ID: 1151344170

View in Genome Browser
Species Human (GRCh38)
Location 17:73491670-73491692
Sequence AGAGCTGGTGGGATTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151344170 Original CRISPR AGAGCTGGTGGGATTGAATC TGG (reversed) Intronic
900703299 1:4061137-4061159 AGGGCTCGTGGGATTGCACCAGG - Intergenic
902655478 1:17865054-17865076 TGGGCTGGTGGGCTTGATTCGGG + Intergenic
903006569 1:20302753-20302775 GGAGGTGGTGGCATTGAAGCTGG + Intronic
903236348 1:21953030-21953052 AGATCTGGTGGGGTTGGACCAGG - Intergenic
904009639 1:27382458-27382480 AGAGCTGGGGGCACTCAATCTGG + Intronic
904358309 1:29955864-29955886 AGAGCTGGTGGGAATAAAGATGG - Intergenic
912429681 1:109622473-109622495 AGAGTTGGTGGGAGTGGCTCTGG + Intronic
912453905 1:109785226-109785248 AGAGCTGGTGGGATTGAAGCAGG + Intergenic
912572653 1:110635794-110635816 TGAGCTGGTGGGAGTGTGTCTGG + Intergenic
915686172 1:157636906-157636928 AGAGCTGGTGCAAGTGAGTCTGG - Intergenic
916787234 1:168095527-168095549 AAAGGTGGTGGGATTGTGTCCGG + Intronic
918441860 1:184575915-184575937 AGAGGTGGAAGGATTGAATCTGG + Intronic
919403282 1:197146544-197146566 AGAGGTCGTGGGAGTGAATTCGG + Exonic
919943339 1:202303384-202303406 AGAGCTCTTGGGAATGAAGCTGG - Intronic
920417852 1:205810697-205810719 AGAGCTGGTGGGTTGGAGTCAGG - Exonic
922372335 1:224924061-224924083 GGAGCTGGTGGGAGTGTAGCAGG - Intronic
1064380429 10:14837577-14837599 AAAGCTGGTGGGTTTGTATTTGG - Intronic
1065705945 10:28471728-28471750 TGAGCTGGTGGGGTGGAAACTGG - Intergenic
1066411305 10:35172072-35172094 TGAGCTGATGGGATAGAAGCTGG + Intronic
1067111585 10:43405335-43405357 ACAGCTGGTTGGTTTGAGTCAGG - Intronic
1068070645 10:52190516-52190538 AGAGTTGTTAGGATTAAATCAGG - Intronic
1069708947 10:70477169-70477191 ACAGCTGGTGGGATGGGATATGG + Intergenic
1070284344 10:75072436-75072458 AGAGTTAGTGGGAGTGAAACAGG - Intergenic
1070770134 10:79077419-79077441 AGAGGTGGTGGGATTGGCTGGGG + Intronic
1071613668 10:87055195-87055217 AGGGCTGCTGGGATTTAATCAGG + Intronic
1074858455 10:117491046-117491068 ACAGCTGCTGGGACTGGATCTGG - Intergenic
1077206732 11:1348393-1348415 AGAGATGGTGGGGTTGAGTCTGG - Intergenic
1077786424 11:5389463-5389485 AAAGCTGGTGAGATAGAATATGG - Exonic
1079132507 11:17755727-17755749 AGAGCTGGTAGAATTCCATCTGG + Intronic
1083246709 11:61434121-61434143 AGATCTGTTAGGCTTGAATCTGG + Intronic
1086072386 11:82813431-82813453 GGGGCTGTTGGGATTGAATGAGG + Intergenic
1086254812 11:84862998-84863020 AGAGTTGGTGGGAGAGAAGCAGG - Intronic
1086349521 11:85931474-85931496 AGAGCTGTTGGGATTCACTCAGG - Intergenic
1086729017 11:90224903-90224925 AGTGGAGGTGGGATTGAAACAGG - Intergenic
1087068900 11:94055279-94055301 AGAAGTGGTGGGAGTGAAACAGG - Intronic
1088238196 11:107747607-107747629 GAAACTGGTGGGATTAAATCTGG - Intergenic
1088457728 11:110050239-110050261 AGAGCTGGGGGGCTAGACTCCGG - Intergenic
1088501814 11:110490823-110490845 GGAGCTGGTGGGATGGAGACGGG + Intergenic
1089209511 11:116790862-116790884 CGAGCTGGTGGGCTGGAATTTGG - Exonic
1090803236 11:130187626-130187648 GGTGATGGGGGGATTGAATCTGG + Intronic
1091221108 11:133930642-133930664 AGAGCTGGAGGGCTGGAATGAGG - Intronic
1101282951 12:103278506-103278528 AGAGCTGTTGGGATAAAATGGGG + Intronic
1101293892 12:103400998-103401020 AGCTCCGGTGGGACTGAATCTGG + Intronic
1101690970 12:107080732-107080754 AGAGTGGGTGGGAGTGAAGCCGG + Intronic
1102688861 12:114744803-114744825 TGAGCTGGTGGGCTTGGATGAGG - Intergenic
1104740446 12:131168202-131168224 AGAGATGGTGGGATGGCAGCAGG + Intergenic
1108129685 13:47284812-47284834 AGTGTTGGTGGGAGTAAATCTGG + Intergenic
1108361121 13:49668836-49668858 AGAGCTTGTGGGGTTTAAACTGG - Intronic
1108863615 13:54894608-54894630 AGAGCTGATGAGATTGATTGAGG - Intergenic
1109908329 13:68875062-68875084 AGAGCTGGTTTGATTGCATCCGG - Intergenic
1111266573 13:85822881-85822903 AGAGCTGGTAGGCTGGTATCAGG + Intergenic
1115284166 14:31700247-31700269 AGAGCTGTTGGGTTTTAATCTGG - Intronic
1115381924 14:32749778-32749800 AGAGATGGAGGATTTGAATCTGG + Intronic
1117605535 14:57424716-57424738 AGAGCTCCTGGGACTGAATTGGG + Intergenic
1119132448 14:72186623-72186645 AGAGCAGGAGGGTTAGAATCAGG - Intronic
1122203847 14:100138539-100138561 AGAGCAGGAGGCATTGAAACTGG + Intronic
1122873629 14:104652640-104652662 CGAGCTGGTGGTATTGAGCCAGG + Intergenic
1124413854 15:29458498-29458520 AGAGCTGGAGGGATTGGGTAGGG - Intronic
1126508507 15:49437954-49437976 AGAGCAGGTGGGAGTGAATCAGG + Intronic
1126791757 15:52227815-52227837 AGAGCTTTTGGAATTGCATCCGG - Intronic
1128779219 15:70347424-70347446 ATTGCTGGTGGGAGGGAATCTGG + Intergenic
1134189975 16:12113452-12113474 AGAGTTGGTGAGATTCACTCCGG + Intronic
1135525432 16:23210242-23210264 AGGGGAGGTGGGATTGGATCAGG + Intronic
1135601401 16:23786927-23786949 AGAGATGGTGGGCTTGAAATTGG - Intergenic
1140907694 16:79423302-79423324 AGAGGAGGTGGGAATGAATTTGG + Intergenic
1145867022 17:28247999-28248021 GGGGATGGTGGGACTGAATCAGG + Intergenic
1146405513 17:32533395-32533417 AGAGAAGGTGGGTTTGAAACAGG - Intronic
1147925068 17:43941072-43941094 GGGGGTGGTGGGACTGAATCAGG - Intronic
1148941322 17:51214623-51214645 GGAGCTGTTGTGATTGAGTCAGG - Intronic
1151344170 17:73491670-73491692 AGAGCTGGTGGGATTGAATCTGG - Intronic
1151852978 17:76701881-76701903 AAATCTGATAGGATTGAATCTGG - Intronic
1151871566 17:76840382-76840404 AGAGCAGCTGGGATGGATTCTGG - Intergenic
1153263922 18:3249397-3249419 AGCGCTGGTGGCAATGAATCTGG - Intronic
1158309368 18:56141925-56141947 ATAGCTGGTGAGACTGAAGCGGG + Intergenic
1158702394 18:59760257-59760279 AGAGTTGCTGTGATTGAAACAGG + Intergenic
1159475395 18:68914391-68914413 TGAGCTGCTGGGATAGACTCAGG + Intronic
1159558665 18:69971163-69971185 TGAGCTGCTGGGATGGAATCTGG + Intergenic
1161503049 19:4628076-4628098 AGAGCTGGGAGGATGGAATTTGG - Intergenic
1165804323 19:38571323-38571345 AGAGCTGTGGGGATTGAAAGAGG + Intronic
1165992356 19:39823880-39823902 AGAGGTGTTGGGAATGGATCAGG - Intergenic
1168458884 19:56538198-56538220 AGAGCTTGTGGGATTGTTTTGGG - Intergenic
1168617678 19:57851598-57851620 AGAGCTGGAAGGATGGAACCTGG + Intronic
925008149 2:461463-461485 AGAGTTGGTGGGATGGAGCCTGG + Intergenic
929742222 2:44614901-44614923 AGAGCTGGTTAGAGTGAATAAGG - Intronic
929826738 2:45314777-45314799 TGTGCTGGTGGGAATGATTCAGG + Intergenic
930676737 2:54209727-54209749 AGAAATGGTGGGATGCAATCAGG - Intronic
931037643 2:58261033-58261055 AGAGCTGGTGTGTTCAAATCAGG - Intergenic
932682977 2:73842450-73842472 TGAGCTGCTGGGATGGACTCTGG + Intronic
933100910 2:78255876-78255898 AGAGGTGGTGGGATTTCTTCTGG - Intergenic
933782941 2:85814338-85814360 AGAGCTGGTGGACTTGGAACAGG + Intergenic
936380675 2:111983085-111983107 AGACCTGGTGTGATTGAGTTAGG + Intronic
936573836 2:113637301-113637323 GGAGGTGGTGGCATTGAAGCAGG - Intronic
937290392 2:120778383-120778405 GGAGCTGCAGGGACTGAATCAGG - Intronic
937842008 2:126533713-126533735 AGAACTGGTGGGACTGGAGCAGG + Intergenic
940778644 2:157910259-157910281 AGAGCTAGTGGGATGGCATAAGG - Intronic
941229952 2:162899503-162899525 AGAGCTGGTGGTTTGGAGTCAGG - Intergenic
943009123 2:182425117-182425139 AGAGCTGTGGGGATTGAAGCAGG - Intronic
943184875 2:184595549-184595571 AGAGCTGGACTGAATGAATCTGG + Intergenic
943730522 2:191298838-191298860 ACAGCTGGTGGGAGTGGAGCCGG + Intronic
946108673 2:217394757-217394779 AGAGCTGGTGGGGCTTACTCAGG - Intronic
946554764 2:220843666-220843688 AGAGCTGGTGGTAAGGAATAAGG - Intergenic
948740917 2:240045466-240045488 AGAGCTGGTGGATTTCATTCTGG - Exonic
1170075539 20:12415009-12415031 ACAGCTGGTGGGCTTGAGTGTGG - Intergenic
1171476962 20:25418013-25418035 AGAGCTGGTGTGTTTGCATCAGG + Intronic
1172815957 20:37686376-37686398 ATAGCTGCTGGGAATGATTCAGG + Intergenic
1172845468 20:37927662-37927684 AGAGCTGGTGGGCCAGAGTCAGG + Intronic
1173361908 20:42352189-42352211 AGAGGTGGTGGGTTTCATTCCGG + Exonic
1174393845 20:50234040-50234062 AGAGCTGGAGGAGTTGAAACAGG + Intergenic
1176040425 20:63062597-63062619 GGAGCTGGTGGGCTTGAATGTGG + Intergenic
1178597342 21:33966649-33966671 AAAGCTGATGGTATTGATTCTGG - Intergenic
1179832600 21:44006885-44006907 AGAGCCGGTGGGATTGGAGGAGG + Intergenic
1181629171 22:24141567-24141589 AGGGCTGGTGGGAGGGCATCTGG - Intronic
1181833303 22:25580328-25580350 ATAGCTGGTGGGTTTCAATCTGG - Intronic
1182111771 22:27728777-27728799 AGAACTGGGGGGATAGAATTTGG + Intergenic
1182619505 22:31611164-31611186 AGCGCTGGTGGGACTGCAGCCGG + Exonic
1183366557 22:37410107-37410129 AGAGCTGGCTGGATGGAAGCTGG - Intronic
1184512639 22:44942440-44942462 AGAGCTGGGGGGATGAAGTCTGG - Intronic
1184987427 22:48145300-48145322 AGGGCTTGGGGGACTGAATCAGG - Intergenic
1185426340 22:50773592-50773614 GGAGGTGGTGGCATTGAAGCAGG + Intronic
953820122 3:46201097-46201119 AGAGCTGGTGGGTTTACAACTGG + Intronic
961329310 3:126129378-126129400 AGAGCAGGTGGGAATGACTGTGG + Intronic
967949769 3:194831835-194831857 GTTGCTGGTGGGTTTGAATCGGG + Intergenic
968027081 3:195451507-195451529 AGAGTTGGTGAGGTTGAAACAGG + Intergenic
971558395 4:28042120-28042142 TGAGCTGCTGGGATAGTATCTGG + Intergenic
972083961 4:35190269-35190291 AGAACTGTTGGGATTCACTCAGG + Intergenic
974067419 4:57092008-57092030 AGAGCTGCTGAGATTCAACCTGG + Intronic
978504941 4:109446214-109446236 AGAACTGCTGTGATTGTATCAGG - Intronic
978745024 4:112183362-112183384 TCAGCTGGTGGGATTGAGACTGG - Intronic
979603430 4:122610858-122610880 AGTGCTGGTGGGTTTAACTCTGG + Intergenic
980880005 4:138700490-138700512 AGAGGTGGTGGGATTAGCTCAGG - Intergenic
981660848 4:147164730-147164752 TGAGCTGCGGGGATGGAATCAGG + Intergenic
982284282 4:153718501-153718523 AGAACTGGTCGGGTTGGATCAGG + Intronic
983430151 4:167639636-167639658 AGAGCTGGTGGGTTTAAAAGGGG - Intergenic
984329370 4:178295958-178295980 AGAGGTGGGGGGATTGAAATGGG + Intergenic
991296604 5:65088238-65088260 AGAGCTGGTGTAATTAACTCTGG - Intergenic
994128927 5:96201698-96201720 AGAACTGGTGGTATTGGAGCAGG - Intergenic
994587912 5:101734383-101734405 GAAGCTGGTGGAAGTGAATCTGG + Intergenic
995218083 5:109618145-109618167 AGAGCTGATCGGGTTGAATCAGG + Intergenic
999707688 5:154289006-154289028 AGAGCCAGTTGAATTGAATCAGG + Intronic
1002459017 5:179363594-179363616 AGAGCTGGAGGGAAAGAAACTGG - Intergenic
1003633949 6:7814173-7814195 AGAGCTGCTGAGATTCAATTAGG + Intronic
1004998305 6:21215604-21215626 AGAGCTGGAAGGGTTGGATCTGG + Intronic
1005973306 6:30778383-30778405 AGAACAGTTGGGATTCAATCTGG + Intergenic
1006009709 6:31032214-31032236 AGAGCTGGAGGCAGTGAGTCTGG - Exonic
1006562119 6:34922665-34922687 AGAGCATGGAGGATTGAATCTGG + Intronic
1007237767 6:40403354-40403376 GGAGCTGGTGGGATTCAGTGAGG + Intronic
1011009175 6:82684574-82684596 TGAGCTGGTGGGAAGGAGTCTGG + Intergenic
1013320297 6:108981469-108981491 AGAGCTGGTGGGGGTGAAAATGG - Intergenic
1013937414 6:115615090-115615112 TAAGCTGGTTGGATTGAACCAGG + Intergenic
1014524874 6:122490563-122490585 AGATCTGGTTGTTTTGAATCTGG + Intronic
1015430692 6:133127689-133127711 AGAGCTGGTGAGATTGGTCCTGG + Intergenic
1018848320 6:167570563-167570585 AGGGCTGGTGGGGCTGAAGCCGG - Intergenic
1020843626 7:13254695-13254717 GGAGCTGATGGTATAGAATCTGG - Intergenic
1021039090 7:15839281-15839303 TGAGCTGGTGAAATTGATTCAGG + Intergenic
1022140327 7:27487861-27487883 AGAGGTGGAGGGATGGAGTCAGG - Intergenic
1022493198 7:30836511-30836533 AGAGCTGGGGTGAATGAATGCGG + Intronic
1023741363 7:43284011-43284033 AGAGATGTGGGGATTGAGTCAGG + Intronic
1028466041 7:91153057-91153079 AGGGCTGGTGGGAATGGATCAGG + Intronic
1031275901 7:119723395-119723417 AGAACTGGAGGGATTTAATTAGG - Intergenic
1031540544 7:122989751-122989773 AGTACTTGAGGGATTGAATCAGG - Intergenic
1031696250 7:124858143-124858165 ACAGCTAGTTGGATTGAAGCAGG - Intronic
1031936526 7:127740804-127740826 AAATCTGGTGAGATTGATTCTGG + Intronic
1031964074 7:128014837-128014859 GGAGCTGGTGGGATGGATACAGG - Intronic
1032345271 7:131110449-131110471 AGAGCTGGAGGCAATGATTCAGG + Intronic
1033445299 7:141416256-141416278 AGAGGTGGTGGGAATGTCTCTGG - Intronic
1034634526 7:152556418-152556440 AGAGATAGTTGGACTGAATCTGG + Intergenic
1035035972 7:155893932-155893954 AGCACTGCTGGGATTGTATCTGG - Intergenic
1036258618 8:7223417-7223439 AGAGCTGTTAGGGTTGAAACAGG - Intergenic
1036310673 8:7682013-7682035 AGAGCTGTTAGGGTTGAAACAGG - Intergenic
1039208931 8:35189009-35189031 AGAGCTGGTGGTTTTGATTAAGG + Intergenic
1039240345 8:35549315-35549337 GGAGCTGATGGGATGGATTCGGG - Exonic
1041413218 8:57579288-57579310 AGGGCGGGTGGGAGTGAAGCAGG + Intergenic
1042131807 8:65594686-65594708 AATGCTGGTGGGATGGATTCAGG - Intergenic
1043815316 8:84794018-84794040 AGAGATGGTGAGGTTGAAGCTGG + Intronic
1045405661 8:101864386-101864408 AGAGCTGGTGGGATTAATTACGG + Intronic
1048754006 8:137714494-137714516 AGAGCTGGGGAGACTGAATCAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049416496 8:142497859-142497881 AGAGCTGGAGGGAATGGACCAGG + Intronic
1051760866 9:20462576-20462598 AGAGGTGGTGCTATTGAGTCAGG - Intronic
1052640816 9:31164483-31164505 AGTTTTGGTGGGAATGAATCAGG + Intergenic
1053269533 9:36740476-36740498 AGAGCTGGTGAGGTGGAAGCAGG - Intergenic
1059332767 9:113546472-113546494 AGAGGTTGTAGGATTGAATTAGG + Intronic
1059436750 9:114281745-114281767 AGAACAGCTGGGATTGATTCAGG + Intronic
1060114236 9:120928415-120928437 AGGGCTGGTTGGATAGAAACTGG - Exonic
1060491843 9:124090957-124090979 AGTGCAGGTGGGAGGGAATCAGG + Intergenic
1185910576 X:3977068-3977090 AAAGCTGGAGGGATAGAATTAGG + Intergenic
1186882238 X:13878063-13878085 ACAGTTGGTTTGATTGAATCAGG + Intronic
1189489565 X:41459282-41459304 AGAGCTGCTGGGAGTGGCTCGGG - Intronic
1189539100 X:41967582-41967604 AGAGCTGATGGGGTAGATTCCGG + Intergenic
1189670640 X:43404740-43404762 AATGCTGCTGGGATGGAATCAGG + Intergenic
1190394028 X:49961562-49961584 AGAGCTGGTGAGATGGCATCTGG - Intronic
1191009628 X:55747084-55747106 AGGGGTAGTGGGAGTGAATCAGG + Intronic
1195343483 X:103926580-103926602 AGAGCTAATGGGAGTGATTCTGG + Intronic
1195363485 X:104106739-104106761 AGAGCTGATGGGAGTGATTTTGG - Intronic
1196706941 X:118725108-118725130 AGAGCGTCTTGGATTGAATCAGG - Intergenic
1197147733 X:123187770-123187792 AGGGCTGGTGGGTGTCAATCTGG - Intronic
1197404226 X:126029862-126029884 GGTGCTGGTGGGGTTGAGTCTGG + Intergenic
1200236970 X:154472442-154472464 AGAGCTGGTGGGTTTGTACAGGG + Intronic
1202129845 Y:21599577-21599599 AAAGCTGGTGGGATTCAGCCTGG + Intergenic