ID: 1151342002

View in Genome Browser
Species Human (GRCh38)
Location 17:73477552-73477574
Sequence CTGGATGCCCACATCAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151342002_1151342008 24 Left 1151342002 17:73477552-73477574 CCATCTTTGATGTGGGCATCCAG 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1151342008 17:73477599-73477621 CACAAATGCTTGCCAAGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 179
1151342002_1151342009 25 Left 1151342002 17:73477552-73477574 CCATCTTTGATGTGGGCATCCAG 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1151342009 17:73477600-73477622 ACAAATGCTTGCCAAGTGAAGGG 0: 1
1: 0
2: 1
3: 38
4: 296
1151342002_1151342010 26 Left 1151342002 17:73477552-73477574 CCATCTTTGATGTGGGCATCCAG 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1151342010 17:73477601-73477623 CAAATGCTTGCCAAGTGAAGGGG 0: 1
1: 0
2: 1
3: 32
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151342002 Original CRISPR CTGGATGCCCACATCAAAGA TGG (reversed) Intronic
901088261 1:6625184-6625206 CTGGCTGCCCCCAACAAAGATGG - Exonic
904296237 1:29521436-29521458 CTGGATGCCACCATCCAGGATGG + Intergenic
904410094 1:30320010-30320032 CTGGATGCCACCATCCAGGATGG - Intergenic
905231050 1:36515200-36515222 GTGGCTGCCCACATCACACATGG - Intergenic
907760351 1:57352059-57352081 CTGCATTTCCAAATCAAAGAAGG + Intronic
908641040 1:66223822-66223844 GTGGCTGACTACATCAAAGAAGG - Intronic
908661189 1:66437005-66437027 CTGAATGCACACAGCCAAGAAGG + Intergenic
910705259 1:90122797-90122819 CAGCATGCCCTCATCAAAGGTGG - Intergenic
911943138 1:104072975-104072997 CTGGCTGCCCGTAACAAAGATGG - Intergenic
912488667 1:110049038-110049060 CTAGGTGCCCACAGAAAAGATGG - Intronic
913930669 1:124960413-124960435 TTGAATGCACACATCAAAAACGG + Intergenic
917994372 1:180419982-180420004 TTGGGTGCCCATATCATAGAAGG + Intronic
918323394 1:183385969-183385991 CTGGATGCTGACAGCATAGAAGG + Intronic
919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG + Intronic
924272685 1:242350086-242350108 CTGTATTCCCACATGATAGAAGG - Intronic
924867214 1:247996705-247996727 CTGTCTTCCCACATCAAATAAGG + Intronic
1065521612 10:26579414-26579436 CTGGACTCCCACATCACAAATGG + Intergenic
1066712025 10:38246541-38246563 CTGTATCCCCACATGATAGAAGG + Intergenic
1068534457 10:58225981-58226003 CTGTAAGCCCACAAAAAAGAAGG + Intronic
1068548055 10:58373744-58373766 ATGGCTGCCCACTTCCAAGAGGG + Intergenic
1071520476 10:86329032-86329054 CTGGGTGACCATATCCAAGAAGG + Intronic
1074849698 10:117429796-117429818 CAGGATGACCTCATCAGAGAAGG - Intergenic
1075353397 10:121746681-121746703 CTGGATGTCCACTTCATACAAGG + Intronic
1076598722 10:131643258-131643280 CTGCAAGGCCACATGAAAGAGGG + Intergenic
1082145997 11:48669774-48669796 GTGAATGCCCACATCACAAAGGG - Intergenic
1084768578 11:71327912-71327934 CTGGAAGCCAACACCACAGAGGG - Intergenic
1087042162 11:93812361-93812383 TTTGATGTCAACATCAAAGAAGG - Exonic
1087566684 11:99868602-99868624 CTGGATGCACTCTTCAAAGTTGG - Intronic
1090270922 11:125385631-125385653 CTCGATGTCCACATCAAAGCTGG - Exonic
1091036553 11:132238977-132238999 CTGTTTGCCCACCTCAAAAATGG - Intronic
1091348679 11:134874891-134874913 CTGGATGCTCACAGAAAAGATGG - Intergenic
1094863429 12:34498419-34498441 GTGAATGCCCACATCACAAAGGG + Intergenic
1094868345 12:34567652-34567674 GTGGATGCACACATCACAGAGGG + Intergenic
1095071782 12:37860766-37860788 ATGAATGCACACATCACAGAGGG + Intergenic
1097066196 12:56322640-56322662 CTGGTGGCTCACATCAAAGTTGG - Exonic
1097526909 12:60748496-60748518 CTAAATGCCCACATCAGAAATGG + Intergenic
1100040663 12:90313340-90313362 CTGAATGCACACATTAAAGAAGG + Intergenic
1100779691 12:98010688-98010710 CTGAATCCTCACATCAAGGAAGG - Intergenic
1105088098 13:16235474-16235496 TTGAATGCCCACATCAAAAAAGG - Intergenic
1106916199 13:34517326-34517348 CTAGTTGCCAAGATCAAAGATGG - Intergenic
1107356841 13:39576345-39576367 GTGGAGGCTGACATCAAAGATGG + Intronic
1108000325 13:45900333-45900355 CTGGCTTCCCACCTCACAGATGG + Intergenic
1108521688 13:51252002-51252024 CTGGATGTCCACATCCAGGTTGG - Exonic
1108862698 13:54881895-54881917 TTAGATGCCTTCATCAAAGATGG - Intergenic
1111402598 13:87760856-87760878 CTGAATGCCTGCATCAAAGATGG + Intergenic
1114388239 14:22278199-22278221 TTGGATGCCCACACTGAAGATGG + Intergenic
1116374471 14:44181347-44181369 ATGTATTCCCACATCAGAGAAGG - Intergenic
1117070779 14:52053905-52053927 TTGGATCCTCACACCAAAGAAGG - Exonic
1117793875 14:59370991-59371013 CAGGATGGCCATATCAAAGGAGG - Exonic
1118117788 14:62800626-62800648 CTGAATGTCCACATCAAACGTGG - Intronic
1119879795 14:78091253-78091275 CCAGATGGCCAGATCAAAGAGGG - Intergenic
1120206412 14:81591573-81591595 CTGGGTGTTCACATTAAAGAGGG + Intergenic
1120279809 14:82424787-82424809 CAGGATGCCCACAGGTAAGAAGG + Intergenic
1122466604 14:101938116-101938138 GTGGACGCCCACAGCATAGAGGG + Intergenic
1126322135 15:47436618-47436640 CTTGGTGCCAACATTAAAGATGG + Intronic
1127394650 15:58534710-58534732 CTTTTTGGCCACATCAAAGAGGG - Intronic
1127997160 15:64159933-64159955 CTGGGTTCCCTCTTCAAAGAAGG + Intronic
1131131580 15:89903843-89903865 CTGGATGCCCGAGTCAGAGATGG - Exonic
1132706305 16:1244890-1244912 CAGTTTCCCCACATCAAAGAGGG + Intergenic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1134291361 16:12904440-12904462 CAGAACGCCCAGATCAAAGAGGG - Intronic
1134589888 16:15443967-15443989 CTGCAGGCCAACAGCAAAGAGGG + Intronic
1134792441 16:17001488-17001510 CTGGCTTCTCACTTCAAAGAAGG + Intergenic
1136740915 16:32525100-32525122 ATGAAAGCCCACATCAAAAAGGG + Intergenic
1139273918 16:65709282-65709304 CTGTGTGACCACATCACAGAAGG + Intergenic
1140208228 16:72950623-72950645 CTGGTGGCCCACATCAAGGAGGG - Exonic
1142397886 16:89843089-89843111 CTGCATGCCCAGTTCAAGGAAGG + Intronic
1203028687 16_KI270728v1_random:550134-550156 ATGAAAGCCCACATCAAAAAGGG - Intergenic
1203043034 16_KI270728v1_random:784297-784319 ATGAAAGCCCACATCAAAAAGGG + Intergenic
1143271173 17:5675943-5675965 CTGGATGGCCAAACCAAACAGGG + Intergenic
1144647498 17:16985341-16985363 CTGGATCCTCACATGACAGAAGG - Intergenic
1145235486 17:21205151-21205173 CAGGCTGCCCACATCCCAGAGGG - Intronic
1145248083 17:21283028-21283050 CTGGATGCCCATTTTACAGACGG + Intergenic
1146666100 17:34704829-34704851 CTGTGTGCCCACATAACAGAAGG - Intergenic
1147047527 17:37765393-37765415 CTGGATGAGCCCATCAAAGAGGG + Intergenic
1147877543 17:43632317-43632339 CCGGATCCCCCCAACAAAGAGGG + Intergenic
1149252991 17:54791616-54791638 CTGAATGCTCATATCACAGAAGG - Intergenic
1150329332 17:64282521-64282543 CTGGAAGCCCACCTGAGAGAGGG + Intergenic
1150364034 17:64565196-64565218 CTAGCTGCCCACATCCCAGAAGG - Intronic
1150525840 17:65921247-65921269 CTGGCTGCCCTGTTCAAAGAAGG + Intronic
1151342002 17:73477552-73477574 CTGGATGCCCACATCAAAGATGG - Intronic
1157160877 18:45313238-45313260 CTAGATGCCCACTTCTAGGATGG + Intronic
1157272894 18:46290214-46290236 CTGAATGACCCCAGCAAAGAGGG - Intergenic
1157311727 18:46557782-46557804 CTGGATGCCCACATCTGTGGTGG + Intronic
1157997226 18:52572670-52572692 CTGGATCCCCACGTCAAGAATGG - Intronic
1159013283 18:63079944-63079966 CTGGATGCCAAAACCAAACAAGG - Intergenic
1159848910 18:73502237-73502259 CTTGATGCCTACATGAAATATGG - Intergenic
1160917844 19:1506249-1506271 CTGGATGCGCACCTCATAGCGGG + Exonic
1163543480 19:17926235-17926257 CAGAATGACCACATCAAACAGGG - Intergenic
1164400644 19:27899973-27899995 CTGGATGGCCACGTGAATGAAGG - Intergenic
1164911614 19:32016988-32017010 CTGGATGCCCACTTTATGGAGGG + Intergenic
1165818854 19:38661574-38661596 CTGGCTTCCAACTTCAAAGAAGG - Intronic
1165932327 19:39367861-39367883 CAGGCTGGCCACATCAAAGAAGG - Intronic
1167495775 19:49818033-49818055 CTGGACGCCCCGCTCAAAGATGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926061666 2:9808532-9808554 CTGGTTGTCCACATCCAGGAAGG - Intergenic
927683663 2:25156255-25156277 CTGTGTGCCCACAGCAGAGATGG - Exonic
929801921 2:45111782-45111804 ATGGATGCCAACAGGAAAGAGGG + Intergenic
931921302 2:67018828-67018850 AAGGATGGCAACATCAAAGATGG + Intergenic
938688062 2:133760564-133760586 CTGGCTGACCTCACCAAAGAGGG - Intergenic
945021202 2:205573289-205573311 CTTGATGCCCACATCTAATCAGG - Intronic
945054083 2:205852749-205852771 CTGGAAGCCAACAGCAAAGAGGG + Intergenic
1169210515 20:3763972-3763994 CTGGAAGCTCACCTCCAAGAGGG - Intronic
1169471082 20:5886120-5886142 CTTCATGACCACATCACAGAGGG + Intergenic
1170654568 20:18274053-18274075 CTAGATGACCACAACAAACAAGG - Intergenic
1170999745 20:21400852-21400874 CTGGACCCCCACTTCAAAGTGGG - Intergenic
1172319446 20:33984794-33984816 GTTTATGCCGACATCAAAGAAGG - Intergenic
1179360965 21:40708453-40708475 CAGGATGTCCACATCAAGGCTGG - Exonic
1180390689 22:12279735-12279757 CTGGACTCCCACATCACAAATGG + Intergenic
1180409054 22:12585022-12585044 CTGGACTCCCACATCACAAATGG - Intergenic
1180744776 22:18079894-18079916 CTGGATCCCCACAACACACAGGG - Exonic
1182556303 22:31130806-31130828 CTGGTTGCCGACATCAAAATGGG + Intronic
949927973 3:9057223-9057245 CTGGAGTCCCACATGAAAGGTGG - Intronic
950089676 3:10286783-10286805 CTTGATTCCAACATCAAAGGGGG + Exonic
954144646 3:48628542-48628564 CTGGAGGCAAACATCAGAGAAGG + Intronic
954799621 3:53179636-53179658 TTCGATGCCCACATCTATGAGGG + Exonic
955426824 3:58800066-58800088 CTGGAAGCCCACCTCTCAGATGG - Intronic
956365397 3:68496551-68496573 CTGGATGGACACATCTAAGATGG - Intronic
959081044 3:101801485-101801507 CTGGCTTCCCACCTTAAAGAAGG - Exonic
959402346 3:105918465-105918487 GTAAATGCCTACATCAAAGAAGG - Intergenic
961057585 3:123802286-123802308 CTGGGTTCCCACATGAAAGCAGG + Intronic
963303071 3:143620521-143620543 CTGGATGCCCACACCCACGTGGG - Intronic
964425813 3:156552662-156552684 CTAGATGACCCCATCAAGGAAGG + Intronic
965988867 3:174791188-174791210 CTGTTTGCCCACATATAAGAGGG - Intronic
970485869 4:16524316-16524338 CTGGATGCACATAATAAAGAAGG + Intronic
970720448 4:18982390-18982412 CTGGATATCCCCATCAAATATGG + Intergenic
971972910 4:33643371-33643393 CTGGAAGTACACAGCAAAGAAGG - Intergenic
981112551 4:140952406-140952428 CTACATGCCCACATTTAAGAAGG - Intronic
983304431 4:165967549-165967571 CTGACTGCCCACAACAAAGATGG + Intronic
983527235 4:168771643-168771665 CTGGGTGCCCACACCATAGAGGG + Intronic
986120282 5:4829095-4829117 CTGTATACTCACATCAATGAGGG + Intergenic
989235547 5:39144225-39144247 ATGGCTGCTCACATCAAAAAAGG + Intronic
989930550 5:49944655-49944677 TTGAATGCCCACATCACAAAGGG - Intergenic
991190624 5:63868771-63868793 CTGGATCCTCACATAACAGAAGG - Intergenic
996118606 5:119646470-119646492 CTGGAAGCCCACATCTAAGGGGG + Intergenic
997153777 5:131528965-131528987 CTGGAGGAGCACCTCAAAGAAGG + Intronic
997230748 5:132240583-132240605 TTGGTTCCCCAAATCAAAGAGGG - Intronic
998316811 5:141189774-141189796 GTGTATGCCCACCACAAAGAAGG + Exonic
1000522312 5:162310776-162310798 CTTGAAGCCCAAACCAAAGAAGG + Intergenic
1001092140 5:168749488-168749510 CTGGATGGCCACATCCTGGATGG + Exonic
1001564106 5:172688491-172688513 CTGGGTGCCCAGAGCAAAGCTGG + Exonic
1002542192 5:179913686-179913708 CAGGATACCCACAAAAAAGAGGG + Intronic
1003461025 6:6328329-6328351 CTGGAAGCCCACATCCAGGTAGG + Intergenic
1005438800 6:25842776-25842798 CAGAATGCCAACATCTAAGAAGG - Intronic
1006871706 6:37257762-37257784 AGGGGTGCCCACATCCAAGATGG + Exonic
1007502004 6:42305521-42305543 CTAAAAGCCCAAATCAAAGAGGG + Intronic
1008556053 6:52673586-52673608 AAGGATGCCCAGATCAAACAGGG - Intronic
1009057264 6:58351650-58351672 CTAGATGCCAACATCAAGGCAGG - Intergenic
1009233964 6:61099916-61099938 CTAGATGCCAACATCAAGGCAGG + Intergenic
1013463984 6:110400825-110400847 CTGGGTGCCCAGCTGAAAGAAGG - Intronic
1014909415 6:127072366-127072388 CTTAATGCACACATGAAAGAAGG + Intergenic
1017232420 6:152087534-152087556 CTGAGTGACCACATAAAAGAGGG - Intronic
1017769246 6:157632171-157632193 CTGGCTTCCCACAGCACAGAGGG + Intronic
1019001716 6:168758931-168758953 CAGGGTGCCCACATTAAATAGGG - Intergenic
1020709609 7:11590533-11590555 CTGGATGCCCCCTCCACAGAGGG + Exonic
1022463061 7:30630250-30630272 ATGGCTGCTCACATCACAGAAGG - Intronic
1025530720 7:61879153-61879175 ATGAATGCCCACATCAAAAAGGG + Intergenic
1025584208 7:62761528-62761550 ATGAATGCACACATCACAGAGGG + Intergenic
1025590182 7:62849286-62849308 ATGAATGCCCACATCACAAAAGG - Intergenic
1025593016 7:62887245-62887267 CTGAATGCACACATCACAAAGGG - Intergenic
1027175544 7:75900776-75900798 CTGGAAGCCCAAGGCAAAGATGG + Intronic
1027236245 7:76299683-76299705 TTTGATGCCCACATCACAGAGGG - Intergenic
1028671680 7:93407764-93407786 CAGGATGCCCACATTAAAAGGGG - Intergenic
1030186657 7:106769061-106769083 CTGGATTCCAACAAGAAAGAAGG + Intergenic
1030710170 7:112740122-112740144 CTGCATGCCCCCCTCAAAGTAGG - Intergenic
1032868280 7:135952017-135952039 ATGGCTGCCTACATCAAAGTGGG - Intronic
1034271621 7:149805939-149805961 CTGGATGCCTCCATCACAGGGGG - Intergenic
1034905743 7:154944311-154944333 CTGCATACCCACATCACAGGAGG + Exonic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1040282201 8:46064199-46064221 CTGAATGCACACATCAAAAAGGG - Intergenic
1041896957 8:62936285-62936307 GTGGATGCCAACAGGAAAGATGG - Intronic
1043150438 8:76707872-76707894 CTGGTGGCTCACATTAAAGAAGG + Exonic
1046289564 8:112139097-112139119 TTGGATGCCTAGATGAAAGATGG + Intergenic
1047890897 8:129307621-129307643 CTGGTTGCCTACATTAAAGTTGG - Intergenic
1048571448 8:135660350-135660372 CTTGATCTCCACTTCAAAGATGG + Intergenic
1049500918 8:142965149-142965171 CTGACTTCCCACAACAAAGAGGG + Intergenic
1052236648 9:26219026-26219048 ATGGATGGACACATGAAAGAGGG + Intergenic
1053221930 9:36319445-36319467 CTGGCTGCCCACACCCAGGATGG - Intergenic
1053275778 9:36782275-36782297 AGAGATGCCCAGATCAAAGAGGG - Intergenic
1054934687 9:70674109-70674131 CTGTCTGCCCACAGGAAAGAGGG + Intronic
1056036667 9:82613690-82613712 CTGGCTGCCCACATCTGACAAGG + Intergenic
1058355664 9:104081251-104081273 CTGGATCCCCAAAGAAAAGAGGG + Intergenic
1060859148 9:126939584-126939606 CTGTATGCCCACTTTACAGAAGG + Intronic
1061165370 9:128919271-128919293 CTGAAGCCCCACATCAAACACGG - Intergenic
1062275750 9:135729826-135729848 CTGGTTGCCCGTGTCAAAGATGG + Intronic
1062424367 9:136499210-136499232 CTGGATGCCCGCATGCATGATGG - Exonic
1203353343 Un_KI270442v1:103229-103251 TTGAATGCCCACATCAAAAAAGG - Intergenic
1203353540 Un_KI270442v1:106984-107006 TTGAATGCCCACATCAAAAAAGG - Intergenic
1187029141 X:15467625-15467647 TTTGATACCCACACCAAAGAAGG - Intronic
1188873368 X:35400585-35400607 CTGGGTGCCCACATCACTGATGG - Intergenic
1191095301 X:56667068-56667090 CTATATGCCCACATCAAAAAAGG + Intergenic
1191263406 X:58354931-58354953 CTGAATGCACACATCACAAACGG - Intergenic
1191594692 X:62930017-62930039 CTGGATGCCCAAATCTTAGCAGG - Intergenic
1192185222 X:68942029-68942051 CTGCTTCCCCACATCAAACAAGG - Intergenic
1192408697 X:70912980-70913002 CTGGAAACCCAAATCAAAAAGGG + Intergenic
1196908154 X:120459208-120459230 CTAAATGCTCACCTCAAAGATGG + Intronic
1201782136 Y:17735046-17735068 CTAAATGCCCACATCAAAAGTGG - Intergenic
1201819417 Y:18170942-18170964 CTAAATGCCCACATCAAAAGTGG + Intergenic