ID: 1151342931

View in Genome Browser
Species Human (GRCh38)
Location 17:73483190-73483212
Sequence CCCAGGCCTTGCCTTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151342927_1151342931 4 Left 1151342927 17:73483163-73483185 CCAGAAAGAAATTCCTCTGGGGA 0: 1
1: 0
2: 2
3: 16
4: 165
Right 1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG 0: 1
1: 0
2: 2
3: 25
4: 255
1151342929_1151342931 -9 Left 1151342929 17:73483176-73483198 CCTCTGGGGAGCTGCCCAGGCCT 0: 1
1: 0
2: 6
3: 61
4: 522
Right 1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG 0: 1
1: 0
2: 2
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151342931 Original CRISPR CCCAGGCCTTGCCTTGATGC AGG Intronic
900098824 1:952332-952354 CCCAGGCCCTGCCTTGGGTCGGG + Intronic
900196901 1:1381124-1381146 CCTGGGCCTGGCCTTGCTGCAGG + Intergenic
900558554 1:3292100-3292122 CACAGGCCTTGGCAGGATGCTGG + Intronic
901853683 1:12031140-12031162 CACAGGCCCTGCCTTGGTGGGGG + Intronic
902688071 1:18091813-18091835 CCCAGGCCCTCCCTTGCCGCAGG + Intergenic
902884755 1:19396559-19396581 CCCCGTGCTTGCCTTCATGCTGG - Intronic
903969422 1:27109229-27109251 CCCTGGGCTTGCCTTCATGCAGG + Intronic
904199520 1:28810953-28810975 CCCAGCCCTCTCCTGGATGCAGG + Intergenic
905515188 1:38557628-38557650 CCCTGACCCTGCCTTGCTGCAGG + Intergenic
906195027 1:43924812-43924834 CCTAGGGATTGCCTTGGTGCAGG + Intronic
906580348 1:46930566-46930588 CCCTGGCCTTGTCTTGATAGAGG - Intronic
907310567 1:53536764-53536786 CCCAGGCCTGGCCTTGCCCCAGG - Intronic
911948605 1:104142694-104142716 CCCAGGCTTTGCCCTCATGTTGG + Intergenic
916147132 1:161749992-161750014 CCCAGGCCCCGCCTTGAAGCTGG - Exonic
917791660 1:178503012-178503034 CCCAGGCCATGCCCCGATGCAGG - Intergenic
918191843 1:182183221-182183243 GCCTGGGCTTCCCTTGATGCTGG + Intergenic
919769237 1:201146728-201146750 CCCTGGCGTTACCTTGATGGTGG + Exonic
920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG + Intronic
920422675 1:205845791-205845813 CCCAAGCCTGGCCTTAATGGTGG - Intronic
920732717 1:208503093-208503115 CCCAGGCCTTGACATAATGAAGG + Intergenic
920962327 1:210674390-210674412 CCCAGGCCAGTCCTTGTTGCTGG + Exonic
921069045 1:211643633-211643655 CCTAGGCCTTGGCATTATGCGGG + Intergenic
924118664 1:240773899-240773921 CTCTGGCCTTCCCTTGAAGCAGG + Intergenic
1062763397 10:44629-44651 CAGAGGCCCTGCCTGGATGCTGG + Intergenic
1063374876 10:5548340-5548362 CCCAGGCCTCGTCTGGATCCGGG + Intergenic
1063655117 10:7980687-7980709 CAGAAGCCTTGCCTTGATGCTGG + Intronic
1064821442 10:19339155-19339177 CCAAGGCCATGCCTTCATGGTGG + Intronic
1065644499 10:27820150-27820172 TCCAGGCCCTGCCTTGTCGCTGG + Intronic
1067083696 10:43227370-43227392 TCCAGGCCTGGCCAGGATGCAGG - Intronic
1067879297 10:50029766-50029788 CTCAGGCTTGGCCATGATGCTGG - Intergenic
1069638123 10:69937892-69937914 CCCAGGCCCCACCTTGGTGCTGG + Intronic
1070320628 10:75352213-75352235 GCCAGGCTTTGTCTTTATGCAGG + Intergenic
1070825931 10:79390717-79390739 ACTGGGCCTTGCCTTGCTGCAGG - Intronic
1071988704 10:91077732-91077754 CCCAGGCCTTGCCTGAAATCAGG - Intergenic
1075085410 10:119411277-119411299 CACAGGCCTTTCGTGGATGCTGG + Intronic
1075822454 10:125326603-125326625 CCCAGGCTTGGCCTTGAAGAGGG + Intergenic
1076440601 10:130478967-130478989 CCCAGGCCTCGCCTTGAACGAGG - Intergenic
1077099577 11:816144-816166 CCCAGCCCTTGCCAGGATTCTGG + Intergenic
1077378041 11:2214802-2214824 GCCAGGCCGGACCTTGATGCTGG + Intergenic
1077465686 11:2732776-2732798 CCGAGGCCTCGCCTTGCAGCCGG + Intronic
1078600391 11:12725030-12725052 CCCAGGCCTGGGCTTGGTGGTGG + Intronic
1079353954 11:19714764-19714786 GCCAGGGCTTGTCTGGATGCAGG - Intronic
1083233211 11:61336234-61336256 CCCTGGCCCTGGCTGGATGCAGG + Intronic
1084429352 11:69102590-69102612 CCCAGGCTCTGCTCTGATGCTGG - Intergenic
1084639770 11:70418250-70418272 GCCTGGCCTTGCCTTCCTGCCGG + Intronic
1085032581 11:73281667-73281689 CCCAGGCCTGGCCTTGCCCCTGG - Intronic
1088746654 11:112809674-112809696 CCCAGGCCTGGCCATAAAGCTGG - Intergenic
1089086830 11:115826823-115826845 CCTAGGACTTCCCTTGTTGCTGG - Intergenic
1089455314 11:118622321-118622343 TTCAGGCATTGCCCTGATGCTGG - Intronic
1091981129 12:4864918-4864940 CCCAGGCCGTGTGTTTATGCAGG + Intergenic
1092370861 12:7915850-7915872 CCCAGGCCCAGCCTTTTTGCAGG + Intergenic
1096801032 12:54110604-54110626 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1102568957 12:113815691-113815713 ACCAGGCATGGCCATGATGCTGG - Intergenic
1103436071 12:120926240-120926262 CCCAGGCCTCGCCTTGTTGGGGG - Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1106873472 13:34046782-34046804 CCCCAGCCTTGCCTTGCTTCAGG + Intergenic
1113931136 13:113969572-113969594 CCCGTGCCTTGCCATGGTGCTGG + Intergenic
1115641785 14:35339876-35339898 CCCAGGCGATGCTGTGATGCAGG - Intergenic
1116143827 14:41037698-41037720 CCCTGGCCCTCCCTTGATCCAGG + Intergenic
1119200859 14:72751865-72751887 CCCAACCCCTGCCTTGTTGCAGG - Intronic
1120529762 14:85617994-85618016 CCCAGGCCTTGCTCTCTTGCAGG - Intronic
1121812342 14:96902200-96902222 CACAGGCATTGCCAGGATGCTGG - Intronic
1122023125 14:98855847-98855869 CCCAGGTCCTGCCTGGCTGCAGG - Intergenic
1122075030 14:99230486-99230508 GCCAGGCCCTGCCGAGATGCCGG + Intronic
1122214626 14:100194654-100194676 CCCAGCCCTTGGCCTGATGCTGG - Intergenic
1122398757 14:101454466-101454488 CCCAGGACCTGCCTTGGTGCAGG + Intergenic
1122436870 14:101706498-101706520 CCCAGCCCTTCCCTTTTTGCCGG - Intergenic
1122626129 14:103086147-103086169 GGCATGCCTTGCCTTGCTGCTGG + Intergenic
1122668712 14:103353629-103353651 CCCATCCCTTGCTTTGATGTGGG + Intergenic
1122849878 14:104522420-104522442 ACCACGCCTTGCCAGGATGCTGG + Intronic
1122855736 14:104559327-104559349 CCCAGGGCTGCCCTTGGTGCAGG + Intronic
1122972137 14:105156704-105156726 CCCAGGCCTTGGCCCGAGGCGGG - Intronic
1202903904 14_GL000194v1_random:57808-57830 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1123947722 15:25246921-25246943 CCCAGGCCGTGCCATGCTGCAGG - Intergenic
1124431455 15:29612285-29612307 TCCAGGCATTTCCTTGAAGCTGG + Intergenic
1125457971 15:39879943-39879965 CCCAGGCCTTGCCATTATTTAGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1125968317 15:43891848-43891870 CCAAAGCCTTGCGTTGATGGTGG - Intronic
1127298803 15:57632820-57632842 CCCAGGGTTTGCTTAGATGCTGG - Intronic
1128113421 15:65090552-65090574 GCCAGGCCTTGGCTTGCTCCTGG + Intergenic
1128157711 15:65402250-65402272 TCCAGGCCTTGCCTTCAAGTAGG - Intronic
1128587799 15:68866215-68866237 CCTAGTACTTGCCTTGAGGCTGG + Intronic
1129340408 15:74882213-74882235 CTCAGGCCTGGGCTTGCTGCAGG + Intergenic
1130653223 15:85774044-85774066 CCCAGGCCCTGCTATGAGGCTGG - Intronic
1132852279 16:2030195-2030217 CCCAGGCCTTCCCAGCATGCAGG - Intronic
1135811320 16:25589241-25589263 GCCAGGCCTTTCCTGGATCCAGG + Intergenic
1136074441 16:27807200-27807222 CCCAGGCCTGGCCTTGAGCTGGG + Intronic
1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG + Intronic
1137252529 16:46750374-46750396 CCCAGGACTTGCCTGGTTGCTGG - Intronic
1137686488 16:50390445-50390467 CCCAGGCCTTGCCCAGCTGGGGG + Intergenic
1139657527 16:68397930-68397952 CCCTGGCCTTGCCTGTCTGCAGG - Intronic
1139907472 16:70376544-70376566 CCCAGGCATAGACTTGCTGCAGG + Exonic
1140795695 16:78435409-78435431 CCCAAGCCTTGCCTTGCTATAGG - Intronic
1141703065 16:85651245-85651267 GCCGGGCCTTGCCTGGATGGGGG + Intronic
1143394063 17:6577873-6577895 CCCAGGCTTTGCCTTGTTTCAGG - Intergenic
1143755687 17:9065639-9065661 CCCAGGCCTGGTCTGGAGGCTGG - Intronic
1143775483 17:9196130-9196152 CCCAGGCCCTGCCCAGCTGCTGG - Intronic
1145973313 17:28969745-28969767 CCCAGGCCTTACCTTGGTAATGG + Exonic
1146016992 17:29241588-29241610 CCCTGGCCTTGCCTCTAGGCCGG - Intergenic
1147382537 17:40063853-40063875 CCCAGGCCTTTCTTTCACGCTGG - Intronic
1147535236 17:41316441-41316463 CCCAGGCCTTTCCTTGACCGGGG + Intergenic
1148739758 17:49886166-49886188 CCCAGGGCTTGCTGTGATGCTGG - Intergenic
1149516765 17:57286953-57286975 CCTAGGCCTTGCTTTGTTTCTGG - Intronic
1149629480 17:58110481-58110503 CCCAGGCCTTCCCTGCAGGCAGG - Intergenic
1150618332 17:66789421-66789443 CCCAGGCCCTGCCTAGTTGCTGG - Intronic
1150737304 17:67751613-67751635 CTCAGGCCTGGGCTTGCTGCAGG - Intergenic
1151241008 17:72757832-72757854 CCCAGGCCTGGTCTAGATCCAGG - Intronic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151402374 17:73864262-73864284 CCGAGGCCTTGGCCTGCTGCTGG - Intergenic
1152415070 17:80154446-80154468 TCCAGGCCTTGCCTGGATCTAGG - Intergenic
1152956306 18:44960-44982 CAGAGGCCCTGCCTGGATGCTGG + Intergenic
1153223941 18:2883658-2883680 CCCAGGCCCGGCCTTGAGTCTGG + Intronic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1154201008 18:12300848-12300870 CCCAGGCCTGGCCCAGATGTCGG - Intergenic
1157025106 18:43833166-43833188 CCCAGGACTTCCTTTGATGTGGG + Intergenic
1160929891 19:1565702-1565724 CCCAGGGCCTGCCTTGCTGACGG + Intronic
1161070529 19:2257731-2257753 CCCAGCCCTTGCTTTGCTGAAGG - Intronic
1161153182 19:2720276-2720298 TCCAGCCTTTGCCTTGCTGCGGG + Intronic
1162242207 19:9364266-9364288 CCGAGGCCTTGACTTACTGCTGG - Intronic
1162301897 19:9849210-9849232 CCCAGGCCTGGCCTCGGGGCAGG + Exonic
1162464393 19:10831442-10831464 CCCAGGCCTTGCTGGGGTGCAGG + Exonic
1163801483 19:19368359-19368381 CCCAGGCCCTGGCTTGACTCAGG + Intergenic
1164421769 19:28099804-28099826 TCCAGGGCTTTCCTTGCTGCTGG - Intergenic
1165532699 19:36417697-36417719 CCCTGGCCTTTCTTTGATACTGG - Intronic
1165825591 19:38703982-38704004 CCCAGGCCCTGCCATCCTGCTGG - Intronic
1166040109 19:40197217-40197239 CCCAGGCCTTGCATGTCTGCTGG - Intronic
1167299067 19:48668883-48668905 CCCAGGGCCTGGCTGGATGCAGG - Intronic
1168326456 19:55541073-55541095 CCCAGCCCTGGCCTTGCTCCAGG - Exonic
1168629664 19:57947184-57947206 CCCATGCCTGGCCTTGGAGCCGG + Intronic
925058960 2:876402-876424 GCCAGACCTGGCCTGGATGCAGG - Intergenic
925829833 2:7883120-7883142 CTCAGGCCTTACCATGAAGCAGG + Intergenic
925992252 2:9263106-9263128 CCCAGGCCGTGGCTGCATGCTGG + Intronic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
928177856 2:29047110-29047132 GCCTGGCCTTGCCTCTATGCAGG + Intronic
928630515 2:33186992-33187014 CCAACGCCTTGCCTGGCTGCTGG - Exonic
932346587 2:70999684-70999706 CCCAGGCCTTGCCTGAAGGAGGG + Intergenic
933037169 2:77414435-77414457 CCCAGACCTTGTCTTGATAATGG + Intronic
934538457 2:95156217-95156239 CCCATGCCTATCCTGGATGCTGG + Intronic
934553568 2:95276283-95276305 CTCAGGCATGGCCTCGATGCTGG - Exonic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
937445697 2:121956050-121956072 CACAGGCCATCCCCTGATGCTGG - Intergenic
937972196 2:127559447-127559469 CCCAGTCCTGGGCTTGATACAGG - Intronic
938294137 2:130166818-130166840 CACAGGCCTTCCATTGATTCAGG - Intronic
938462510 2:131507063-131507085 CACAGGCCTTCCATTGATTCAGG + Intergenic
939262722 2:139831077-139831099 CCCAGGGGTTGGCTTGATGATGG - Intergenic
940850033 2:158679197-158679219 CCCAGGCTTTGCTTTCATGAAGG + Intronic
941147942 2:161876118-161876140 CCCAGACCTCACCTTTATGCTGG - Intronic
941937157 2:170991991-170992013 CCCAGGAGTTGCCTTGATAATGG + Exonic
945279830 2:208025640-208025662 GTCAGGCCTTGCCTAGCTGCCGG - Intergenic
948555527 2:238807372-238807394 CCCAGGCCGTGACATGATGACGG - Intergenic
948731793 2:239968894-239968916 CCATGGCCATGCCTTGATACTGG + Intronic
948760193 2:240185499-240185521 CCCAGTCCTTTCCTAGATGAAGG + Intergenic
948760268 2:240185933-240185955 CCCAGTCCTTTCCTAGATGAAGG + Intergenic
949004740 2:241638988-241639010 CCCAGGCCTTGCTTGGGTCCAGG + Intronic
1168955628 20:1832481-1832503 CCCAGCCCTGGCCTGGGTGCTGG - Intergenic
1169277711 20:4244665-4244687 CCCAGGCCTGGGCCTCATGCTGG + Intronic
1170495297 20:16917877-16917899 CACATGCCTGGTCTTGATGCTGG - Intergenic
1171474577 20:25398310-25398332 CCCAAGCTTTGGCTTGTTGCTGG + Intergenic
1171512465 20:25696585-25696607 CCCAGGCCGCGCCTTGAAGTGGG - Intronic
1171795625 20:29564066-29564088 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1171852804 20:30320395-30320417 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1172116110 20:32574572-32574594 GCCAGGCCCTGACTGGATGCTGG - Intronic
1172529325 20:35619141-35619163 CCCAGGCCTTGCCGGGAGTCGGG - Intronic
1172690192 20:36784634-36784656 CCATGGCCTCGCCTTGGTGCCGG - Exonic
1172911516 20:38412997-38413019 CACAGGCCTGGCCTTGAAACAGG + Intergenic
1174115972 20:48226491-48226513 CCCAGGCCTGGGCATTATGCTGG + Intergenic
1174654673 20:52160924-52160946 CCCATGCCTTGGCTAGAAGCAGG - Intronic
1175156735 20:56976486-56976508 GCCAGGCCCTGGCTTGGTGCTGG - Intergenic
1175918641 20:62439582-62439604 TCCAGGCCTTTCCTTGCTGGGGG + Intergenic
1176020795 20:62961478-62961500 CCCTGGCCTGGCCTCGATCCAGG - Intronic
1176200361 20:63857688-63857710 CCCAGACTTTACCTTGATGTGGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176623274 21:9072576-9072598 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1178873596 21:36395544-36395566 CCCGGGCCCTGCCTTTATGGAGG + Intronic
1179124374 21:38578081-38578103 CCCGGGCCTGGCGTTGGTGCTGG - Intronic
1179531176 21:42020621-42020643 CACAGGCCTGCCCTGGATGCTGG - Intergenic
1179900523 21:44391120-44391142 CCCAGCCCTTCCCTTGAGGGTGG + Intronic
1180061742 21:45388757-45388779 CCCTGGCCCTGCCTTCCTGCTGG - Intergenic
1180719009 22:17893100-17893122 CCCAGGCCAAGCTTTGCTGCTGG - Intronic
1181118641 22:20650414-20650436 CTCAGGCCTGGCCATGATGCTGG + Intergenic
1181634340 22:24167395-24167417 CCCAGGCCTGCCCTTGGGGCGGG + Intronic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1182041470 22:27241911-27241933 CCCTGGCCTTGGCTCGGTGCCGG - Intergenic
1182301629 22:29340343-29340365 CCTAGCCCTTGCCCTGATCCTGG - Intronic
1183194629 22:36344975-36344997 CCCAGGCCTTGCCCCGAGCCAGG + Intronic
1183740962 22:39668397-39668419 ACCAGGCCAAGCCTTGATGCAGG + Intronic
1184688153 22:46105652-46105674 CCCAGGCCCTGCCTTCACCCTGG + Exonic
1184956472 22:47890189-47890211 ACCAAGACTTGCCTTGACGCGGG + Intergenic
949872794 3:8603483-8603505 CCCAGGCCTTGCCTTGCTTCCGG - Intergenic
952838105 3:37621417-37621439 CCCTGGCCCTGCCTGGATGCCGG + Intronic
953884001 3:46705413-46705435 CCCAGGCCTCGCCTTGTCTCTGG + Intronic
954665377 3:52248599-52248621 CACAGGGCTTGGGTTGATGCTGG + Intronic
955080823 3:55656491-55656513 CCCAGGCCTGGCCTTGAGTCCGG + Intronic
959564891 3:107824180-107824202 TCCTGGCCTTGCCCTGAAGCAGG - Intergenic
959579150 3:107966489-107966511 CACAGGCCCTGCCTTGCTGCTGG - Intergenic
960481906 3:118201764-118201786 CCCAGGCTTTGCCCTGATGGTGG + Intergenic
961048476 3:123726061-123726083 CACAGGGCTTGCCGTGATGGAGG - Exonic
962431986 3:135328416-135328438 ACCAGGGATTGCCATGATGCAGG - Intergenic
966819109 3:183911031-183911053 GCCTGGCCTTGCTTTTATGCTGG + Intergenic
968319369 3:197751302-197751324 CTCAAGTCTTGCCTTGCTGCTGG + Intronic
968358028 3:198123281-198123303 CAGAGGCCCTGCCTGGATGCTGG - Intergenic
969517695 4:7656739-7656761 TCCAGGCCTGGCCCTGGTGCAGG + Intronic
970710629 4:18858367-18858389 CCCAGGCATTGTGATGATGCTGG - Intergenic
980604124 4:135066620-135066642 CCCAGAACTTGCCGAGATGCAGG - Intergenic
985180705 4:187258373-187258395 CCAAGGCGTTGCCTGGAGGCCGG + Intergenic
985549261 5:524783-524805 CCCAGGCCCTGCGTTTATGAAGG - Intergenic
985679202 5:1247070-1247092 CCGCGGCCGCGCCTTGATGCTGG - Intergenic
988907972 5:35809535-35809557 CCCAGACCTTGCCTTCACCCAGG - Intronic
994024520 5:95067059-95067081 CCCAGGCCTTGGATTGGTACCGG - Intronic
996418020 5:123230779-123230801 CTCAGGCCTTGCAGTGTTGCAGG + Intergenic
998154452 5:139776440-139776462 CTCAGCCCCTGCCTTGCTGCAGG - Intergenic
999276764 5:150336508-150336530 CCCAGGTGATGCCATGATGCTGG + Intronic
1000339452 5:160266120-160266142 CCCAGGCCTTGCCTTTTCCCAGG + Intronic
1000661689 5:163946997-163947019 CCCAGGCCTTGCTGTGAGCCTGG + Intergenic
1003003589 6:2360208-2360230 CACAGGCCCTGCCTTGGGGCAGG - Intergenic
1003711007 6:8590162-8590184 CCCAGGCCCTGCCCTGATGGAGG - Intergenic
1004890426 6:20095861-20095883 TCCAGGCTTTCCCTTGATGGTGG - Intergenic
1004925479 6:20411726-20411748 CCTACGCCTTCCCTTGATGTGGG - Intronic
1006129345 6:31859984-31860006 CCCAGGCCTTGTCTAGACACAGG + Intronic
1006750491 6:36373655-36373677 GCCAGCCCTTGCCCTGAGGCAGG - Intronic
1006763196 6:36481899-36481921 CGCAGGTCTAGCCTTTATGCTGG + Intronic
1006845148 6:37056537-37056559 CCTAGGCCTTGGCAAGATGCTGG - Intergenic
1007629597 6:43265408-43265430 TCCAGGCCTTGCCTGGACACTGG + Intronic
1011277739 6:85645897-85645919 GCCTGGCCTTCCCTTGATTCTGG + Intergenic
1017131862 6:151114603-151114625 CCCAGGCCTGGCCCTCATGTTGG - Intergenic
1017387768 6:153906205-153906227 CCCAGGCTTTTCCTTGCTGGGGG - Intergenic
1021993549 7:26158741-26158763 CCCAAGCCCTGACTTGAGGCAGG + Intronic
1022222324 7:28325498-28325520 CCGAAGGCTTCCCTTGATGCTGG + Intronic
1022728953 7:33005115-33005137 CCCAGGCCTGGCGTTCATGGCGG + Intronic
1023823732 7:43994951-43994973 CTCTGGCCTTGCCTTTATCCTGG + Intergenic
1023850996 7:44150312-44150334 CCCACGCCCTGCCTTGACTCTGG - Intronic
1023870853 7:44262343-44262365 CCCAGGCCTTGCCTTTGTCGGGG - Intronic
1026107034 7:67429511-67429533 CCCAGGGGGTGCCTTGCTGCTGG - Intergenic
1027746486 7:82081724-82081746 CCCAGGCCTTGCTTGGGTCCGGG + Intronic
1029751999 7:102548364-102548386 CTCTGGCCTTGCCTTTATCCTGG + Intronic
1029769951 7:102647458-102647480 CTCTGGCCTTGCCTTTATCCTGG + Intronic
1030689953 7:112522172-112522194 CCCAGGTCATGCCTTCATGGGGG + Intergenic
1031173872 7:118324844-118324866 CTCAGCCCTTGACTTGCTGCTGG + Intergenic
1031951989 7:127902344-127902366 TGCAGGCCTTGCCTTGAAGGAGG + Intronic
1032460496 7:132106619-132106641 CCCAGGCCTCACCTTGGTGGTGG + Intergenic
1032889539 7:136179811-136179833 CCCAGGCCTTGCCTAACTGAAGG + Intergenic
1034493579 7:151407403-151407425 CCCAGGCTTTGCCAGGCTGCCGG - Intronic
1034496255 7:151424644-151424666 CCCTGGCCCTGCCTTGGTTCTGG - Intergenic
1034564655 7:151903763-151903785 CCCAGGCCTCAGCTTGAGGCTGG + Intergenic
1035293413 7:157854248-157854270 CCCAGCCCTTGCCTTCATGTCGG - Intronic
1037651157 8:20839905-20839927 CCCAGGCCTTGGCTAGATCCTGG - Intergenic
1038018068 8:23531257-23531279 CCCAAGCCTTTCCATGATGGAGG - Intronic
1040546233 8:48400144-48400166 CCCAGGCCATAGATTGATGCCGG + Intergenic
1044945785 8:97388036-97388058 CCCAGGCCATGTATTGATACTGG + Intergenic
1045023704 8:98065489-98065511 CCCAGTGCTTGGCTAGATGCTGG + Intronic
1045485516 8:102628110-102628132 CACAGGCCTTGCCCTGACCCAGG - Intergenic
1046343865 8:112896264-112896286 CTCAGGCCTGGAGTTGATGCTGG - Intronic
1047170316 8:122486336-122486358 TCCAGGCTTTCCCTTGGTGCTGG + Intergenic
1048449930 8:134524213-134524235 CCGAGGGCCTGCCTTGGTGCCGG + Intronic
1049259045 8:141629129-141629151 GCCAGGCCTGGCCTTGGTGCGGG + Intergenic
1049384388 8:142333845-142333867 CTCAGGCCTTGCCTTCCTGGAGG - Intronic
1049501770 8:142971100-142971122 CCCAGGCCTGGCGTGGCTGCTGG + Intergenic
1049839377 8:144761237-144761259 CCCAGGCCGAGCCCTGATGGTGG - Intergenic
1053020004 9:34688175-34688197 CCCAGGCCTGGTTTTGTTGCTGG + Intergenic
1053066922 9:35075508-35075530 CCCAGGCCTGGCCCTGAAGCAGG + Exonic
1053790600 9:41683675-41683697 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054154560 9:61631126-61631148 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054178945 9:61895374-61895396 CCCTGGCCTTACCTGGAAGCTGG - Intergenic
1054474337 9:65562202-65562224 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1054658592 9:67685457-67685479 CCCTGGCCTTACCTGGAAGCTGG + Intergenic
1057547985 9:96032202-96032224 CCCTGGCCTTTCCCTGATGAAGG - Intergenic
1060014439 9:120074190-120074212 GCCAGCCCTTGACTAGATGCTGG + Intergenic
1060814494 9:126627490-126627512 CCAGAGCCTTGCCTTGGTGCTGG + Intronic
1061683646 9:132257818-132257840 CCCAGGCTTTGCTTTCATGAAGG - Intergenic
1062389148 9:136327285-136327307 CCTGGGCCTGGCCTTGCTGCTGG - Intergenic
1062590492 9:137272435-137272457 CCCAGGCCCAGCCCAGATGCAGG - Intronic
1062741895 9:138179816-138179838 CAGAGGCCCTGCCTGGATGCTGG - Intergenic
1203746460 Un_GL000218v1:43003-43025 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1203563645 Un_KI270744v1:76477-76499 CTCAGTCCTGGCCCTGATGCAGG + Intergenic
1185817215 X:3167331-3167353 CCCAGCCCTTGCACTGATGGAGG - Intergenic
1186605180 X:11082099-11082121 GCCAGGCCCTGCTTTGATTCAGG - Intergenic
1186876822 X:13825615-13825637 TCCAGGCTTTGCACTGATGCTGG - Intronic
1188461964 X:30438085-30438107 GCCAGGCTGTGCCTTGATTCCGG - Intergenic
1191629027 X:63300860-63300882 CCTAGGCATTGCCTTGGTGAAGG + Intergenic
1194589032 X:95773641-95773663 CTCAGTCCTTGCCTTGATGGAGG + Intergenic
1197159427 X:123307158-123307180 TCCTGGCTTTGCCTTGATGGTGG - Intronic
1197753473 X:129980627-129980649 CCCCGCCCTTGCCTGGGTGCTGG - Intergenic
1201159792 Y:11158017-11158039 CTCAGTCCTGGCCCTGATGCTGG - Intergenic