ID: 1151349680

View in Genome Browser
Species Human (GRCh38)
Location 17:73524413-73524435
Sequence TGCCCTTCCCCTGGTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 306}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151349672_1151349680 1 Left 1151349672 17:73524389-73524411 CCTCTTTCCCAGAACTAAAATTC 0: 1
1: 1
2: 0
3: 30
4: 268
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349670_1151349680 3 Left 1151349670 17:73524387-73524409 CCCCTCTTTCCCAGAACTAAAAT 0: 1
1: 0
2: 2
3: 21
4: 289
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349666_1151349680 30 Left 1151349666 17:73524360-73524382 CCATTCACCCTTCTTTTTCTGTT 0: 1
1: 0
2: 7
3: 137
4: 1392
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349674_1151349680 -7 Left 1151349674 17:73524397-73524419 CCAGAACTAAAATTCCTGCCCTT 0: 1
1: 0
2: 1
3: 21
4: 220
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349667_1151349680 23 Left 1151349667 17:73524367-73524389 CCCTTCTTTTTCTGTTGCCTCCC 0: 1
1: 0
2: 5
3: 92
4: 905
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349668_1151349680 22 Left 1151349668 17:73524368-73524390 CCTTCTTTTTCTGTTGCCTCCCC 0: 1
1: 0
2: 4
3: 63
4: 680
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349669_1151349680 6 Left 1151349669 17:73524384-73524406 CCTCCCCTCTTTCCCAGAACTAA 0: 1
1: 0
2: 0
3: 18
4: 279
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349671_1151349680 2 Left 1151349671 17:73524388-73524410 CCCTCTTTCCCAGAACTAAAATT 0: 1
1: 1
2: 1
3: 39
4: 505
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1151349673_1151349680 -6 Left 1151349673 17:73524396-73524418 CCCAGAACTAAAATTCCTGCCCT 0: 1
1: 0
2: 1
3: 9
4: 215
Right 1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151349680 Original CRISPR TGCCCTTCCCCTGGTGGGCT GGG Intronic
900167758 1:1250651-1250673 TGCCCTCACCCTGGGAGGCTGGG + Intergenic
900516629 1:3085284-3085306 TGGCCTTCGCTTGCTGGGCTGGG + Intronic
900608873 1:3536056-3536078 TGGCCGTCCTCTGGTGGCCTCGG + Intronic
901504568 1:9676463-9676485 GGCCCTTCCCCAGTTGGCCTGGG + Intronic
901522229 1:9793904-9793926 AGAGCTTCCCCTGGTGGGCCAGG + Intronic
902297257 1:15476194-15476216 TTCCCATCCCCTGGTGGGGCTGG + Intronic
902714354 1:18262190-18262212 TCCCCATCCCTTTGTGGGCTGGG - Intronic
902838649 1:19061893-19061915 AGCCCTTCCCCTGGTGCTCCTGG - Intergenic
903013679 1:20348276-20348298 TGCCCCTCCACTGTTGGGCCAGG - Exonic
903176856 1:21586590-21586612 GGCCCGTCCCCTGCTTGGCTGGG - Intergenic
903370204 1:22830357-22830379 GGCCCTTTCCCTGGTGCGCATGG - Intronic
903461539 1:23524413-23524435 TGCACTTCCCCTTGGGGGTTGGG + Exonic
903671968 1:25041437-25041459 TGCATTGCCCCTGGTGGGCTGGG + Intergenic
903857051 1:26343744-26343766 TTCCCTGCCCCTGGAGGGGTGGG - Exonic
904290681 1:29484027-29484049 TCTCCTTCCCCTGGTGGGCTGGG + Intergenic
904962778 1:34347829-34347851 TCCCCTGCCCATGGTGGGCAAGG + Intergenic
905183442 1:36179925-36179947 AGCCATTCTCCTGGTGTGCTGGG - Exonic
906523227 1:46479380-46479402 AGCCCTTCCCCTCCTGAGCTGGG - Intergenic
906746633 1:48226470-48226492 TCCCCATCCTCTGGTGGGCCAGG + Intronic
911187190 1:94915915-94915937 TTCCCTTCCCCTTCTGAGCTGGG + Intronic
911364860 1:96925822-96925844 ACCTCTTCCCCTGGTGGGTTGGG - Intergenic
912853327 1:113145763-113145785 TGCCCTTGCCCATGTGGCCTTGG - Intergenic
915743792 1:158140754-158140776 TGTCCTGCCCATGGTGGGATTGG - Intergenic
917490373 1:175493503-175493525 TGACCTTCTCCTGGTGAGCGTGG - Intronic
919958291 1:202439799-202439821 TCCCCTTCTCCTGCTGGGCTAGG + Intronic
920945708 1:210526424-210526446 TGCGCTCCCCCTGTTGAGCTAGG - Intronic
924586754 1:245367217-245367239 TGACCTTGGCCTGGTGGGTTGGG - Exonic
1063208536 10:3857504-3857526 TGGCCTTCCCTTTGTGGGCATGG - Intergenic
1064091996 10:12393669-12393691 TGTCTTCCCCCAGGTGGGCTGGG - Intronic
1064520017 10:16191023-16191045 TGCCCTACCCCAGGTGGAATTGG - Intergenic
1065888464 10:30100034-30100056 TGTCCTTCCCCTGTTGGCCAGGG - Intronic
1066312217 10:34208468-34208490 TGGCATTCCCCTGGTGGTCCTGG - Intronic
1067851365 10:49756766-49756788 TGCCCCTCACCTGGTAGGCCCGG + Exonic
1069872967 10:71544403-71544425 TGCCCTCCCCCTGGTGAGGCTGG - Intronic
1071287124 10:84159198-84159220 TGCCCTTTCCTGGGTGTGCTAGG + Intergenic
1072726083 10:97815097-97815119 AGCCCTTCTTCTGATGGGCTGGG + Intergenic
1073462602 10:103675076-103675098 TGCCCTTGCACTGGAGGGCGAGG + Intronic
1076304532 10:129455236-129455258 CGCCCTTCCCCTGGAGTGCCAGG - Intergenic
1076343601 10:129766036-129766058 TTCCCTTCCCCTGGTGGGACTGG + Intronic
1076719706 10:132387693-132387715 TCCCCCTCCCCTGGTGGATTTGG + Intergenic
1077392868 11:2308099-2308121 TGCCCTGCCCCTGCTGGGCAGGG + Intronic
1077473588 11:2776196-2776218 TGCCCTCCCTCTGCAGGGCTGGG - Intronic
1078006791 11:7538193-7538215 TGCGCTCCTCCTTGTGGGCTGGG + Intronic
1078662360 11:13297653-13297675 TGCCCTTTCCCAAGTGTGCTAGG + Intronic
1079580873 11:22062888-22062910 TGCCCTTCCCTTTTTAGGCTTGG + Intergenic
1082004074 11:47410154-47410176 TGCCCTTGCCCTGGAGCTCTTGG + Exonic
1083252787 11:61478976-61478998 TTGCCTTCCCATGGGGGGCTGGG + Intronic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1083667569 11:64284277-64284299 GGCCCGTCCCCTGCGGGGCTGGG + Exonic
1083675090 11:64320768-64320790 TGCCTTCCGCCTTGTGGGCTCGG - Exonic
1083927178 11:65815062-65815084 TGCCCTTCCCCAGGTTGACTTGG + Intergenic
1084007670 11:66331911-66331933 TACCCTTCCCCTCATGGGCATGG - Intronic
1084203914 11:67579921-67579943 TGCCCTTCCCTTGGTGGCACTGG - Intergenic
1084399142 11:68933620-68933642 TGGCCTTGCCCTGGAGAGCTGGG + Intronic
1084757212 11:71247540-71247562 TGCCATGGCCCTGCTGGGCTGGG - Intronic
1085032508 11:73281342-73281364 TGGCTTTCCCAGGGTGGGCTTGG - Intronic
1085524878 11:77158264-77158286 TGCAGTTACCCTGGTGGGCAGGG - Exonic
1086801657 11:91183873-91183895 TGCTCTGCCCCTGGTTGGCTTGG + Intergenic
1088808644 11:113374267-113374289 TGTCCTCCCCCAGATGGGCTAGG + Intronic
1089141625 11:116289305-116289327 TTCCATTCTCCTGCTGGGCTAGG + Intergenic
1089280422 11:117370517-117370539 TCCCCATCCACTGGTGGGCCTGG - Intronic
1089330677 11:117686791-117686813 TGAGCTTCACCTGGTGGCCTGGG - Intronic
1090440157 11:126718751-126718773 TTCCCTGCCCCTGGTGAACTTGG - Intronic
1090893687 11:130950377-130950399 TGCCCAGTCCCTGGTGGGCAGGG - Intergenic
1091304904 11:134530629-134530651 TGACCTTTCCCTGGGAGGCTGGG - Intergenic
1092290412 12:7156882-7156904 CTCCCTTCTCCTGGTGGGCTTGG - Intronic
1092776687 12:11949941-11949963 TGCCCTTCCCCTGCAGGCCCAGG - Intergenic
1095117982 12:38379156-38379178 TTCCCTTCTTCTGCTGGGCTTGG + Intergenic
1096868562 12:54579137-54579159 TGCCCTTCTCGGGGTGGGGTAGG - Exonic
1097177608 12:57152386-57152408 TGCCCTTTACTTGGTGGGCACGG - Intronic
1097999432 12:65924074-65924096 TATCCTTCCCAAGGTGGGCTGGG - Intronic
1100384483 12:94092813-94092835 GGCCCTTGCCCTGGTGGCCTTGG + Intergenic
1101965848 12:109281492-109281514 AGCCCTTCCCATGGCGGGGTGGG + Exonic
1102277937 12:111598044-111598066 TTCCCTTCCCCAGGTGGGGGAGG + Intronic
1102981994 12:117249238-117249260 TGCCCTTCCACAGATGAGCTTGG - Intronic
1103517861 12:121518980-121519002 TGGCCTTCCCCAGGTGGGATGGG + Intronic
1103602819 12:122064915-122064937 TGGCCCTCCCCTGGTTGCCTTGG + Intergenic
1104192768 12:126499053-126499075 TGCAGTTCCCCTGGTTGGTTCGG + Intergenic
1105859205 13:24394770-24394792 GGCCCTTGCCCTCATGGGCTGGG + Intergenic
1106351025 13:28930793-28930815 TGTCCTCCCTCTGGTGTGCTGGG - Intronic
1107723985 13:43279058-43279080 TGACCTTGGCCTGTTGGGCTAGG + Intronic
1113292010 13:108917429-108917451 TGACCTTCACCTGCCGGGCTGGG - Intronic
1113901516 13:113800755-113800777 AGCCCTGCCCTTGGTGGGGTGGG + Intronic
1114051192 14:18920795-18920817 TGCACTGCCCGTGGTGGGGTTGG + Intergenic
1114111370 14:19481130-19481152 TGCACTGCCCGTGGTGGGGTTGG - Intergenic
1115717929 14:36126338-36126360 TGCCCTTCCTGGGATGGGCTAGG - Intergenic
1117745029 14:58860671-58860693 TGCCCCTCTGCTGGTGGGGTCGG + Intergenic
1118468909 14:66056818-66056840 GACCCTTCCTCTGGGGGGCTGGG - Intergenic
1119436176 14:74599401-74599423 TCCCCTTCCCCAGTTGGGGTGGG + Intronic
1119746972 14:77051593-77051615 TGCCCCTCCCCTGTTGAGCTGGG + Intergenic
1121029523 14:90646176-90646198 TGCCATTCCCCTGGCAGGCCTGG - Intronic
1121222831 14:92299368-92299390 TGACCTTCCCCTGTGGGGGTGGG + Intergenic
1122268226 14:100556622-100556644 TGCCCTTGCACTGTAGGGCTGGG - Intronic
1122379115 14:101288822-101288844 TTCCCTCCCCCTGGTGGACTCGG + Intergenic
1122703460 14:103605704-103605726 TCCCCTGTCCCTGGTGGTCTGGG + Intronic
1122817329 14:104320154-104320176 TGCCCTCACCCTAGGGGGCTGGG - Intergenic
1122854557 14:104553994-104554016 TCCCCTCCCCGTGGTGTGCTTGG + Intronic
1122983098 14:105200357-105200379 ACCCCTCCCCTTGGTGGGCTGGG + Intergenic
1124971896 15:34496313-34496335 TGCCCAGCTCCTGGGGGGCTGGG - Intergenic
1125205689 15:37151504-37151526 TGTCTTGCCCCTGGTGGCCTAGG - Intergenic
1125575419 15:40752106-40752128 TGTCCTTCCCGTGGAAGGCTGGG + Exonic
1128804802 15:70522742-70522764 TGCCCCTCCCCTGTTGGGTATGG - Intergenic
1128866862 15:71120713-71120735 TGACCTGCTCCAGGTGGGCTTGG + Intronic
1129167482 15:73786945-73786967 GGCACATCCCCTGGCGGGCTGGG + Intergenic
1129394481 15:75236486-75236508 TGCCCAACCCCTGCTGGGCCTGG + Intergenic
1132726781 16:1342338-1342360 TGCCCTGCCCCTTGAAGGCTGGG - Intronic
1132850056 16:2020841-2020863 GGCGCTTCCCCTGGTCGGCGAGG - Intergenic
1133018657 16:2956281-2956303 TGCCCTGCCCTGGCTGGGCTGGG - Intergenic
1133233403 16:4376825-4376847 TGCCCTTCACCCTGGGGGCTGGG - Intronic
1133303578 16:4797115-4797137 TCCCCTCCCCCTGGAGGGCATGG - Exonic
1134456549 16:14399538-14399560 TGCCCTGCCCTTGGTGTCCTGGG + Intergenic
1138379651 16:56591034-56591056 TCCCCTTCCCCTGCTGACCTTGG + Exonic
1139671373 16:68494025-68494047 TGCCCATCCCCTGGGATGCTGGG - Intergenic
1139950124 16:70664499-70664521 TGTGCTCACCCTGGTGGGCTGGG - Intronic
1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG + Intronic
1141564968 16:84895221-84895243 AGCTCTGCCCCTGGTAGGCTGGG - Intronic
1142039258 16:87882073-87882095 TGCCCATTTCCAGGTGGGCTTGG - Exonic
1142109404 16:88323257-88323279 TGCCATGCCCCTGGGAGGCTGGG + Intergenic
1142151162 16:88513095-88513117 TCCCCTGCCCCTGCAGGGCTTGG - Intronic
1142220925 16:88854569-88854591 TGCCCCTCCCCCAGTGTGCTTGG + Intronic
1142499859 17:326195-326217 TCCCCTTCGCCAGGAGGGCTCGG - Intronic
1143527663 17:7481924-7481946 TGCCCTGCCCCAGGTCGCCTGGG + Intronic
1144793667 17:17876721-17876743 TGCCCTCCCACTGATGAGCTGGG - Intronic
1144826025 17:18106160-18106182 TGACCTTCCCCTGGTGGCTTTGG + Intronic
1145056750 17:19708072-19708094 TTCACCTCTCCTGGTGGGCTTGG + Intronic
1146059527 17:29597074-29597096 TGCCTTCCTCCTCGTGGGCTGGG + Intronic
1147257985 17:39193528-39193550 TGCCCGTTCCCTTGGGGGCTCGG + Intronic
1147370486 17:39989255-39989277 TGCCTTTCCTCTGGTGTGCCCGG + Intronic
1147519932 17:41160912-41160934 TTTCCTTCCCCTGGTGTGTTAGG + Intergenic
1147862777 17:43533292-43533314 TCCCCTGCCCCTGGTGCCCTTGG - Exonic
1148091538 17:45025179-45025201 TGCAGTTCCCCTGGGGGCCTGGG + Intronic
1148713586 17:49699652-49699674 TGTCCTACCCAGGGTGGGCTAGG - Intergenic
1149460899 17:56829501-56829523 CTCCCTTCCCCAGGAGGGCTTGG + Intronic
1149470293 17:56910812-56910834 TGCCCTTAGCCTCGGGGGCTGGG - Intronic
1149683571 17:58521890-58521912 AGCCCTGCCCCTGGTGCTCTTGG + Intronic
1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG + Intronic
1151816068 17:76472043-76472065 TGCCCCGCCCCAGGTGGGCCCGG - Exonic
1152284485 17:79404280-79404302 AGCCAGGCCCCTGGTGGGCTGGG - Intronic
1152291108 17:79440764-79440786 GGCCCTTCCTCTGGTGGGGAGGG - Intronic
1152914211 17:83024602-83024624 TCCTCTTCTCCTGGTGGGGTTGG - Intronic
1157113420 18:44842248-44842270 AGCCTTTCCCCAGGAGGGCTGGG + Intronic
1157292437 18:46419650-46419672 TGGCCTTCCCCAGGTAGGCCTGG - Intronic
1159080002 18:63726117-63726139 TACCATTCCCCGGGTGGTCTGGG + Intronic
1159085217 18:63782483-63782505 TGCCCTGGCCCTGGTCCGCTTGG + Exonic
1160888791 19:1365911-1365933 TGCCCCTCCCCGTGTGGCCTGGG + Intronic
1161408390 19:4102888-4102910 TCCCCTTCCCTTCGTGTGCTGGG - Intronic
1161650236 19:5479938-5479960 TGCCCTTCCCTGGGTTGGGTGGG - Intergenic
1161707815 19:5830201-5830223 TTCCAATTCCCTGGTGGGCTGGG - Intergenic
1162054506 19:8054460-8054482 TTCCCTGCTCCTGCTGGGCTGGG + Intronic
1162806076 19:13138695-13138717 GCCCCCTCCCCTGGTGGGCCTGG - Exonic
1162914275 19:13865721-13865743 TGCCCTCCCCCTGGCGGCCCCGG - Intronic
1163447055 19:17353034-17353056 TGCCCTCCCCCTCCTGGGCCTGG + Intronic
1164629049 19:29749200-29749222 TGTCCTTCTCCAGGTGGGTTTGG + Intergenic
1164693065 19:30225460-30225482 CGCCCTGCCCCGGCTGGGCTGGG + Intergenic
1165022138 19:32934049-32934071 TGCCCCTCAGCTGTTGGGCTAGG - Intronic
1166510652 19:43406639-43406661 AGCGCTGCCCCTGGTGAGCTTGG - Intronic
1166548201 19:43647286-43647308 TGCACTTCCCCTGATGTGCTGGG - Intronic
1166840433 19:45693587-45693609 TTCCCATTCCCTGGAGGGCTAGG - Intronic
925636009 2:5941954-5941976 CGTCCTTCCCGTGGTGGGGTAGG - Intergenic
926141426 2:10370757-10370779 TGCCCTGCTCCTGGGGGTCTTGG + Intronic
926249220 2:11144130-11144152 TGGCCTTCCCCAGGTGGGTGTGG + Exonic
927930298 2:27039551-27039573 TGCCCTTCTCCTGCTGGGCCAGG - Intronic
928367026 2:30710649-30710671 TGACCTTCCCATGGGGCGCTGGG + Intergenic
929779989 2:44951396-44951418 ACCCATTCCCCTTGTGGGCTGGG + Intergenic
929863673 2:45700030-45700052 CTGCCTTCCACTGGTGGGCTGGG - Intronic
930026172 2:47030373-47030395 AGCCCTGCCTCTGATGGGCTGGG - Intronic
931282620 2:60807566-60807588 CGCCCTTCACCTGGTGACCTTGG - Intergenic
931449402 2:62355649-62355671 TGCCCTTCCCCTTCTGACCTGGG - Intergenic
933639181 2:84741173-84741195 TCCCCTTTCCCTGCTTGGCTGGG + Intronic
936041361 2:109152332-109152354 TGCCCTTTCCCTGGTGCATTTGG + Intronic
936264697 2:110994568-110994590 AACCCTTCCCCTGGTTGTCTAGG + Intronic
936849132 2:116874233-116874255 TGCCCCTCCCCTTGGGAGCTCGG + Intergenic
937301581 2:120846029-120846051 TGCCTTTCCCCAGGTCAGCTGGG + Intronic
937568963 2:123333593-123333615 TCCTCTTCCCCTGGTTGGCTTGG - Intergenic
937872741 2:126797784-126797806 GGCGCTTGCCCTGGAGGGCTTGG - Intergenic
937890245 2:126933240-126933262 GGCCCCTTCCCTGGTGGGCCGGG + Intergenic
937896493 2:126980173-126980195 TGCACTTCCCTTGATGGGCTTGG + Intergenic
938336984 2:130509431-130509453 GGCCCTTCCTCGGGTGGGCGTGG - Exonic
938352857 2:130611315-130611337 GGCCCTTCCTCGGGTGGGCGTGG + Intergenic
941560773 2:167041108-167041130 TGCTCTAACCCTGGAGGGCTGGG - Intronic
941644756 2:168028059-168028081 TGCCCTTCACCTGGCAGGCATGG - Intronic
942303669 2:174586125-174586147 TGCCCTCTCCCTGGAGGACTAGG - Intronic
944877000 2:203972446-203972468 TGCCCTACCCCTGGTGTGACTGG + Intergenic
947740017 2:232480708-232480730 TGCCTTTGCCCAGGTGGGCTGGG - Exonic
947911994 2:233807699-233807721 TGCCCTCACCCTGGCTGGCTGGG + Intronic
948002769 2:234581771-234581793 TGAGCTTCCCCTGCTGGACTTGG - Intergenic
948407998 2:237737098-237737120 TGCCCTGCCCCTGGAGGACCAGG + Intronic
948835445 2:240624034-240624056 GGCCCTGGCTCTGGTGGGCTGGG + Intronic
948900632 2:240955297-240955319 TGCCCTCCCCCAGATGGGCCTGG + Intronic
1169264982 20:4162096-4162118 TGCCCTTCCCCAGGGTGCCTCGG + Intronic
1172390066 20:34559982-34560004 TGCCTCTACCGTGGTGGGCTGGG + Exonic
1172397801 20:34621900-34621922 TCAGCTTCCCCTGATGGGCTAGG - Intronic
1173049961 20:39549867-39549889 TGCCCCTCCTCTGGGGAGCTGGG - Intergenic
1173465656 20:43279080-43279102 TGTCCTGCCCCTGGGGGCCTGGG - Intergenic
1173790296 20:45823889-45823911 TGTCCTTGGCCTTGTGGGCTGGG - Intronic
1174343020 20:49909723-49909745 TGCCCCTGCCCTCGTGGCCTCGG - Intronic
1174448781 20:50607702-50607724 TGCCCTCTCCCTCGTGAGCTGGG - Intronic
1174544365 20:51314310-51314332 TCCCCATTCCCAGGTGGGCTTGG + Intergenic
1175833841 20:61981207-61981229 TCCCTTTGCCCTGGTGGCCTTGG - Intronic
1175929364 20:62486388-62486410 TGGCCTCCCCCTGGGGGGGTGGG - Intergenic
1175953017 20:62593548-62593570 GGCCCTGCTCCTGGTGGGATTGG + Intergenic
1176065791 20:63193913-63193935 CTCCCTTCCCCTGGTAGGCCTGG + Intergenic
1178704008 21:34858087-34858109 TGGCCTGCCCCTGGTGGGCATGG + Intronic
1178971529 21:37182274-37182296 TACCGTTCCCCTGGAGGGTTTGG - Intronic
1179361680 21:40715045-40715067 TGACCTTCACCTGATGGCCTTGG + Intronic
1180469667 22:15643170-15643192 TGCACTGCCCGTGGTGGGGTTGG + Intergenic
1180859449 22:19068974-19068996 TGCCCTTCACCTTGTGAGATGGG - Intronic
1181052538 22:20244570-20244592 GGCCCCTCCCTGGGTGGGCTGGG + Intronic
1181163866 22:20973386-20973408 TGCCATTGCCCTGGTAGGCCCGG - Exonic
1181278023 22:21699021-21699043 TGCCGCTGCCCTGGTGGGCATGG - Exonic
1182835039 22:33334944-33334966 TCTCCTTCCCCTGGGGGGATCGG - Intronic
1183030205 22:35098123-35098145 TGTCCTTCCCATGGAGAGCTGGG + Intergenic
1183379720 22:37484839-37484861 TGCCCCTCCCCAGGAGGGCCTGG + Intronic
1183641645 22:39096415-39096437 TGCCACTCCCCTGGTGGACAGGG - Intergenic
1183956444 22:41382873-41382895 GGCCCTTCGCCTGGTTGGTTGGG + Intronic
1184386983 22:44182016-44182038 CTCCCTTCCCCGGGTGGCCTGGG - Intronic
1184510956 22:44932827-44932849 GGCCCTTCCTCTGGAGGGCCAGG - Intronic
1184533559 22:45071648-45071670 TTCCCTTGTCCTGGTGGGCTGGG + Intergenic
1185015506 22:48340347-48340369 TGGGCTTCACCTGGAGGGCTTGG + Intergenic
1185321369 22:50201578-50201600 CGCCCTTCTCCAGGTGGGCCGGG + Exonic
949399812 3:3654209-3654231 TGCCCTTCCCATGGTGGCCTAGG - Intergenic
950848262 3:16035678-16035700 TGCCTCTCCCCTGGAGTGCTAGG - Intergenic
953020513 3:39110165-39110187 TTTCCTTCCCCTGGTGGGTCAGG - Intronic
954139969 3:48599820-48599842 TGCCTTTCCTCTTTTGGGCTGGG - Intronic
954450477 3:50568957-50568979 GGCCGACCCCCTGGTGGGCTCGG + Intronic
956004275 3:64762132-64762154 TGACCTTGCCCTGGTGGCCTGGG + Intergenic
957083454 3:75658438-75658460 TCCCCTGCCCCTGGGGGGGTGGG - Intergenic
959609618 3:108278642-108278664 AGTCCTTCCCCTGGAGGCCTAGG - Intergenic
961058407 3:123808202-123808224 TGCCCTGCCCCTGGTGAGAATGG - Intronic
961121563 3:124375481-124375503 TCCCCATTCCTTGGTGGGCTAGG + Intronic
961372760 3:126441389-126441411 TGCCCTTCTTCTGCAGGGCTGGG - Intronic
966330703 3:178809628-178809650 TACTTTTCCCCTTGTGGGCTTGG - Intronic
966971918 3:185052084-185052106 GGCCCCGCCTCTGGTGGGCTTGG + Exonic
968626070 4:1627213-1627235 TTCCCTTCTCCTGCTGGGCTGGG - Intronic
969490764 4:7498102-7498124 TGCCCTTCCACTGGGGGGCCAGG + Intronic
969601946 4:8181970-8181992 AGCCCTTCCCAGGGTGGGGTGGG + Intergenic
969611194 4:8228574-8228596 AGCCCTTGCCCTGCTGGGCCGGG - Exonic
970925535 4:21447334-21447356 TGCACTTCCTCTGGAGGCCTGGG - Intronic
980387183 4:132101425-132101447 TGCTCTTTCTCTGGTGTGCTGGG - Intergenic
981315684 4:143337390-143337412 GCCCCTACCCCTGGCGGGCTCGG + Intronic
981401886 4:144322591-144322613 TGCTCTTACCCTAGGGGGCTGGG - Intergenic
982014713 4:151141965-151141987 TGCCCTTCACCTGCTAGGCTGGG - Intronic
983936754 4:173507902-173507924 GGCCCCTCCGCTGGTGGGCCTGG + Intergenic
985683338 5:1268489-1268511 TCCTCTTCCCCAGGGGGGCTTGG - Intronic
990462298 5:56040596-56040618 TGCCCTTGCCCTCATGCGCTAGG + Intergenic
990616463 5:57513326-57513348 GGCCCTTCAGCTTGTGGGCTTGG - Intergenic
992619011 5:78574283-78574305 TGCCCTGCTGCTGGAGGGCTGGG - Intronic
995624890 5:114065359-114065381 TGCCCTTCCACTTTTGGACTTGG - Intergenic
996134235 5:119818976-119818998 TGCACTTCTCCTCATGGGCTAGG + Intergenic
996195811 5:120605808-120605830 TGCTCTTACCCTGGCAGGCTAGG + Intronic
998570199 5:143250228-143250250 TGCCCTTGCCCTGGTTGGGGTGG - Intergenic
1002789112 6:424803-424825 TACCCTTCCCGTGCTGGGCCTGG + Intergenic
1006437261 6:34032568-34032590 TGCTCTCTCCCTGGTGGCCTAGG - Intronic
1006451853 6:34109951-34109973 TGCCCTTCCCTTGGTGGTCTAGG + Intronic
1007056252 6:38888127-38888149 TGCCCTTTCCCGGATGGGCACGG - Intronic
1007110556 6:39311161-39311183 CCTCCTTGCCCTGGTGGGCTGGG - Intronic
1007268995 6:40621307-40621329 TCCCCATCCACAGGTGGGCTTGG - Intergenic
1009329162 6:62394129-62394151 TGCACTTAGCCTTGTGGGCTAGG - Intergenic
1011272539 6:85593916-85593938 GGCCGTTCCTCTGGTCGGCTGGG - Intronic
1016012969 6:139157898-139157920 TGCCCAACTCCTGGTGGGCTCGG + Intronic
1018847683 6:167566772-167566794 TGGCCCTTCCCTGGTGTGCTGGG + Intergenic
1018864622 6:167737108-167737130 TGCCCTCTGCCTGCTGGGCTGGG + Intergenic
1018966519 6:168494765-168494787 TGCCCTTCAGCTGCTGGGATGGG - Intronic
1019225458 6:170504095-170504117 TTCCCTTCCCCTGATGGGTGTGG - Intergenic
1020083602 7:5299035-5299057 TGCCGGTCACCTCGTGGGCTGGG - Exonic
1020254404 7:6494641-6494663 TGCCCTTCATATGGTGGTCTTGG + Intergenic
1021746453 7:23745701-23745723 TACCCTTCTGCTGGTGGGGTTGG + Intronic
1023400918 7:39792694-39792716 TGCCCATCTCCTGGCGGCCTTGG + Intergenic
1024648714 7:51388083-51388105 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025042732 7:55662314-55662336 GGCACTGCCCCTGGTGGGTTGGG - Intergenic
1025052659 7:55742908-55742930 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025053043 7:55744365-55744387 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025129942 7:56369915-56369937 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025130241 7:56371144-56371166 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025130561 7:56372442-56372464 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025130879 7:56373736-56373758 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025131198 7:56375031-56375053 TGCCCATCTCCTGGCGGCCTTGG - Intergenic
1025178238 7:56812552-56812574 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025178670 7:56814294-56814316 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025179108 7:56816084-56816106 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025179563 7:56817970-56817992 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025180013 7:56819808-56819830 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025180931 7:56823639-56823661 TGCCCAGCTCCTGGTGGCCTTGG - Intronic
1025181358 7:56825379-56825401 TGCCCAGCTCCTGGTGGCCTTGG - Intronic
1025181805 7:56827217-56827239 TGCCCAGCTCCTGGTGGCCTTGG - Intergenic
1025691009 7:63753424-63753446 TGCCCAGCTCCTGGTGGCCTTGG + Intergenic
1025724254 7:64043199-64043221 TGCCCTGACCCTGGTGGCCCTGG - Intronic
1025753328 7:64312109-64312131 TCCCCTGCCCCTGGTGGCCCTGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029788859 7:102821298-102821320 TGCCCTACCCCTGCAGGCCTGGG + Intronic
1034496244 7:151424601-151424623 TGCCCTGCCACATGTGGGCTGGG - Intergenic
1034902797 7:154917911-154917933 AGCCCTTCCCCATGTCGGCTGGG - Intergenic
1035646102 8:1222379-1222401 TGCTCTAACCCTGGGGGGCTAGG + Intergenic
1035704418 8:1664263-1664285 AGCCCTTCCCGTGGTGGCATGGG + Intronic
1036256386 8:7209969-7209991 TGCACTTCCCCAGGTCAGCTGGG + Intergenic
1036308436 8:7668554-7668576 TGCACTTCCCCAGGTCAGCTGGG + Intergenic
1036361099 8:8077523-8077545 TGCACTTCCCCAGGTCAGCTGGG - Intergenic
1036775892 8:11613085-11613107 TGCCCTTCCTCTCGCAGGCTAGG - Intergenic
1036897476 8:12647639-12647661 TGCACTTCCCCAGGTCAGCTGGG + Intergenic
1039680824 8:39734097-39734119 TGCCCTTCCCCTATTTGTCTTGG - Intergenic
1039816656 8:41100520-41100542 TGCCCTTTCCCAGGGAGGCTGGG + Intergenic
1040408502 8:47132827-47132849 GGCCTTTCCCCAGGTGGGCGTGG - Intergenic
1042944530 8:74142047-74142069 TGCTCTTCCCCAGGTAGTCTAGG - Intergenic
1045394627 8:101748529-101748551 CACCCTGCCCATGGTGGGCTTGG + Intronic
1047457111 8:125025094-125025116 TGCTCTTCCCCTTCTGGCCTTGG - Intronic
1049148595 8:141019953-141019975 TGGCCTTTGCCTGGTGGGCCTGG - Intergenic
1049424625 8:142532612-142532634 TGCTCCTCCCCTGCTGGCCTTGG + Intronic
1050552902 9:6763019-6763041 TACCCTTCCGCTGGTGGGGGGGG + Intronic
1050684185 9:8148148-8148170 TGCTCTCACCCTGGAGGGCTAGG - Intergenic
1053141980 9:35688236-35688258 AGCCCAACCCCTGGGGGGCTGGG + Intronic
1053449315 9:38179970-38179992 TGCCATTCCCCTGGTTGTTTGGG - Intergenic
1053596982 9:39572888-39572910 TTTCCTTTCCCTGCTGGGCTGGG + Intergenic
1053854958 9:42329548-42329570 TTTCCTTTCCCTGCTGGGCTGGG + Intergenic
1054569274 9:66792109-66792131 TTTCCTTTCCCTGCTGGGCTGGG - Intergenic
1057526531 9:95808017-95808039 TGCCCTGCAGCTGTTGGGCTGGG - Intergenic
1059413638 9:114149794-114149816 TGCCCTCCCAATGGTGGCCTGGG + Intergenic
1060186423 9:121566758-121566780 AACCCCTCCCCTGGGGGGCTGGG + Intergenic
1060513213 9:124249127-124249149 AGCCCTGGCCCTGGTTGGCTGGG - Intergenic
1061193512 9:129095342-129095364 GGCCCATCCCAGGGTGGGCTTGG + Exonic
1061235617 9:129341224-129341246 TGCCGTTCCCCGGGGAGGCTTGG - Intergenic
1062373495 9:136252082-136252104 GGACCTTCCCCTGGTGGACGGGG - Intergenic
1062373512 9:136252134-136252156 GGCTCTTCCCCTGGTGGACAGGG - Intergenic
1062373602 9:136252368-136252390 GGACCTTCCCCTGGTGGACGGGG - Intergenic
1062392521 9:136339627-136339649 AGCCCCTCCCCTGGTGGTCACGG - Intronic
1062544008 9:137053749-137053771 TGCTCTGCTCCTGGCGGGCTGGG - Intronic
1062580035 9:137225344-137225366 TCCCCCTCCCCTGGTGGCATTGG - Intronic
1062686536 9:137816547-137816569 CGCCCTTCCCCAGCTGGGCTTGG + Intronic
1186627196 X:11306976-11306998 TGCCCTTACCCTGGTTGCCATGG - Intronic
1188273951 X:28177927-28177949 TGCCCTTCCCTTTGTGGGACTGG - Intergenic
1189320440 X:40083996-40084018 GCCCATTCCCCGGGTGGGCTCGG - Intronic
1190113226 X:47608697-47608719 GGCCCGTCCCCAGCTGGGCTTGG + Intronic
1192225172 X:69222656-69222678 CCCCCTCCTCCTGGTGGGCTGGG + Intergenic
1198705938 X:139448201-139448223 TTCCCTTTCCCTGTAGGGCTGGG + Intergenic
1200397221 X:155998333-155998355 TCCCCTTCCTCTGCTTGGCTGGG - Intronic
1201901395 Y:19048339-19048361 CTCCCTTCCCCAGGTGGCCTTGG + Intergenic