ID: 1151350157

View in Genome Browser
Species Human (GRCh38)
Location 17:73527118-73527140
Sequence GGGGCCACTGAGGATTGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151350157 Original CRISPR GGGGCCACTGAGGATTGGCG GGG Intronic
900711244 1:4115840-4115862 GAGGCCACTGCGGAGTGGCCAGG - Intergenic
900991844 1:6101713-6101735 GGGGCCAGGGAGGAGTGGTGGGG - Intergenic
902134654 1:14294503-14294525 GAGGCCACTGAGGATCAGAGAGG + Intergenic
902149285 1:14429811-14429833 GAGACCACTGAGGTTTGGGGAGG + Intergenic
902447316 1:16475639-16475661 GGGGCAACTGAGGTATGGGGAGG + Intergenic
902629314 1:17695329-17695351 GTGGCCAGTGGGGCTTGGCGGGG + Intronic
902693687 1:18126401-18126423 GGGGAAACTGAGGATTAGAGAGG + Intronic
902715374 1:18269149-18269171 AGGGTCACTGGGGATTGGGGTGG + Intronic
903268642 1:22174036-22174058 GCAGCCACTGAGGCTTGGCCTGG - Intergenic
904081089 1:27872923-27872945 GGGGCCACCTAGGAGTGGCCCGG - Intronic
906344095 1:45004470-45004492 GGTGGCACTGAGGAATGGTGGGG + Intronic
908779616 1:67677796-67677818 GAGGAAACTGAGGAATGGCGAGG + Intergenic
914337636 1:146730180-146730202 AGGGACACTGAGGCTTGGAGAGG - Intergenic
915076188 1:153309677-153309699 GGGGACACAGAGGACTGGGGAGG + Intronic
915537144 1:156543651-156543673 TGGGCCACAGAGGACTGGAGAGG + Intronic
915580349 1:156809436-156809458 GGGGCAGCTGAGGTTTGGCGGGG + Exonic
915857568 1:159405914-159405936 TGGGTCACTGAGGATTGGCCTGG - Intergenic
916578983 1:166090978-166091000 GGTGCGACTGAGGTTTGGGGAGG + Intronic
917611778 1:176695894-176695916 GTGACCACTGAGGATGGGGGTGG + Intronic
918067154 1:181109178-181109200 GGGGGCACTGAGCACTGGCCAGG - Intergenic
920418243 1:205812904-205812926 GGGGCCAAGGAGGACTGTCGAGG - Exonic
922531563 1:226349120-226349142 GGGGCCTCTCAGGATGGGAGAGG + Intergenic
922769793 1:228175670-228175692 GGGGCCCCTGAGCATGGGTGGGG - Exonic
1063614284 10:7588877-7588899 GGGGCAACTGAGGCATGGAGTGG + Intronic
1067053532 10:43038604-43038626 GGGGCCATGGAGGACTGGCCAGG - Intergenic
1067455010 10:46412968-46412990 TGGGCCAGTGAGGATTTGGGAGG - Intergenic
1067466535 10:46503300-46503322 GGGGACACTGAGGATGGTGGAGG - Intergenic
1067620653 10:47881305-47881327 GGGGACACTGAGGATGGTGGAGG + Intergenic
1067632194 10:47971666-47971688 TGGGCCAGTGAGGATTTGGGAGG + Intergenic
1069684722 10:70310305-70310327 GGGGAAACTGAGGCTTGGAGAGG + Intronic
1069744026 10:70703545-70703567 GGGGCCTCTGAGCACTGGCGTGG + Intronic
1071462780 10:85914200-85914222 GGGGCCCCTGAGGGTGGGTGGGG + Intronic
1072263152 10:93701894-93701916 GAGGACACTGAGGCTTGGAGAGG - Intronic
1073756074 10:106581902-106581924 GGGGCCACAGATGATTGGGATGG + Intronic
1074715922 10:116218553-116218575 GGTGCCACTGAGGCTGAGCGGGG - Intronic
1075540445 10:123308969-123308991 GGGGCTTCTGAGGCTTGGCGAGG + Intergenic
1076126562 10:127978695-127978717 GAGGACACTGAGGCTTGGTGAGG - Intronic
1076803931 10:132845875-132845897 GGGGACACTGAGGCTTGGAGAGG + Intronic
1077337126 11:2010437-2010459 GGGGCCAGGAACGATTGGCGTGG - Intergenic
1078762101 11:14259730-14259752 GAGGCCACTGGGGACAGGCGTGG + Intronic
1080576121 11:33600648-33600670 GGGTCCTCTGAGGACTGGGGTGG - Intronic
1081661687 11:44892328-44892350 GGGGCCTGGGAGGAATGGCGCGG - Intronic
1081749709 11:45501328-45501350 GGGGCCACAGAGGGGTGGTGAGG - Intergenic
1084563251 11:69915742-69915764 GGAGACACTGAGGCTTGGGGCGG - Intergenic
1086991178 11:93304831-93304853 AGGGCCACTGAGGTTTGCTGGGG - Intergenic
1089134575 11:116238875-116238897 GGTGTCACTGAGGATGGGCCTGG + Intergenic
1089528095 11:119109885-119109907 GGAGCCACTGAGCAATGGGGAGG - Intronic
1090267036 11:125359719-125359741 GGGGCCACTGAGGCTTCAGGCGG - Intronic
1090478986 11:127051150-127051172 GCGGAAACTGAGGATTGGAGAGG + Intergenic
1202820110 11_KI270721v1_random:65619-65641 GGGGCCAGGAACGATTGGCGTGG - Intergenic
1091786168 12:3244526-3244548 GGGGCCTCTGAAGAATGGCCTGG + Intronic
1091807912 12:3369060-3369082 GGGGCCACTGAACACTGGAGAGG - Intergenic
1094525234 12:31226937-31226959 GGGGCCTCTGAGGAGTGGCCTGG - Intergenic
1096595945 12:52695592-52695614 GGGGATTCTGAGGATTGGGGTGG + Intronic
1101945016 12:109130049-109130071 GGGGACACTGAGGTTTGGAGAGG + Intronic
1102012317 12:109626331-109626353 GGGGGAACTGAGGCTTGGAGAGG + Intergenic
1102460089 12:113094751-113094773 GGGGAGACTGAGGACTGGGGAGG - Intronic
1103963084 12:124621656-124621678 GGGTCCCCTGAGGATGTGCGGGG + Intergenic
1104804041 12:131573740-131573762 GGGGCCAGAGAGGAGTGGCCCGG - Intergenic
1105834057 13:24193091-24193113 GGAGCCACTGAGCATTGTTGAGG + Intronic
1106974401 13:35190020-35190042 GCAGCCACTGAGGATAGGAGTGG + Intronic
1107784159 13:43937665-43937687 GGGGCCACTGAGGCTCAGAGAGG + Intergenic
1109073831 13:57806735-57806757 GTGGCCACTGAGAATTGCAGAGG + Intergenic
1117162988 14:53007197-53007219 GGGGACACTGAGGAGTGGTAGGG + Intergenic
1119513138 14:75227411-75227433 GGGGCCACTGAGGCTGGGCACGG + Intergenic
1119513190 14:75227720-75227742 GGGGCCACTGAGGCTGGGCACGG + Intergenic
1122156770 14:99754741-99754763 GAGGAAACTGAGGCTTGGCGAGG - Intronic
1122366387 14:101197301-101197323 AGGGCCAGTGAGGATGGGGGTGG - Intergenic
1122834490 14:104424187-104424209 GGGGTGACTTAGGCTTGGCGGGG + Intergenic
1128144341 15:65324216-65324238 GGGGACAGTGAGGTTTGACGGGG + Intergenic
1129714736 15:77840413-77840435 GGGGCCACTGGGGCCTGGGGAGG + Intergenic
1130306369 15:82714557-82714579 GGGGAAACTGAGGCTTGGAGAGG + Intergenic
1132311066 15:100858457-100858479 GGGGCCACTGTGGGCTGGGGAGG - Intergenic
1132639443 16:971007-971029 GGGGCCTCCGAGAATGGGCGGGG - Intronic
1132639450 16:971026-971048 GGGGCCTCCGAGAATGGGCGGGG - Intronic
1133295275 16:4748871-4748893 CAGGCCACTGAGGATGGGCAGGG + Exonic
1133513598 16:6484092-6484114 GGAGCCAATGAGCATTGGCAAGG - Intronic
1134832056 16:17331682-17331704 GGGCACACTGAGGATTGACCAGG + Intronic
1135117399 16:19735306-19735328 CGGGCCACTGGGGATTTGCAGGG + Intronic
1137719544 16:50620019-50620041 GGGGAAACTGAGGCTTGGAGAGG - Intronic
1139996645 16:70987148-70987170 AGGGACACTGAGGCTTGGAGAGG + Intronic
1141922149 16:87143498-87143520 GGGGAAACTGAGGCTTGGAGTGG - Intronic
1142200730 16:88760018-88760040 GGGGCAGGTGGGGATTGGCGCGG - Intronic
1142210966 16:88808284-88808306 GGGGCCACTGTGGACAGACGTGG + Exonic
1142291511 16:89195531-89195553 GGGGCCAGTGAGGCCTGGCCTGG + Intergenic
1142356403 16:89603905-89603927 GGGAGCACTGAGGGTTGGAGGGG + Intergenic
1147252430 17:39160989-39161011 GGGGAAACTGAGGATTAGAGAGG + Intronic
1147615088 17:41822849-41822871 GGAGCCAGTCAGGATTGGGGAGG - Exonic
1148798884 17:50210805-50210827 GGGGACACTGAGGAGAGGCGGGG + Intergenic
1150132607 17:62677416-62677438 GGAGCCAGTGAGGCTGGGCGTGG - Exonic
1151310921 17:73291955-73291977 AGGGCCAGGGAGGATAGGCGAGG - Intronic
1151348985 17:73520413-73520435 AGGGCCACTGCTGATTGGAGGGG - Intronic
1151350157 17:73527118-73527140 GGGGCCACTGAGGATTGGCGGGG + Intronic
1152362798 17:79840163-79840185 GGAGCCATTGAGGATCGGGGTGG - Intergenic
1152924531 17:83081015-83081037 GGGGCGACTGTGGCTTCGCGGGG - Intronic
1155338118 18:24785657-24785679 GGGGGCACTGAAGAGTGGCAGGG + Intergenic
1157195499 18:45617377-45617399 GGGTCCTCTGAGGACTGGCTGGG - Intronic
1160875950 19:1296190-1296212 GGGGAAACTGAGGCTTGGAGGGG + Intronic
1160937712 19:1605102-1605124 GGGGAAACTGAGGCTTGGAGCGG + Intronic
1160978757 19:1806925-1806947 GGGGCCATTGAGCTTTGGTGGGG - Intronic
1161111806 19:2475044-2475066 GGGGAAACTGAGGCTTGGTGAGG - Intergenic
1161258191 19:3321325-3321347 GGGGAAACTGAGGCTTGGCAAGG + Intergenic
1161957180 19:7502739-7502761 GGGGAAACTGAGGCTTGGAGAGG - Intronic
1162548827 19:11346992-11347014 GGGGACACTGAGGCATGGAGAGG + Intronic
1162561973 19:11422293-11422315 GGGGACTCTGAGGAATGGGGTGG + Intronic
1163195476 19:15716675-15716697 GGTGCAACTGAGGTTTGGTGAGG - Intergenic
1163612694 19:18309425-18309447 GGGGAAACTGAGGCTTGGGGAGG + Intronic
1163638447 19:18448768-18448790 GGGGCCGCTGAGGTTTGCCAAGG - Intronic
1163728153 19:18934125-18934147 GGGACCACAGAGGAGTGGTGTGG - Intronic
1163817503 19:19475727-19475749 GTGGCCACTGAGGTTTGGAGGGG - Intronic
1164416134 19:28047906-28047928 GGAGCCACTGAGGATAGCTGTGG + Intergenic
1165027660 19:32973254-32973276 GTGGCCAATGAGAAATGGCGCGG + Exonic
1165308923 19:35019063-35019085 GGGGACACAGAGGAGTGGTGGGG + Intronic
1165421929 19:35726384-35726406 GGGGCCACAGGGGAATGGCCAGG + Intronic
1166786599 19:45370756-45370778 GGCGTCACTGAGGATCGTCGAGG + Intronic
1167504962 19:49866439-49866461 AGCTCCACTGAGGATTGGAGGGG + Exonic
1167568662 19:50272862-50272884 GGGGACACTGAGGCTCGGAGGGG - Intronic
1168173949 19:54609294-54609316 GGGGACACTGAGGTGGGGCGAGG - Intronic
925874781 2:8302500-8302522 AGCGCCACTTAGGATTGGCTGGG - Intergenic
926689772 2:15725273-15725295 GGGGACACTGAGGCCTGGAGAGG + Intronic
927712261 2:25333198-25333220 GGGGCCACAGGGGAGTGGCAGGG - Intronic
932495155 2:72142502-72142524 GGGGCCACTGAGGCGTAGAGCGG - Intronic
937085424 2:119168785-119168807 GGGGAAACTGAGGTTTGGAGAGG - Intergenic
937829756 2:126406481-126406503 GGAGCCACTGAGAATTGCAGCGG - Intergenic
942231060 2:173861088-173861110 GGGGCCCCGGAGGAGGGGCGGGG + Intergenic
943060747 2:183038912-183038934 GGGGAGACTGAGGATGGGCTGGG - Intergenic
948465008 2:238148106-238148128 GGGGCTCCTGAGGATAGACGGGG + Intronic
948547397 2:238742628-238742650 GGAGCCACTGAGTTTTGGGGTGG - Intergenic
1168904467 20:1392521-1392543 GAGGAAACTGAGGCTTGGCGAGG - Intronic
1172162600 20:32879019-32879041 GAGGCCACTGAGGTCTGGAGAGG + Intronic
1172306191 20:33882436-33882458 GGGGCCAGTGTGGCTGGGCGGGG + Intergenic
1172640911 20:36439946-36439968 GGGGCCACTCAGCATGGGCTGGG - Intronic
1173513678 20:43649972-43649994 AGAGCCACTGAGGATAGGAGAGG + Intergenic
1174581359 20:51574059-51574081 TGGGCCACTGAGCAGGGGCGTGG + Intergenic
1175895682 20:62334659-62334681 GGGGCCCCTGAGGCTGGGTGGGG - Intronic
1176171323 20:63697633-63697655 GGGGCCACAGTGGATTTGAGGGG + Intronic
1176412236 21:6455290-6455312 GGGGCCTCTGAGGATCAGCCAGG - Intergenic
1179157455 21:38862802-38862824 GGGGCCCCTGAGGAATGTCATGG + Intergenic
1179687730 21:43063612-43063634 GGGGCCTCTGAGGATCAGCCAGG - Intronic
1180956406 22:19743330-19743352 AGGGCCAGTGTGGATTGGAGAGG - Intergenic
1181511767 22:23392585-23392607 GGGGACACTGGGGTTGGGCGTGG - Intergenic
1181904788 22:26185781-26185803 GGAACCACTGAGGCTTGGAGAGG + Intronic
1181956078 22:26589170-26589192 GGGGAGACTGAGGCTTGGAGAGG - Intronic
1182280182 22:29213959-29213981 GGGGAAACTGAGGCTTGGGGAGG - Intronic
1182352971 22:29709225-29709247 GGGGAAACTGAGGCTTGGAGAGG + Intergenic
1182420899 22:30248107-30248129 GGGGGCATGGAGGATGGGCGAGG - Intergenic
1182700690 22:32235199-32235221 AGGGTCACTGAGGATTGGACTGG - Intronic
1183961560 22:41414425-41414447 GGGGACACTGAGGTTCGGAGAGG - Intergenic
1184520878 22:44993309-44993331 GGGGACACTGAGGCTGGGTGAGG - Intronic
1184768779 22:46586291-46586313 GGGCCCAGTGAGGATGGGGGTGG - Intronic
949420495 3:3860273-3860295 GGGGCCAGGGAGGGTTGGGGAGG - Intronic
950173926 3:10858641-10858663 GGGCACACTGAGGCTTAGCGAGG + Intronic
952981521 3:38739821-38739843 TGGGCTCCTGAGGATTGGCCAGG + Intronic
954396777 3:50297211-50297233 GGGGCCACTGATCATTGATGAGG + Exonic
956508203 3:69965159-69965181 GGGGACACTGAGGAAAGGAGTGG - Exonic
959882094 3:111455629-111455651 GTGGACACTGAGGCTTGGGGAGG + Intronic
961441036 3:126953317-126953339 GGCACCACTGAGGCTGGGCGAGG + Intronic
961501689 3:127340761-127340783 GGGGCCAGTGAGGGTCGGCAAGG - Intergenic
962101580 3:132348394-132348416 GGGGAAACTGAGGCTTGGAGAGG - Intronic
962885056 3:139616942-139616964 GTGGCCACTGAGGAGTGACCAGG - Intronic
963913974 3:150841029-150841051 GGTGTCACTGAGGGTTGGGGAGG + Intergenic
964420037 3:156492499-156492521 GGAACAACTGAGGATTGGCTGGG - Intronic
966626903 3:182026780-182026802 GAGGAAACTGAGGATTGGAGAGG - Intergenic
968635533 4:1676596-1676618 GTGGCCACTGTGGAGTGGCAGGG - Intronic
968910790 4:3476093-3476115 GGGGCCACTGTGGACAGGTGGGG - Intronic
969112709 4:4853638-4853660 GGAGCCACAGAGGGTTGGGGAGG - Intergenic
969254809 4:5994533-5994555 GGGGCCCCTGGGGATGGGCTTGG - Intergenic
969430507 4:7151136-7151158 GGGGCCACTGAGGTTTGTAATGG - Intergenic
970865650 4:20755866-20755888 GGGGCCACTGTGGCTGGGTGGGG + Intronic
971176079 4:24283955-24283977 GGGGAAACTGAGGATTGGGGAGG + Intergenic
971918667 4:32909361-32909383 TGGTCCACCCAGGATTGGCGTGG + Intergenic
982406058 4:155021481-155021503 GGGGCCAGTGAGGCTCGGGGAGG - Intergenic
986150726 5:5127948-5127970 GAGGACACTGAGGCTTGGAGCGG + Intergenic
987120797 5:14764599-14764621 TGAGCCACTGAGGATCGGGGTGG + Intronic
1000081725 5:157854851-157854873 AGGGCCACTGAGGCTGGGCAAGG + Intronic
1000890930 5:166801144-166801166 TGGGCCACTGAGTTTTGGAGTGG - Intergenic
1001313704 5:170628388-170628410 GGGGACACTGAGGCTCGGAGTGG + Intronic
1001489236 5:172144129-172144151 GGGGAAACTGAGGTTTGGTGGGG + Intronic
1002200471 5:177524912-177524934 GGAGCCACTGAGGTTTGAGGGGG + Exonic
1002424391 5:179166824-179166846 GGGGCTACTGAGGGCAGGCGTGG - Intronic
1002437384 5:179239900-179239922 ATGGCGACTGAGGATTGGCAGGG + Intronic
1002455472 5:179343879-179343901 GGGGCCACTATGGAGTGGCAGGG - Exonic
1004114941 6:12757734-12757756 GGGGGCACGGAGGATTGGTCAGG + Intronic
1006611255 6:35295795-35295817 GGGGCAGCTGAGGAGTGGTGGGG - Exonic
1006881356 6:37342729-37342751 GGGGAAACTGAGGCTTGGAGTGG + Intergenic
1008638490 6:53436597-53436619 GGTGCCACTGAGAAGGGGCGTGG - Intergenic
1010270414 6:73910304-73910326 GGGGGCAGTGCGGATTGGGGAGG - Intergenic
1019415794 7:926019-926041 GGGGAGACTGAGGCTTGGAGGGG + Intronic
1019999192 7:4745236-4745258 ACGGCCAATGAGGACTGGCGAGG - Intronic
1022506760 7:30912377-30912399 GGGGACACTGAGGAACGGAGAGG + Intronic
1023057419 7:36301180-36301202 AGGGCCAGTGAGGTTTGGCTGGG - Exonic
1030401652 7:109059178-109059200 GGGGCCACTGTGGTTGGGGGAGG + Intergenic
1032077380 7:128842488-128842510 GGTGCCACTGAGGCTGGGCCGGG + Intronic
1032192416 7:129772535-129772557 GGGGGCACTTAGGATAGGAGAGG - Intergenic
1033172395 7:139095611-139095633 GGGCCCGCTGAGGATAGGGGAGG + Intronic
1033290600 7:140079541-140079563 TGGGCAACTGAAGATTGTCGAGG + Intergenic
1034968170 7:155404143-155404165 GGGGCCACTGAGGGGTGGGTGGG - Intergenic
1035737845 8:1901642-1901664 GGGGCCACTGAGCACAGCCGGGG - Intronic
1036642433 8:10592770-10592792 GGGCCCACTGAGGAATGGGCAGG - Intergenic
1037802518 8:22043302-22043324 GGAGGCACTGAGGTTTGGAGGGG + Intronic
1037823464 8:22147047-22147069 GGGGCCTCTGTGGACTGGTGGGG + Exonic
1040061129 8:43103681-43103703 GGGTCCACAGTGGATTGTCGAGG - Exonic
1040385816 8:46914350-46914372 GGGGCCACTGAGGTTTGTCTTGG - Intergenic
1042217373 8:66439555-66439577 GGGGCCTCTGGGGAGCGGCGCGG + Intronic
1045174277 8:99704644-99704666 GCAGCCACTGAGGATTGAAGTGG + Intronic
1045960835 8:107966043-107966065 GGGTCCAGTGAGGAGTGGCTTGG + Intronic
1049564152 8:143329243-143329265 GGGGCCACCGAGAACTTGCGAGG + Intronic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic
1053415185 9:37942947-37942969 GGGGCCCATGAGTACTGGCGAGG - Intronic
1053420636 9:37975363-37975385 GGGGTCACTCAGGCTTTGCGGGG - Intronic
1057211223 9:93202120-93202142 GGGGTGACTGAGGTTTGGTGTGG + Intronic
1058790488 9:108439704-108439726 GTGGCCACTGACCATTAGCGTGG - Intergenic
1059597165 9:115733634-115733656 GTGCCCTCTGAGGATTGGGGTGG - Intergenic
1060210871 9:121709392-121709414 GTGGCCACTCAGGATGGGCCAGG + Intronic
1060431160 9:123552381-123552403 AGGGGAACTGAGGATTGGAGAGG + Intronic
1060896885 9:127224411-127224433 GGGGCCACCGAGTTTGGGCGGGG + Intronic
1061948147 9:133920289-133920311 GGGGACACTGAGGCCTGGTGAGG - Intronic
1062143285 9:134972122-134972144 GAGGACACTGAGGAGTGGCAGGG - Intergenic
1189267805 X:39730134-39730156 GGGGCCTCTGAGGGTTGGCTGGG - Intergenic
1191194396 X:57705779-57705801 GGGGCCATTGAGGAAGGGGGAGG - Intergenic
1191748248 X:64513387-64513409 GGTGGCAGTGAGGATTGGGGAGG + Intergenic