCTTTTGTGGTCCCATCCCCTGG - Intronic
921666063 1:217872689-217872711 TTGTGTGTGTTCCCTTCTCCTGG - Intergenic
1067682864 10:48451284-48451306 GGGTGTGTGGTCCTTTCCTCTGG - Intronic
1070916706 10:80159735-80159757 CCCTGTGTGGTCCCTTTCTCAGG + Intronic
1073071040 10:100793385-100793407 ACTTGTGTGTTCCCTTCCTGAGG + Intronic
1074770244 10:116728959-116728981 ATGTGTGAGGGCCCTTGCCCCGG - Intronic
1077190202 11:1252787-1252809 ACGTGCATGTTCCCTGCCCCAGG + Exonic
1082968581 11:58994472-58994494 ACCTTAGTGGTCACTTCCCCTGG - Intronic
1083365355 11:62138783-62138805 AGGTGAGTCCTCCCTTCCCCAGG - Intronic
1103746331 12:123127007-123127029 AGCTTTGTGGTCCCTTGCCCTGG - Intronic
1104967832 12:132517244-132517266 TCCTGAGTGGCCCCTTCCCCTGG - Intronic
1106608978 13:31260027-31260049 AAGTCTGTGCTCCTTTCCCCTGG + Intronic
1112034329 13:95483581-95483603 ACAGGTGTGGTCCCTCCCACAGG - Intronic
1114426658 14:22629498-22629520 ATGTGTGTGCTCACTTCCCAAGG + Intergenic
1121624522 14:95374516-95374538 ACATATTTGGTCCCTGCCCCAGG - Intergenic
1122467288 14:101942740-101942762 CTGTGTGTGCCCCCTTCCCCAGG + Intergenic
1129157618 15:73728571-73728593 ATGTGTGAAGCCCCTTCCCCAGG - Intergenic
1131459849 15:92610335-92610357 ACCTGTGTTCTCCCCTCCCCTGG - Intergenic
1132939451 16:2499650-2499672 AGGTGTGTGCACCCTGCCCCTGG - Intronic
1142481320 17:219887-219909 ATGTGTGTCCTCCCATCCCCAGG - Intronic
1142690958 17:1605867-1605889 AAGGGTGTGCTCCCCTCCCCCGG + Intronic
1144707822 17:17380992-17381014 GCCTGTGGGGTCCCTTCCTCAGG + Intergenic
1146929711 17:36768522-36768544 ACGTCTGGGGTCCCCGCCCCAGG + Intergenic
1147550900 17:41440735-41440757 CCGTGTGGGGTCCACTCCCCTGG - Exonic
1148778967 17:50111076-50111098 ACGTGTGGGTCCCCTCCCCCAGG - Exonic
1151340823 17:73469624-73469646 ACGTGTGTGGTCCCTTCCCCTGG - Intronic
1152037386 17:77881542-77881564 ACGTGGGTTTTCCCTTCTCCTGG + Intergenic
1152231980 17:79118291-79118313 ACGTGTGTGCTTCCCTCCCGTGG - Intronic
1152419932 17:80187137-80187159 ACGTGTGTGCTCCTTCCCCAGGG + Intronic
1153952177 18:10067094-10067116 GCCTGTGTGCTCCCTTCCTCAGG - Intergenic
1160780879 19:877596-877618 GCACCTGTGGTCCCTTCCCCCGG + Intronic
1161476795 19:4490538-4490560 ATGTGTGTGTTCCATTCTCCTGG + Intronic
1162033899 19:7929112-7929134 ACCTGTGTGTTTCTTTCCCCTGG - Intronic
1162189805 19:8936051-8936073 ACCTGTGAGGTCACTACCCCTGG + Exonic
1167912568 19:52716117-52716139 TCGTGTGTGGTGGCTTCTCCAGG - Intronic
1167927543 19:52833832-52833854 TCGTGTGTGGTGGCTTCTCCAGG - Intronic
927557981 2:24049609-24049631 CCGGGCGGGGTCCCTTCCCCCGG + Intronic
934663705 2:96156333-96156355 ACATGTGAGGTCCCATGCCCCGG - Intergenic
935179690 2:100678262-100678284 AAATGTGAGCTCCCTTCCCCCGG + Intergenic
935831507 2:107005561-107005583 ACCTGTGTGGCCACTTCCACTGG + Intergenic
938388346 2:130883645-130883667 ACATGCGTGGGCCCTGCCCCTGG - Intronic
941688383 2:168471023-168471045 ACTTGTGATGTCCCTGCCCCAGG + Intronic
945132458 2:206588069-206588091 ACATGTGTGCTCCTGTCCCCAGG + Exonic
1169944513 20:10974635-10974657 ACTTGTTTGGTCCCTGGCCCTGG - Intergenic
1170556482 20:17518983-17519005 GAGGGTGTGGTCCCATCCCCGGG - Intronic
1175637720 20:60599659-60599681 ACCTCTGTGGCCCCTTCTCCAGG + Intergenic
1175946026 20:62559179-62559201 CCTTCTGTCGTCCCTTCCCCAGG + Intronic
1181276091 22:21688319-21688341 GAGTGTGTGGTCTCTTCCCTGGG + Intronic
949778873 3:7663365-7663387 ACGTTTATGCCCCCTTCCCCTGG - Intronic
964321259 3:155499838-155499860 ATGTGTGTGGTCCCTACTCTAGG - Intronic
966573060 3:181468456-181468478 ACATATTTGGTCTCTTCCCCTGG - Intergenic
969226076 4:5799155-5799177 ACGTGTGCTTTCCCTGCCCCTGG + Intronic
969344513 4:6562823-6562845 GAGTGTGTGGTCCCTGTCCCTGG + Intronic
971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG + Intronic
979610769 4:122686755-122686777 ACGTATTTGGTCTCTGCCCCTGG + Intergenic
981419835 4:144536890-144536912 ATGTCTGGGATCCCTTCCCCAGG + Intergenic
981716540 4:147757829-147757851 ACCTGTCTGTTCCCTTCCCTGGG + Intronic
982140057 4:152308783-152308805 ACATGTGAGGTCCCTTGCCATGG + Intergenic
986826165 5:11525281-11525303 CTTTGTGTAGTCCCTTCCCCAGG + Intronic
990139833 5:52690346-52690368 ATGGGTGTGCTCCCTTCCCTGGG - Intergenic
997564760 5:134878321-134878343 ATGTGTATGGTCCCTGCCACAGG - Intronic
1000880448 5:166691211-166691233 AATTGTGGGGTCCCATCCCCAGG - Intergenic
1001440850 5:171741648-171741670 ACTGGTGAGGTCCCTTGCCCAGG + Intergenic
1001947117 5:175788471-175788493 AGGTGCTTGGTCCCCTCCCCTGG - Intergenic
1004590850 6:17050375-17050397 ACATGTTTGGTCTCTGCCCCTGG + Intergenic
1005266003 6:24112798-24112820 ACGTGGGTAGTCCCTTCCAGTGG + Intergenic
1008920766 6:56843034-56843056 AGGTATGTGGTCCCTGCCCTGGG - Intronic
1010106931 6:72181098-72181120 TAGTGTGTGGTCTCTTCCCTAGG - Intronic
1013760270 6:113510257-113510279 GGGTGTGTGGCACCTTCCCCCGG + Intergenic
1015376777 6:132518748-132518770 ACGTGTGGTGGCCCCTCCCCCGG - Intergenic
1017832109 6:158140124-158140146 ACGTATTTGGTCTCTACCCCTGG + Intronic
1018766661 6:166938874-166938896 AGGTGGGTGCGCCCTTCCCCCGG - Exonic
1023602769 7:41896458-41896480 ACTAGTGTGGTCCATGCCCCCGG - Intergenic
1026152076 7:67796393-67796415 ACGTGTGTGATACACTCCCCAGG - Intergenic
1027793260 7:82659008-82659030 AGGTGTGTATTCTCTTCCCCAGG + Intergenic
1029279967 7:99429204-99429226 ACGTCTTTGTTCCCTCCCCCAGG - Exonic
1034373909 7:150626988-150627010 AAGTAGGTGGTCCCTTGCCCTGG - Exonic
1035127392 7:156618477-156618499 AGCTGTGCGGTCCCTCCCCCTGG + Intergenic
1035337972 7:158142260-158142282 CCGTGTCTGGTCCTTGCCCCAGG - Intronic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1036544975 8:9759165-9759187 TCCTGTGTGCTCCCCTCCCCTGG - Intronic
1037123851 8:15321080-15321102 AAGTGGGTGATCCTTTCCCCAGG - Intergenic
1039408617 8:37333605-37333627 ACATTTGTGGGCACTTCCCCTGG - Intergenic
1041370063 8:57149866-57149888 ACCTGTGTGTTCCCTCCCACGGG - Intergenic
1056399521 9:86213041-86213063 GCTTGTGTGGGCCCTTTCCCTGG + Intergenic
1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG + Intergenic
1057612206 9:96555148-96555170 CCTTGTGTGGTCCCCTCCCACGG + Intronic
1061485937 9:130920580-130920602 GAGGGTGTGGTCCCTGCCCCTGG + Intronic
1188229318 X:27641810-27641832 ACGTGTGTTTGCCCTTCCTCTGG + Intronic
1192149521 X:68703534-68703556 TCGTGTCTGCTCCCTTCCCGGGG + Intronic
1193887355 X:86998817-86998839 AAGTGTGTGGTACCTCCCCATGG - Intergenic
1198785521 X:140283660-140283682 AGGTGTGAGGTCCCTTTTCCAGG - Intergenic
1199217492 X:145277184-145277206 CCGTGTGTGCTCACTTCCCAAGG + Intergenic
1200958355 Y:8973054-8973076 AGGTGTGTGGTCCCCTCTTCTGG + Intergenic