ID: 1151348836

View in Genome Browser
Species Human (GRCh38)
Location 17:73519584-73519606
Sequence ACTCCCCTAAGGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151348836_1151348842 29 Left 1151348836 17:73519584-73519606 CCTCCCAGCCTCCTTAGGGGAGT 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1151348842 17:73519636-73519658 ATCTGAAGCTCAGATGAGAGAGG 0: 1
1: 1
2: 1
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151348836 Original CRISPR ACTCCCCTAAGGAGGCTGGG AGG (reversed) Intronic
900300164 1:1973169-1973191 CCTCCCCAAGGGAGGCTGTGCGG - Intronic
900330070 1:2129758-2129780 ACTCGCCTATGGAGGCTGAGAGG - Intronic
900415158 1:2531408-2531430 CCTCCCCTAAGGACCCAGGGTGG - Intergenic
900985950 1:6072870-6072892 ACACCCCTTGGGAGGCAGGGTGG + Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903222612 1:21877308-21877330 ACTCCCCTAAGGACCTTGAGAGG + Intronic
905179515 1:36157186-36157208 CCTCCCCGAATCAGGCTGGGTGG - Intronic
906659318 1:47571384-47571406 ACTCCAGCATGGAGGCTGGGAGG - Intergenic
908724067 1:67156588-67156610 ACAGCCCTAAGGAGACTGGGAGG - Intronic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
917232783 1:172856045-172856067 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
918160042 1:181889737-181889759 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
920007659 1:202845151-202845173 ACTCAGCTAAGGAGGCTGTATGG - Intergenic
920703924 1:208238097-208238119 ACTCCTCCAAGAGGGCTGGGAGG + Intronic
921821154 1:219618922-219618944 ACTCCCCTGAGAAGTTTGGGTGG - Intergenic
1067252034 10:44594485-44594507 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1069703366 10:70441777-70441799 ACCCCCCTCCGGAGGGTGGGGGG + Intronic
1072617486 10:97059399-97059421 CATCCCCTGAGGAGGCTGGCAGG - Intronic
1073268009 10:102240134-102240156 ACTCCAGCAAGGAGTCTGGGGGG + Intronic
1073283841 10:102375261-102375283 ACTGGCCTAAGGAGACTGGTGGG + Intronic
1073604839 10:104883781-104883803 TTTCCTCTAAGGAGGCTGGGAGG + Intronic
1074744905 10:116522881-116522903 ACTCTCCTGGGGAGGCTGGAAGG + Intergenic
1075141927 10:119845548-119845570 GGTTCCCTAAGGAGGCTGGGTGG + Intronic
1075742059 10:124701944-124701966 GAACCCCTAAGAAGGCTGGGAGG + Intronic
1075990329 10:126832780-126832802 ACTCCCCAAAGGAAGCTAAGGGG + Intergenic
1076312966 10:129521356-129521378 ACTCCCACCAAGAGGCTGGGCGG - Intronic
1077096972 11:803168-803190 ACTCACCCAGAGAGGCTGGGAGG + Exonic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1080211603 11:29793050-29793072 AATCCAGTAAGGAGGTTGGGGGG + Intergenic
1084357971 11:68652155-68652177 ACTCTCCTAAGGAGCCCGGCTGG - Intergenic
1085129832 11:74028793-74028815 AAGCCCCTCAGGAGGCTGGCAGG + Intronic
1085254652 11:75165608-75165630 TCTCCCCTAAGGGGGCCGTGCGG + Intronic
1085423137 11:76380869-76380891 ACTGCCCTGAGGAGGCGGGGAGG - Exonic
1087939011 11:104071031-104071053 ACTCCCCTAGTGAGGCAGTGAGG - Intronic
1089164249 11:116462435-116462457 AATCCCCCAAGGATGCTGAGTGG + Intergenic
1089731649 11:120523067-120523089 ACTGCTCCTAGGAGGCTGGGTGG + Intronic
1090307785 11:125705316-125705338 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1091167612 11:133493276-133493298 TCTCCCCAAAGGGTGCTGGGTGG - Intronic
1091710543 12:2737224-2737246 ACTCCGCCAGGGAGGGTGGGAGG - Intergenic
1092143983 12:6202094-6202116 ATTTCCCTAAGGAGGCTTGTGGG - Intronic
1092247742 12:6872921-6872943 ACTCCCCGAAAGAGGCTTGCTGG + Exonic
1092387078 12:8044021-8044043 ATTCCCCTCAGGAGGCAGTGAGG - Exonic
1096665041 12:53158783-53158805 ACCCCCAGAAGGTGGCTGGGTGG - Intronic
1097267858 12:57755963-57755985 CGGCGCCTAAGGAGGCTGGGCGG + Intronic
1100832772 12:98532940-98532962 ACTGCCCAAAGGAGGACGGGTGG - Exonic
1101579367 12:106028015-106028037 ACTTGCCTAAGGAGGGTGGCAGG - Intergenic
1105003028 12:132703437-132703459 GGTCCCCTAAGGAGTCAGGGTGG + Intronic
1105535838 13:21262130-21262152 TACCCCCTGAGGAGGCTGGGTGG - Intergenic
1106043027 13:26112009-26112031 ACTCCCCAGAGTACGCTGGGAGG - Intergenic
1106043326 13:26114877-26114899 ACTGCCATAAAGAGGCTGTGAGG - Intergenic
1108354770 13:49620362-49620384 TCTCCACTAAGGCTGCTGGGTGG + Intergenic
1115357182 14:32460932-32460954 ACAGTGCTAAGGAGGCTGGGAGG + Intronic
1118926997 14:70200068-70200090 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1119622332 14:76140431-76140453 ACTCTACTCAGGAGGCTGAGGGG + Intergenic
1122217245 14:100212593-100212615 ACCCCCCTCAGGAGCCTGGTCGG + Intergenic
1122920762 14:104879045-104879067 ACTCCCAAAAAGATGCTGGGGGG - Intronic
1122941051 14:104981543-104981565 ACCCCCAGAAGGAGGGTGGGAGG - Intergenic
1123056802 14:105574685-105574707 AGCCCCCCAAGGAGGCTGGAGGG + Intergenic
1123081408 14:105697100-105697122 AGCCCCCCAAGGAGGCTGGAGGG - Intergenic
1125608697 15:40956813-40956835 GCTGCCCCAAGGAGGCTGGCAGG + Intergenic
1126145988 15:45473297-45473319 AGCCTCCTAAGGAGGCTGGGTGG - Intergenic
1126355842 15:47795221-47795243 ACTCATCTAATGAGGCTGGTTGG + Intergenic
1128235866 15:66066673-66066695 ACACCCCTAGGGGGGCTGGGAGG + Intronic
1128857499 15:71031771-71031793 ACAGTGCTAAGGAGGCTGGGAGG - Intronic
1130012177 15:80160443-80160465 ACTCACCTATGGTGGCTGGAAGG - Exonic
1131083191 15:89554239-89554261 GCTCCCATGAGGAGACTGGGCGG + Intergenic
1132425184 15:101710034-101710056 TTTCCCCTAAGGAGGCAGGTGGG - Intronic
1132514329 16:359285-359307 ACTCCCCTCAGGACACTGGGAGG - Intergenic
1134801153 16:17085972-17085994 AATGAGCTAAGGAGGCTGGGGGG - Intergenic
1134834627 16:17350616-17350638 TCTCCCATAAGGAGGCTGACGGG + Intronic
1136576418 16:31127892-31127914 ACTTTCCTAAGGCTGCTGGGAGG + Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141615125 16:85206081-85206103 ACTTCCCTGGGGAGGCCGGGAGG + Intergenic
1141739186 16:85879272-85879294 ACTCCCATCTGGAGGCTGTGGGG + Intergenic
1144012555 17:11163573-11163595 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1144206322 17:12982113-12982135 ACTGGCATTAGGAGGCTGGGTGG - Intronic
1147359227 17:39920863-39920885 AATCCCCCAAGGGGGCTGTGAGG - Intergenic
1148438098 17:47697551-47697573 ACTGCCCTTGGGAGGCTGTGAGG + Intronic
1148645420 17:49217442-49217464 ACATCCCTAGGGATGCTGGGAGG - Intronic
1150007056 17:61476504-61476526 AGTCACCTAAAGGGGCTGGGAGG + Intronic
1151348836 17:73519584-73519606 ACTCCCCTAAGGAGGCTGGGAGG - Intronic
1153872002 18:9330411-9330433 ATTCCCCTAACAAGGCAGGGAGG + Intergenic
1156520278 18:37716448-37716470 ACTGTGCTAAGGAGGCTGGAGGG + Intergenic
1160969693 19:1762107-1762129 ACTCCCCTAAGTGGGGTGCGGGG + Intronic
1160983308 19:1826562-1826584 ATTCCCCTGAGGTGGGTGGGTGG + Intronic
1161397326 19:4051777-4051799 ACTCCCCAGATGAGCCTGGGAGG + Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1161990325 19:7681001-7681023 GCCCCCCTCAGGAGGCTGCGAGG + Intronic
1165475413 19:36027318-36027340 GCTCCCCTACTGAGGCTGGAAGG - Intronic
1167239428 19:48334296-48334318 ACTCCCCTGAGGAGGCGGGGAGG + Intronic
926226904 2:10973224-10973246 ACCCACCTTAGGGGGCTGGGTGG + Intergenic
927513256 2:23657787-23657809 CCTCGCCTAAGAAGGCTGGTTGG + Intronic
928125195 2:28610782-28610804 ACTCACATCAGGAGGCTGGCTGG + Intronic
932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG + Intergenic
934773240 2:96921321-96921343 ACTCCCCTGTGCGGGCTGGGTGG - Intronic
937845890 2:126578524-126578546 ACTCCTCTAAGGATGCAGGGAGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
938969454 2:136418824-136418846 ACTCACCTAAGGGAGCTGGCGGG - Intergenic
939470678 2:142616053-142616075 ACAGCACTAAGGAGACTGGGTGG + Intergenic
939808906 2:146807947-146807969 CCTCCCCTAAGGAGTTTGGTAGG - Intergenic
942609236 2:177725487-177725509 ATTTCTCTAAGGAGGGTGGGTGG - Intronic
943836888 2:192525160-192525182 TCTCCCCTCAGGAGGCACGGGGG - Intergenic
944270559 2:197780928-197780950 CCTCCCCTATGTGGGCTGGGGGG + Intronic
945210875 2:207380966-207380988 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
947593539 2:231397647-231397669 GCCCCCCTTGGGAGGCTGGGTGG - Intronic
948082230 2:235215795-235215817 CATCCCCCATGGAGGCTGGGAGG + Intergenic
948907505 2:240986817-240986839 ACTCCCAGAAGGGGGCTGTGAGG - Intronic
1169903439 20:10575843-10575865 ACACCCATAAGGAAGCTGGAAGG + Intronic
1170089752 20:12577757-12577779 ACTCACCTGAGGTGGGTGGGTGG - Intergenic
1171982693 20:31638640-31638662 GCTCCCCAGAGGAAGCTGGGTGG - Intronic
1172632208 20:36386073-36386095 CCTCCGCTGAGGAGGCTGGCTGG - Intronic
1172808370 20:37629581-37629603 ACTGCTTTAAGGAGGCTGAGAGG + Intergenic
1172849102 20:37947762-37947784 ATCCCTCTAAGGAGGTTGGGGGG - Intergenic
1173072040 20:39777534-39777556 CCTCTCATAAGGAGGCTGTGAGG - Intergenic
1175654079 20:60753437-60753459 ATTCACCTAAGGAGTCTGGAGGG - Intergenic
1175902019 20:62363706-62363728 GCCCCCCAAGGGAGGCTGGGCGG - Intronic
1177853607 21:26377397-26377419 ACTCCCTGAATGAGCCTGGGTGG - Intergenic
1179631238 21:42679991-42680013 ACTGTCGTAAGGAGGCTGAGAGG + Intronic
1179938242 21:44618881-44618903 ACACCCCTAAAAAGCCTGGGAGG + Intronic
1181625764 22:24121163-24121185 ATTCCACTGAGGATGCTGGGGGG - Intronic
1183099492 22:35575178-35575200 GCTCCCCTCTGGAGGCTGAGAGG - Intergenic
1184383236 22:44159597-44159619 ACTCTCCTTCGGAGGATGGGAGG + Intronic
1185176050 22:49327603-49327625 ACTCCCCAGGGGAGGCTGGAGGG + Intergenic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
950460121 3:13116141-13116163 ACTGCCCTCAGGGAGCTGGGAGG - Intergenic
953863485 3:46564616-46564638 ACTCCCACTGGGAGGCTGGGAGG + Intronic
953908799 3:46881861-46881883 AATCCCCTGAGGAGGCTGCCCGG - Intronic
954163440 3:48738369-48738391 AATTCCCTAAGGAGGGAGGGAGG + Intronic
954326174 3:49865377-49865399 AGTCTCCCAAGAAGGCTGGGAGG + Intronic
961478532 3:127164271-127164293 ACTCCCCTGAGGAGGGAGAGTGG - Intergenic
962491333 3:135896858-135896880 ACAGCCCTCAGGATGCTGGGGGG - Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
965801282 3:172496688-172496710 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
968043907 3:195612741-195612763 ACTCCCCAGAAGAGGCTGAGGGG - Intergenic
968511112 4:996353-996375 TCTCCCTAAAGGAGGCAGGGAGG + Intronic
969070326 4:4532124-4532146 ACTCCCCCAAGGAAGAGGGGAGG + Intronic
970654362 4:18214819-18214841 ACTCCCCTAAGGTGCCTGCTTGG + Intergenic
970679391 4:18489531-18489553 ATAGCGCTAAGGAGGCTGGGAGG + Intergenic
971576242 4:28279228-28279250 AGTCCACTCAGGTGGCTGGGAGG - Intergenic
971998811 4:34001834-34001856 GCTCACTTAAGAAGGCTGGGGGG - Intergenic
973005375 4:44998899-44998921 GCTCTCCCAAGGAGACTGGGAGG + Intergenic
979119750 4:116883178-116883200 ACAGTCCTAAGGAGGCTTGGAGG - Intergenic
982573154 4:157075950-157075972 AGTCCCCTAAGGAGTGAGGGGGG + Intergenic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
987010272 5:13755993-13756015 GCTCCCCTCAACAGGCTGGGGGG - Intronic
988021466 5:25627307-25627329 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
990946704 5:61256692-61256714 ACTCCCCTTGCCAGGCTGGGTGG - Intergenic
993025815 5:82644747-82644769 ACTTCACTAAGGATGCTGTGTGG + Intergenic
995358085 5:111262367-111262389 ACTCTCCTACAGAGGCTGAGAGG + Intronic
998161242 5:139814098-139814120 AGGCCCCAGAGGAGGCTGGGAGG - Intronic
998513800 5:142735307-142735329 CCTCCCCTAAGGAGCTGGGGAGG - Intergenic
1001433998 5:171685513-171685535 ACTCCCCCACGGGTGCTGGGCGG - Intergenic
1004086936 6:12458771-12458793 ACTCCTCTCAGCAGGCTTGGAGG + Intergenic
1005378289 6:25207588-25207610 ACACTGCTAAGGAGGCTGGGAGG + Intergenic
1006805819 6:36788354-36788376 ACTGCCCTCAGCAGGCAGGGTGG - Intronic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1013814641 6:114083364-114083386 ACCCTCCCAAGGAGCCTGGGAGG + Intronic
1013910173 6:115266538-115266560 CCTCACCTAAGGAGGTTGAGTGG - Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1015624871 6:135170467-135170489 AGTCACCAAAGAAGGCTGGGAGG + Intergenic
1019178847 6:170175136-170175158 ATTCCTCGAGGGAGGCTGGGGGG - Intergenic
1019340678 7:507471-507493 GGCCCCCTGAGGAGGCTGGGTGG - Intronic
1020021646 7:4872823-4872845 ACTCCCCTACAGAGTCTGGTGGG - Intronic
1022400966 7:30036998-30037020 ACTCCCCTAGAGAAGCTGAGTGG + Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1023819086 7:43970449-43970471 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023819135 7:43970713-43970735 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023895221 7:44427482-44427504 ACTCCCTCAAGGATGCTGGTGGG + Intronic
1026969034 7:74456798-74456820 TTTCCCCTGAGGAGGCTGGGGGG + Intronic
1027847603 7:83402277-83402299 ACTCCTCTGAAGAGGCTGAGAGG + Intronic
1029744139 7:102507408-102507430 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029744186 7:102507676-102507698 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762130 7:102606571-102606593 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762177 7:102606838-102606860 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1038336906 8:26652947-26652969 AATCCCCTAAGCATGCTGTGAGG - Intronic
1038668510 8:29562608-29562630 ACTCACCTAAGGACACTTGGGGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1043303346 8:78762464-78762486 ACTGCCCTGAGGAGGCGGGGAGG - Intronic
1044610646 8:94088619-94088641 ACGCGGTTAAGGAGGCTGGGAGG - Intergenic
1046939878 8:119920747-119920769 AATCCCCTCAGGGGGCTGAGTGG - Intronic
1047732480 8:127738111-127738133 TATCCCCTAAAGCGGCTGGGTGG - Intronic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1049791803 8:144475685-144475707 CCTCCTCTTAGGGGGCTGGGAGG + Exonic
1051336342 9:16069851-16069873 ACTCCCCTTAGGAATCTGAGTGG - Intergenic
1051451725 9:17204963-17204985 ACAGTGCTAAGGAGGCTGGGAGG - Intronic
1058128553 9:101224080-101224102 GCTCCCCTAGGGAGGCTTGAGGG - Intronic
1059419594 9:114182859-114182881 ACTCCCAAAAGTAGGCTGAGTGG + Intronic
1060729810 9:126030155-126030177 TGCCCCCAAAGGAGGCTGGGAGG - Intergenic
1061303423 9:129719214-129719236 ACTCACCTGCGGAGGTTGGGGGG - Exonic
1061811497 9:133164759-133164781 ACACCCCTGAGGGGCCTGGGAGG - Intergenic
1186194656 X:7098686-7098708 GCTCCCCTTAGGTGGCTGAGGGG - Intronic
1186774836 X:12854543-12854565 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1187253638 X:17622038-17622060 AAGGCCCTGAGGAGGCTGGGTGG + Intronic
1190966400 X:55305495-55305517 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1191094330 X:56658929-56658951 ACTGTGCTAAGGAGGCTGGGAGG - Intergenic
1191132610 X:57030798-57030820 ACTGTGCTAAAGAGGCTGGGAGG - Intergenic
1191972986 X:66838265-66838287 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1192701763 X:73482102-73482124 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1192707427 X:73541251-73541273 ACAGTACTAAGGAGGCTGGGAGG + Intergenic
1192792784 X:74399586-74399608 ACTGCCCTGAAGAGGCGGGGAGG - Intergenic
1192916038 X:75652251-75652273 ACAGCGCTAAGGAGACTGGGAGG - Intergenic
1192933950 X:75839038-75839060 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1193065504 X:77254993-77255015 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1193382151 X:80827947-80827969 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1193514406 X:82445956-82445978 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic
1194315274 X:92369290-92369312 ACAGTGCTAAGGAGGCTGGGAGG - Intronic
1195469050 X:105212327-105212349 ACAGTGCTAAGGAGGCTGGGAGG + Intronic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1198784461 X:140272676-140272698 ACAGTGCTAAGGAGGCTGGGAGG - Intergenic
1200208689 X:154335741-154335763 ACTCCACTAAGGATGCATGGAGG + Intergenic
1200623325 Y:5480825-5480847 ACAGTGCTAAGGAGGCTGGGAGG - Intronic
1201946399 Y:19515155-19515177 ACAGTGCTAAGGAGGCTGGGAGG + Intergenic