ID: 1151346644

View in Genome Browser
Species Human (GRCh38)
Location 17:73506633-73506655
Sequence GATTATGCACATCAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151346635_1151346644 14 Left 1151346635 17:73506596-73506618 CCCCAGGGCAAGACAATCTTGTT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 12
4: 82
1151346637_1151346644 12 Left 1151346637 17:73506598-73506620 CCAGGGCAAGACAATCTTGTTTC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 12
4: 82
1151346638_1151346644 -10 Left 1151346638 17:73506620-73506642 CCCCAACAAAACCGATTATGCAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 12
4: 82
1151346636_1151346644 13 Left 1151346636 17:73506597-73506619 CCCAGGGCAAGACAATCTTGTTT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 12
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151346644 Original CRISPR GATTATGCACATCAGGCCCT GGG Intronic
900818388 1:4868008-4868030 GATTTTGAACATGAGTCCCTAGG - Intergenic
903664858 1:25000015-25000037 TATTCTCCACACCAGGCCCTGGG - Intergenic
904615235 1:31745972-31745994 GATCATGTGGATCAGGCCCTGGG - Intronic
907368024 1:53978813-53978835 ATTTATGCACATGAGACCCTCGG + Intergenic
907491537 1:54811879-54811901 CATCCTGCACATGAGGCCCTCGG - Exonic
909154179 1:72049887-72049909 GGTAATGCATATCAGGCTCTGGG + Intronic
909213098 1:72849535-72849557 GATTCTGCACATCAAACCATTGG - Intergenic
912192500 1:107356139-107356161 GATTATGCACATCTGGCATAAGG + Intronic
913142020 1:115950837-115950859 GATTTTGCACATTAGCCCATGGG + Intergenic
919560602 1:199114094-199114116 GATTTTGAACATAAGGCCCTTGG - Intergenic
1063689490 10:8272742-8272764 GATTATGCAAATGAGACCCAGGG - Intergenic
1067534523 10:47099213-47099235 CATCATGCAGATCAGGCCTTTGG + Intergenic
1070864792 10:79701557-79701579 GACTCTGCACTTGAGGCCCTGGG - Intergenic
1070878582 10:79839685-79839707 GACTCTGCACTTGAGGCCCTGGG - Intergenic
1071033971 10:81220653-81220675 GTTTATGCACTTTAGGCCTTTGG + Intergenic
1074781791 10:116807502-116807524 GAGCATGCTCATCAGGCTCTTGG - Intergenic
1074960699 10:118442714-118442736 GATAATGTACATTAGGCCCCTGG + Intergenic
1079793403 11:24768087-24768109 TATTAGGCAAATCAGGCACTGGG + Intronic
1080519930 11:33059918-33059940 GATCATGTACATCCAGCCCTTGG - Intronic
1082742314 11:56924409-56924431 TATAATCCAGATCAGGCCCTAGG + Intergenic
1095636006 12:44434562-44434584 CACAATGCACATCAGTCCCTGGG - Intergenic
1097022840 12:56032983-56033005 AATCATACACATCTGGCCCTTGG - Intronic
1099331080 12:81288267-81288289 GATGAGGCACATGAGGTCCTGGG + Intronic
1102602690 12:114044287-114044309 GATTTTGCACATCACACCCAAGG - Intergenic
1103136342 12:118511095-118511117 GATTCTTCACTTCATGCCCTTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108501113 13:51070840-51070862 CATAATGCACATAAAGCCCTTGG - Intergenic
1113079949 13:106508507-106508529 CATTATGCAAATCAGGCCCAGGG + Intronic
1114159194 14:20144147-20144169 GATAATGCATAGCAGGCTCTAGG - Exonic
1116453458 14:45090249-45090271 GTTTAATCACTTCAGGCCCTAGG - Intronic
1119056187 14:71422491-71422513 AATGATGGACATCAGGGCCTGGG - Intronic
1123122598 14:105924858-105924880 GATGATACACATCAGGCACTGGG - Intronic
1123405248 15:20016284-20016306 GATGATACACATCAGGCACTGGG - Intergenic
1123514577 15:21022932-21022954 GATGATACACATCAGGCACTGGG - Intergenic
1124199992 15:27671008-27671030 GAATCTGCACATCAGAACCTGGG + Intergenic
1128738934 15:70070327-70070349 GATTATGCACATCACGCCTTAGG + Intronic
1130434720 15:83886349-83886371 GATTATGAACATCTAACCCTTGG - Intronic
1131268578 15:90933085-90933107 GATTTTTCAGGTCAGGCCCTAGG - Intronic
1133337346 16:5014754-5014776 GATGCTGCAAATCAGGCCCCAGG - Intronic
1141123461 16:81381935-81381957 CATCATGTACATCAGGCACTTGG - Exonic
1141189890 16:81816820-81816842 GCTTCTGGACATCAGGACCTTGG - Intronic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1147343846 17:39773366-39773388 GATTATGGACATCAGGCCTTTGG + Intronic
1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG + Intronic
1153062627 18:1009846-1009868 GATTGTCCACCTCAGCCCCTAGG + Intergenic
1156271711 18:35540954-35540976 GATTATACACATCAGGTTTTTGG + Intergenic
1156635173 18:39019390-39019412 CATTGTGCAGATCAAGCCCTAGG - Intergenic
1156842421 18:41625187-41625209 GATTATGAACATCAGGTCATGGG - Intergenic
1158395162 18:57073594-57073616 GATGATGCATATAAAGCCCTCGG - Intergenic
1158814500 18:61078555-61078577 TATTATGCACATCATGCAGTGGG - Intergenic
1161866251 19:6834014-6834036 GATTATGGAGATCTGTCCCTGGG - Intronic
1164811592 19:31161667-31161689 GATCCTGCACATCAGGGCCCAGG - Intergenic
1164872284 19:31656193-31656215 GATTGTTCACACCAGTCCCTTGG + Intergenic
1164947606 19:32309707-32309729 GATTTTGCAGAGAAGGCCCTCGG - Intergenic
927098645 2:19768890-19768912 CATTATGCACAAAAGGCCATTGG - Intergenic
930041981 2:47132298-47132320 GATTATTCACTTCAGGTCCTAGG - Intronic
930755627 2:54969093-54969115 GATTATGCACAAAAGCCCATGGG - Intronic
932109249 2:68979944-68979966 GACTGAGTACATCAGGCCCTTGG - Exonic
935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG + Intergenic
938491755 2:131764826-131764848 ACTTGTGGACATCAGGCCCTAGG + Intronic
938495811 2:131797516-131797538 ACTTGTGGACATCAGGCCCTAGG - Intronic
944532629 2:200682519-200682541 GATTATTGACAACAGGGCCTAGG - Intergenic
945287567 2:208097549-208097571 GAATATGGACATCAGGAGCTTGG - Intergenic
945950228 2:216032533-216032555 GATTCTGCTCTGCAGGCCCTAGG - Intronic
1170114669 20:12844514-12844536 GATTTTGCATATCAGGCTGTTGG - Intergenic
1173441132 20:43077238-43077260 GATAATGCACATGAAGCCCTTGG - Intronic
1174175960 20:48645047-48645069 GACTATGGACATGAGGCTCTGGG + Intronic
1174440377 20:50546917-50546939 GCTTAAGAACTTCAGGCCCTGGG - Intronic
1174574792 20:51529207-51529229 GACTGTGCACATCAGCCCCAAGG - Intronic
1174860405 20:54086099-54086121 GATAATGCACAGCACGCGCTTGG + Intergenic
1181184815 22:21095417-21095439 GATCATGCACCTCAGTCCCCTGG - Intergenic
1181495936 22:23287535-23287557 GTTTGTGCAGATCTGGCCCTTGG + Intronic
961692168 3:128677925-128677947 GATTAAGCACTTCAGGGCCAAGG - Intronic
963251434 3:143106997-143107019 GATTATGCAGGTCAGACACTAGG + Intergenic
965789616 3:172373364-172373386 GCTTATGCACCACAGGCCCTAGG - Intronic
980834299 4:138172478-138172500 GATTAGGCAAATTAGGCCCTAGG - Intronic
984261329 4:177446004-177446026 GATTATGGACATGAGCCACTAGG - Intergenic
987314114 5:16708410-16708432 CATTATGGAAATCAGGCCCAAGG - Intronic
1001323036 5:170698536-170698558 GATAGTGCACATGAAGCCCTAGG + Intronic
1010434966 6:75818724-75818746 CATTATGCATTTCAGTCCCTGGG - Intronic
1010998971 6:82565700-82565722 GATGAAGCCCATCAGACCCTGGG - Intergenic
1015041517 6:128726245-128726267 GATTATGCATATCAGACTATGGG + Intergenic
1015813384 6:137183799-137183821 AATTATGCAAGTCAGGCACTAGG - Intergenic
1017183856 6:151580357-151580379 AATAATGCAAATCAGTCCCTTGG + Intronic
1018785656 6:167105915-167105937 GATCATGCACAGCATGCCCAAGG - Intergenic
1020528317 7:9294406-9294428 GAAAATGCACATAAAGCCCTTGG - Intergenic
1021893144 7:25207063-25207085 TATTATGCACATGAAGCCCCAGG + Intergenic
1025280987 7:57626372-57626394 TAACATGGACATCAGGCCCTAGG + Intergenic
1025303742 7:57839135-57839157 TAACATGGACATCAGGCCCTAGG - Intergenic
1035645030 8:1212176-1212198 GATCATGAACATGAGGCTCTTGG - Intergenic
1045106707 8:98899694-98899716 CATTATGCATATCATGCCCTTGG - Intronic
1057197858 9:93124980-93125002 GATGATGAACACCAGGCCCGTGG + Exonic
1062405270 9:136393240-136393262 GACCATGCACATCAGGCCACGGG + Intronic
1186653926 X:11592418-11592440 TATTGTGCACATCAGTTCCTGGG - Intronic
1193699731 X:84746146-84746168 AATTATGCAGATCAGACACTAGG + Intergenic
1195111316 X:101653077-101653099 GAGTAAGAACATTAGGCCCTAGG + Intergenic
1196179867 X:112678158-112678180 GAACCTCCACATCAGGCCCTGGG + Intronic