ID: 1151349708

View in Genome Browser
Species Human (GRCh38)
Location 17:73524566-73524588
Sequence CAGTCATGCTAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151349708_1151349727 28 Left 1151349708 17:73524566-73524588 CCCTCTTCCCTCTAGCATGACTG 0: 1
1: 0
2: 2
3: 32
4: 269
Right 1151349727 17:73524617-73524639 TGTCTGCAGTCATGAGGGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 290
1151349708_1151349722 22 Left 1151349708 17:73524566-73524588 CCCTCTTCCCTCTAGCATGACTG 0: 1
1: 0
2: 2
3: 32
4: 269
Right 1151349722 17:73524611-73524633 GACCCCTGTCTGCAGTCATGAGG 0: 1
1: 0
2: 0
3: 13
4: 137
1151349708_1151349717 0 Left 1151349708 17:73524566-73524588 CCCTCTTCCCTCTAGCATGACTG 0: 1
1: 0
2: 2
3: 32
4: 269
Right 1151349717 17:73524589-73524611 GAGCAGGGGGCCTCCTTCCCAGG 0: 1
1: 0
2: 3
3: 30
4: 353
1151349708_1151349723 23 Left 1151349708 17:73524566-73524588 CCCTCTTCCCTCTAGCATGACTG 0: 1
1: 0
2: 2
3: 32
4: 269
Right 1151349723 17:73524612-73524634 ACCCCTGTCTGCAGTCATGAGGG 0: 1
1: 0
2: 1
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151349708 Original CRISPR CAGTCATGCTAGAGGGAAGA GGG (reversed) Intronic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901405961 1:9045961-9045983 AAGTCATGCCAAAGGGAGGATGG - Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
907573543 1:55505783-55505805 CAGACATGAGAAAGGGAAGAGGG - Intergenic
909204366 1:72735902-72735924 CAGTCATCCTAATGGAAAGATGG - Intergenic
909867169 1:80687381-80687403 CAATCATGGTAGAAGGAAAAAGG + Intergenic
911118733 1:94273632-94273654 CAGTCATAATAGACGGAAGTAGG - Intronic
915103804 1:153519746-153519768 CACTGATGCTAGATGGAGGAAGG + Intergenic
917784703 1:178441935-178441957 CAGTCATGGCAGAAGGCAGAAGG + Intronic
917904640 1:179576226-179576248 ATGTCATGCTAGAGGGCTGACGG + Intergenic
920222924 1:204417237-204417259 CAAGCCTGCTAGAGGGCAGAGGG + Intergenic
920555853 1:206903935-206903957 CAGCCTTGCTATTGGGAAGAAGG - Intronic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922894016 1:229086897-229086919 CAGTCATGCAGGAGGGGAAAGGG + Intergenic
923278562 1:232419636-232419658 CAGTCATGGTGGAAGGTAGAGGG - Intronic
923339953 1:232998560-232998582 CTGGCATGCTGGTGGGAAGAGGG + Intronic
924427676 1:243968041-243968063 CAGTAATGCCAGAGGGACCAGGG + Intergenic
924465773 1:244298166-244298188 CAGTCATGCCACATGGGAGATGG + Intergenic
1062849212 10:729955-729977 CAGTCATGATGGACGGCAGAGGG - Intergenic
1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG + Intronic
1063512080 10:6655452-6655474 CAGTCATGACAGAAGGTAGAGGG - Intergenic
1064094517 10:12413191-12413213 CAGTCATGGTGGAGGGGAAAGGG + Intronic
1064125994 10:12660617-12660639 CAGAAATGGTAGAGGGAAGTGGG - Intronic
1065245486 10:23752038-23752060 CCCTCATGTTAGAGGGAAGATGG + Intronic
1067799616 10:49350024-49350046 CATTCATCCTACAGGGAAGTGGG - Intergenic
1069971601 10:72175325-72175347 CAGTCATGTAAAAAGGAAGAGGG - Intronic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1073022821 10:100460727-100460749 CTGTTATCCTAGAGGGGAGAAGG + Intergenic
1073741912 10:106417026-106417048 CAGTCATGGTGGAAGGCAGAGGG + Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1079784010 11:24648037-24648059 AAGTCATGCTAGAGGAAAACAGG - Intronic
1080109138 11:28546063-28546085 CAATCATGGTAGAAGGCAGAGGG + Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080838710 11:35964605-35964627 GATGCAGGCTAGAGGGAAGAAGG + Intronic
1080882861 11:36339042-36339064 CAATCATGATAGAGGGCAGAAGG - Intronic
1081034636 11:38127970-38127992 CAATCATGGTAGAGGGTAAAGGG + Intergenic
1083554830 11:63617835-63617857 CAGTCATGGCAGAAGGAAAAAGG - Intergenic
1086461536 11:87010646-87010668 AAATAATGCTAGAGTGAAGATGG - Intergenic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1089576866 11:119450874-119450896 CAGACATGATGGAGGGCAGAAGG + Intergenic
1089789689 11:120933839-120933861 CAGCCATGCTAATGGGAGGATGG - Intronic
1091695944 12:2628109-2628131 CAGTCAGGCTGGTGGCAAGAAGG - Intronic
1092258387 12:6939214-6939236 CAGTCATGATAGGGGGAAGGTGG - Intronic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101469451 12:104983000-104983022 CAGTCATGGTAGAAGGCAAAGGG - Intergenic
1101472975 12:105016555-105016577 CAATCATGGTAGAGGGTAAAGGG + Intronic
1102716550 12:114978406-114978428 CAATCATGGTAGAAGGCAGAAGG + Intergenic
1103310830 12:120006415-120006437 CAGTGATGCTACAGTGAACAAGG + Intronic
1104494471 12:129224023-129224045 CTGTCATACTAGGGGGATGAGGG - Intronic
1106682005 13:32017883-32017905 CAATCATGCCAGAAGGAAAAGGG + Intergenic
1107629118 13:42325479-42325501 CAGTCATGGTAGAAGGCAAAGGG + Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1108785335 13:53893440-53893462 CAGTCATGGTGGAGGGCAAACGG - Intergenic
1109592032 13:64498006-64498028 CAGTCATGCTATAAAGCAGAAGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112357402 13:98685418-98685440 CAGACATGCTACAGTGCAGAAGG + Intronic
1114575457 14:23708709-23708731 GAGTCAGGCTAGTGGGAATAAGG - Intergenic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1116389753 14:44377999-44378021 CAGTCATGGTGGAGGGCAAAAGG + Intergenic
1119050100 14:71358774-71358796 TAGTCATGGCAGAGGGAAGCAGG + Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1123412182 15:20069728-20069750 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1123521526 15:21076848-21076870 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1123788119 15:23692604-23692626 CAGTCATGGTGGAAGGAAAAGGG + Intergenic
1123921464 15:25072746-25072768 CAGGCCTGCTGGAAGGAAGATGG + Intergenic
1125277472 15:38008380-38008402 CAGGGATGATAGAGGGAAGGGGG + Intergenic
1125489163 15:40133811-40133833 CTATCATGCTAGAGTGAAGAAGG + Intergenic
1131601268 15:93851221-93851243 CAGTCATGGTAGAAGGCAAAAGG - Intergenic
1132405961 15:101542044-101542066 CTGACATCCAAGAGGGAAGATGG - Intergenic
1132767867 16:1543691-1543713 CAGTCATGCAGGAGGGGAGGAGG - Intronic
1133811734 16:9166070-9166092 TAGTCATGCTTGAGGGTGGATGG + Intergenic
1134622865 16:15702834-15702856 CAGTCATGTTCGAGGGCAGGGGG + Intronic
1134743460 16:16569267-16569289 CATGCATGCTAAAGGGGAGAAGG - Intergenic
1134924095 16:18143194-18143216 CATGCATGCTAAAGGGGAGAAGG + Intergenic
1135060721 16:19269233-19269255 CAATCATGGTAGAGGGCAAAGGG + Intergenic
1135406665 16:22203307-22203329 TAGTCATGCTAGTGGGTAGTGGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1139560016 16:67735975-67735997 CAGTCATGGTAGAGGCTAGGTGG - Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1140709991 16:77668739-77668761 CAGTTATGATAGAGGAAAGAGGG - Intergenic
1144658994 17:17056319-17056341 CATTCATGGCAAAGGGAAGAGGG - Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148973860 17:51509780-51509802 CAGTCATGCTAATTGGAAGAGGG + Intergenic
1150471181 17:65438775-65438797 GAGGCATGCAAGAGGGAAGAGGG - Intergenic
1151128650 17:71872694-71872716 CAGTCAAGATGCAGGGAAGAAGG + Intergenic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1153004469 18:485024-485046 AAAACATGCTAGAGGGCAGAAGG + Intronic
1153092924 18:1369083-1369105 CCCTCATGCTAGAGGGACAATGG - Intergenic
1156305114 18:35872167-35872189 CAGTCAGGATTGAGGCAAGAAGG - Intergenic
1157430040 18:47617142-47617164 CTGTCATGCAAGGGGGAAGGAGG + Intergenic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157931212 18:51825675-51825697 CAGTCATGATAGAAGGCAAAGGG + Intergenic
1159996754 18:74971925-74971947 TAGTCATGGTAGAGGGTGGAAGG + Intronic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1162594756 19:11619676-11619698 CAGTCATATTAGTGAGAAGAGGG + Intergenic
1164453687 19:28388880-28388902 CAGTCATGGCAGAGGGAAAGGGG - Intergenic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1166423807 19:42658176-42658198 CAGTCAGGATAGAGGCCAGATGG + Intronic
1166620978 19:44299837-44299859 CAAAAATGCTAGGGGGAAGAAGG + Intronic
925726236 2:6875295-6875317 TAGTTTTGCTTGAGGGAAGAGGG - Intronic
926372755 2:12197003-12197025 CAATCATGGTGGAGGGAAGGAGG + Intergenic
926752349 2:16208139-16208161 CTGTGATGCTAGAGACAAGATGG + Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
931069876 2:58634568-58634590 CAAACATGCTATAGGGAACATGG - Intergenic
931928394 2:67100282-67100304 CAGTCATGGTAGAAGGCAAAGGG + Intergenic
933064472 2:77776850-77776872 CATACATACTAGAGGGAAGGAGG + Intergenic
933790628 2:85881173-85881195 CAATCATGGTAGAGGGCAAAAGG - Intronic
935523069 2:104133291-104133313 TAGCCATGCCAGAGGGAATATGG - Intergenic
935675676 2:105593294-105593316 CAACCATGCTAGAGGAAAGATGG - Intergenic
936734093 2:115419368-115419390 CAGTCATGGCAGAAGGAAAAGGG + Intronic
936755989 2:115713203-115713225 CAGTCATGAGAGAGGGCAGCTGG + Intronic
940097112 2:149989494-149989516 CAGTCATTCTATAGGCAAGCAGG + Intergenic
941456896 2:165719924-165719946 CAATTATGCTAGAGGTAAGATGG - Intergenic
941900430 2:170672739-170672761 CAGGGAAGCTAGAGAGAAGAGGG - Intergenic
942340353 2:174937833-174937855 CAGTCATGGTGGAAGGCAGAGGG - Intronic
942794013 2:179794744-179794766 CAATCATAATAGAGGAAAGAGGG + Intronic
942877548 2:180819480-180819502 CACTCAGGCTAAAGGAAAGAGGG + Intergenic
943452887 2:188067224-188067246 AAGTCATGCTGGAGGAAAGAAGG + Intergenic
944875278 2:203958332-203958354 TGGTACTGCTAGAGGGAAGAAGG + Intronic
945421788 2:209647047-209647069 CAGTCATGGTAGAAGGCAAAGGG + Intronic
945469532 2:210211643-210211665 CAGTCATGGCAGAAGGCAGAGGG - Intronic
946322379 2:218961395-218961417 CAGTCAGGCAAGGGGTAAGATGG - Exonic
946441204 2:219698047-219698069 AAGTCATGCCAGAGAAAAGATGG + Intergenic
946597260 2:221319810-221319832 CCATCATGCCAGATGGAAGAGGG - Intergenic
946881605 2:224182375-224182397 CAGTCATCCTACAGAGGAGAAGG + Intergenic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1170104070 20:12734833-12734855 CTGTCTTGCTACAGGGAAAAAGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172240838 20:33411509-33411531 CAGTCATGCAGGAGAGATGATGG - Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173337846 20:42127259-42127281 CAGGCCTGCTTGAGGAAAGATGG + Intronic
1173463047 20:43259368-43259390 CAGTCATGTTGGAGGGCAAAGGG - Intergenic
1175157941 20:56985883-56985905 CAGGGATGCTAGAGGGAGGGTGG - Intergenic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176725079 21:10424917-10424939 CAGTCATGTGAAAGGGAAGCTGG + Intergenic
1177384737 21:20393844-20393866 TAATCAGGCTAGAGGGGAGATGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1183228532 22:36566314-36566336 CAGTCCTGCCACTGGGAAGAAGG - Intronic
1184818183 22:46888196-46888218 CAGTCATGGTGGCTGGAAGATGG + Intronic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
950396638 3:12738642-12738664 AAGTCATGCTTCAGGGAAGGTGG + Intronic
951285718 3:20810692-20810714 GAGTCATTCTAGAAGGAAAAAGG - Intergenic
951513309 3:23528706-23528728 GATGCATGCTAAAGGGAAGAGGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
952951888 3:38532388-38532410 CAGTCACCCTGGTGGGAAGATGG + Intronic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953477977 3:43222030-43222052 CAGTCATACAAGAGGGCACAGGG + Intergenic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
954611211 3:51945422-51945444 CAGTCATGTGAGAGAGGAGAGGG + Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
955104593 3:55885068-55885090 GTGTGATGTTAGAGGGAAGAGGG - Intronic
955264985 3:57434350-57434372 CGGCCATGCTAGAGGGAAAAGGG - Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957853768 3:85846336-85846358 CAGTCATTCTAGAGGACAGTGGG - Intronic
959700650 3:109295830-109295852 GAGTAATGCAAGTGGGAAGATGG + Intronic
960341511 3:116480049-116480071 CAATCATGGTAGAAGGAAAAAGG - Intronic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
961742266 3:129040242-129040264 CAGGCATGCCAGTGGGAGGAAGG - Exonic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
964097880 3:152954458-152954480 TAGTCATGACAGAGGGTAGATGG - Intergenic
964370550 3:155995726-155995748 CACTCATGTTAGACAGAAGAGGG + Intergenic
965562214 3:170072594-170072616 CAGTCATGGTGGAAGGCAGAGGG + Intronic
968770203 4:2500580-2500602 CAGTCATACTAAAGTGTAGAGGG + Intronic
969123098 4:4924185-4924207 AATTCATTCTAGTGGGAAGATGG + Intergenic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
970123928 4:12788296-12788318 ATGTCATGCTAGAGAGAATATGG + Intergenic
971035575 4:22689329-22689351 CAGTCATGGCAGAAGGATGAAGG - Intergenic
975353897 4:73376972-73376994 CAACCATGCTAATGGGAAGAGGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977155410 4:93566727-93566749 CACTCAGGCTGGAGGGCAGAGGG - Intronic
978917570 4:114145641-114145663 CAGTCATGCTAAAGGAGATATGG - Intergenic
979337181 4:119476591-119476613 CAGTCATGATAGAGGGATGAAGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
980537902 4:134152869-134152891 CACTCATGGTAGAAGGAAAAGGG + Intergenic
981318363 4:143363887-143363909 AAGTCATTCTCGAGGGATGATGG - Intronic
982490250 4:156021017-156021039 CAATCATGGTGGAGGGCAGAGGG - Intergenic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
983194235 4:164787599-164787621 CTGTCATGGAAGAGAGAAGACGG - Intergenic
985091716 4:186369917-186369939 TAGTCAGGCTAGAAGGGAGAAGG + Intergenic
985309063 4:188577520-188577542 CAATCATGACAGAGGGCAGAGGG + Intergenic
986644159 5:9900068-9900090 CAGTCATGCAAGACAGAAGTAGG + Intergenic
987432176 5:17848239-17848261 CAGTCCTTCTAGAGAGAGGAAGG + Intergenic
988006870 5:25424725-25424747 CAGTATTGCTAGAAGGAAAATGG + Intergenic
990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG + Intergenic
990997446 5:61746542-61746564 CACTCATGTTAGACGGGAGAGGG + Intronic
992002159 5:72446358-72446380 CAGACATCCTAGAGGGCAGATGG + Intronic
992803236 5:80312079-80312101 TAGTCATTCTAAAGGGAAAATGG + Intergenic
993390833 5:87318498-87318520 CAGTCATGGTAGAAGGCAAAGGG + Intronic
993640152 5:90392634-90392656 CAGTCATGGTAGAAGGCAAAGGG - Exonic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
996134135 5:119818022-119818044 TAGTCATGCAGGAGAGAAGATGG - Intergenic
996760529 5:126982293-126982315 CAGACATGGTATAGGGAAGATGG - Intronic
997619942 5:135281018-135281040 CAGTCAGGCTAGAGGGAGTATGG - Intronic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
998894281 5:146782093-146782115 CAGTCATGGTGGAGGGCAAAGGG - Intronic
999255633 5:150208713-150208735 CTGTCATGCCAGGGAGAAGAGGG - Intronic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
999948965 5:156628065-156628087 CAGTCATGGTGGAAGGCAGAGGG + Intronic
1001093640 5:168760000-168760022 CAGTCATGCTAGTGTGAGGCTGG - Intronic
1001202465 5:169730658-169730680 TAATCATGCTAGATGGAGGATGG + Intronic
1001309601 5:170601552-170601574 AAGCCATGCGAGACGGAAGAAGG + Intronic
1002494455 5:179602311-179602333 CAGTCAGGCCAGAGGGAGCAGGG + Intronic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1004881659 6:20014258-20014280 GAGTCACGCTAGAGAGAAGAGGG - Intergenic
1005919713 6:30389954-30389976 CAGTCACCCAAGAGGGAAGGTGG - Intergenic
1007233915 6:40377044-40377066 CAGTCATGGTAGAAGGCAAAGGG + Intergenic
1007353797 6:41295080-41295102 CAGCCATGCTAGAGGGACAGAGG - Intergenic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1008433611 6:51449534-51449556 CTCACATGCTAGAGGAAAGAAGG - Intergenic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009924580 6:70104334-70104356 CAGTCATGGCAGAAGGGAGAAGG + Intronic
1009964495 6:70564524-70564546 CAGTCATGGCAGAAGAAAGACGG + Intergenic
1010574009 6:77510290-77510312 CAGTCATGCTATGGGAAAGGGGG + Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1011749036 6:90436763-90436785 CAATCATGGTAGAAGGAAAAGGG - Intergenic
1012222539 6:96666953-96666975 CAGACATGCCAAAGGTAAGATGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013639256 6:112057376-112057398 AAGTCATTCTGGAGGGAGGAAGG + Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014047238 6:116904669-116904691 GGGACATGGTAGAGGGAAGATGG - Intronic
1014241067 6:119017950-119017972 CAATCATGCTGGAAGGAGGAGGG - Intronic
1017324102 6:153127479-153127501 CAGACATACAAGAGGGATGAAGG - Intronic
1017638967 6:156471784-156471806 CAGGCCTGATAGAGGGGAGAGGG - Intergenic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1019120105 6:169795327-169795349 CAGTCTTGCTCCCGGGAAGATGG + Intergenic
1019582772 7:1775369-1775391 AAGTAATGCTAGAGGGAAACTGG - Intergenic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020695936 7:11414024-11414046 CAGCCATGCCACATGGAAGATGG - Intronic
1022526597 7:31041940-31041962 CAGCCATACTGGCGGGAAGAAGG + Intergenic
1023530824 7:41151869-41151891 CAGTCATGCTGAAGAGAAGAAGG - Intergenic
1025930378 7:65988963-65988985 CAGTCATTATTCAGGGAAGAGGG - Intergenic
1027529492 7:79312910-79312932 CATACAAGCTAAAGGGAAGAAGG - Intronic
1027744964 7:82061664-82061686 CAGTCATGCCAGACAGGAGATGG + Intronic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1028482741 7:91325493-91325515 AAATCATATTAGAGGGAAGAGGG - Intergenic
1030412127 7:109193712-109193734 CAGTCATGGTGGAAAGAAGAAGG + Intergenic
1031670073 7:124531074-124531096 GAGTCCTGCCAGAGGCAAGAGGG - Intergenic
1031906765 7:127468683-127468705 CAGTCATGCTGGATGGATGATGG - Intergenic
1032641123 7:133769747-133769769 CATTCATGATAAAGGGAATAAGG - Intronic
1033277724 7:139985305-139985327 CAGTCAGGCTAGAGGGGTGGGGG - Intronic
1034260842 7:149754317-149754339 CAGTCATGTTTGATGGAAAAAGG + Intergenic
1034612722 7:152386505-152386527 CAGTCATGTGAAAGGGAAGCTGG - Intronic
1034848224 7:154467515-154467537 CAATCATGGTAGAAGGAAAAGGG - Intronic
1036943649 8:13074158-13074180 AAGTCATTATAGAGGGAATACGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038180696 8:25224613-25224635 TAGTTATGGTTGAGGGAAGATGG + Intronic
1040625911 8:49149842-49149864 CAGCAATGCTCAAGGGAAGAGGG + Intergenic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1044358719 8:91256958-91256980 CTGTCATGCTAGAAGCAAGCTGG - Intronic
1045569623 8:103355443-103355465 CTGTCATGCTAGGGGTAAGACGG - Intergenic
1046748273 8:117899120-117899142 CATTTACGCTAGAGAGAAGATGG + Intronic
1047720244 8:127632288-127632310 CAGACATTCTAGAGAGAAGCAGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048819062 8:138363077-138363099 GAGAGATGCTAGGGGGAAGAGGG + Intronic
1050028723 9:1363095-1363117 CAGACAAGCTACATGGAAGAAGG - Intergenic
1050630594 9:7554612-7554634 CAGGCATGTTAGAGGGTGGAGGG + Intergenic
1051453946 9:17230838-17230860 CAGTCATGCTTGGGGGAAGGGGG - Intronic
1051556083 9:18384198-18384220 CAGTCATGTTGGAGGGCAAAGGG + Intergenic
1052331319 9:27271758-27271780 AAGTCATCCAAGAGGGAAGAAGG + Intergenic
1055480180 9:76701952-76701974 CAGTCATGGTAGAGGCAGGCTGG + Intronic
1055493253 9:76827611-76827633 CAGTCATGGGGGAGGGAAAATGG + Intronic
1055936031 9:81605031-81605053 CAGGCATGCTCCAGGAAAGAGGG - Intronic
1056010959 9:82329604-82329626 CAGTCATGCTGGGGAGAAGGGGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1059484112 9:114613801-114613823 CAGTCACACTAGAGTGCAGAGGG + Intronic
1059733921 9:117083083-117083105 TAGTCATGCCAGAGGAAAAAGGG - Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1061034042 9:128103594-128103616 GAGCCGTGCTAGAGGGTAGACGG + Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1192047860 X:67695425-67695447 CAGTAAGGCTAGATGTAAGAGGG - Intronic
1193749662 X:85326619-85326641 CATTCATGCTAGTGGGAAAGGGG + Intronic
1196124674 X:112084618-112084640 CCCTCATGCCAAAGGGAAGACGG - Intergenic
1196298872 X:114031559-114031581 CAGTCATGACAGAAGGCAGAAGG + Intergenic
1197355901 X:125437252-125437274 CAGTCATACTACAGGGAAAGGGG + Intergenic
1198925949 X:141795657-141795679 CAGTCTTGATGGAGGCAAGAGGG + Intergenic