ID: 1151350259

View in Genome Browser
Species Human (GRCh38)
Location 17:73527671-73527693
Sequence CGCTCCTCTGCACTGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151350259_1151350266 3 Left 1151350259 17:73527671-73527693 CCTCCTGGCAGTGCAGAGGAGCG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1151350266 17:73527697-73527719 ATGGAAGGAGGTAGGTGTGCCGG 0: 1
1: 0
2: 1
3: 45
4: 416
1151350259_1151350264 -9 Left 1151350259 17:73527671-73527693 CCTCCTGGCAGTGCAGAGGAGCG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1151350264 17:73527685-73527707 AGAGGAGCGTGGATGGAAGGAGG 0: 1
1: 0
2: 1
3: 47
4: 601
1151350259_1151350269 23 Left 1151350259 17:73527671-73527693 CCTCCTGGCAGTGCAGAGGAGCG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1151350269 17:73527717-73527739 CGGCTGAGAGTCTAGTTTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 71
1151350259_1151350265 -5 Left 1151350259 17:73527671-73527693 CCTCCTGGCAGTGCAGAGGAGCG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1151350265 17:73527689-73527711 GAGCGTGGATGGAAGGAGGTAGG 0: 1
1: 1
2: 2
3: 50
4: 826
1151350259_1151350267 20 Left 1151350259 17:73527671-73527693 CCTCCTGGCAGTGCAGAGGAGCG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1151350267 17:73527714-73527736 TGCCGGCTGAGAGTCTAGTTTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151350259 Original CRISPR CGCTCCTCTGCACTGCCAGG AGG (reversed) Intronic
900410242 1:2509385-2509407 CGCTGGTCTGCTCTGCCTGGTGG - Intronic
900462892 1:2809864-2809886 TGCTGCTCTGGACTCCCAGGAGG - Intergenic
900525721 1:3127700-3127722 CGGGCCTCTGCACCGCAAGGGGG - Intronic
900609733 1:3539454-3539476 AGCACCTCGGCCCTGCCAGGAGG + Intronic
901198250 1:7452248-7452270 CCCCCCTCCGCCCTGCCAGGAGG + Intronic
902726403 1:18339004-18339026 GGCTCCTCTGGAATGCCAAGGGG + Intronic
902854855 1:19194442-19194464 CGCTCCACTGCACTCCCACCTGG + Intronic
904593708 1:31629714-31629736 GGCTCCTCTCCACTGCCAGAGGG - Intronic
905772960 1:40650067-40650089 CCATCCCCTGCACTGCCATGAGG - Intronic
907281342 1:53349250-53349272 GGCTTCTCTGCACTCCTAGGGGG - Intergenic
909984707 1:82146677-82146699 TGGGCTTCTGCACTGCCAGGTGG + Intergenic
910251288 1:85201239-85201261 CGCCCCTCCGCACTCCCCGGAGG - Intergenic
912090366 1:106065903-106065925 CGCGCCACTGCACTCCCAGCTGG + Intergenic
917655526 1:177121893-177121915 AGCTGTTCTGCACTGCCAGCAGG - Intronic
920166743 1:204041493-204041515 CTCTTCTCTTCACTGCCACGGGG + Intergenic
920533600 1:206722971-206722993 ACCTCCTCTTCACTCCCAGGAGG - Intronic
1067069533 10:43121665-43121687 CACTGCTCTGCACTACCAGCAGG + Intronic
1069544455 10:69318690-69318712 CGCGCCTCTGCAACGCCCGGCGG - Intronic
1070778198 10:79122441-79122463 CCCTCCACTGCCCAGCCAGGTGG - Intronic
1071505517 10:86229260-86229282 TGCTCCTCTGCCCTGGGAGGAGG - Intronic
1071571531 10:86699922-86699944 CCCACCTCACCACTGCCAGGAGG - Intronic
1071819020 10:89261677-89261699 TTCTCCTCTGCACTGAGAGGGGG - Intronic
1073567372 10:104546667-104546689 CATTCCTCAGCACTGCCAAGGGG - Intergenic
1076363447 10:129906457-129906479 CCCCTCTCTGCACTGGCAGGGGG + Intronic
1076391202 10:130103764-130103786 CGCTCCACTGCACTGCAACCTGG + Intergenic
1076662656 10:132065696-132065718 CGCAGCTCTGCACGGCCGGGCGG - Intergenic
1077116099 11:885284-885306 CGCTCCTCAGACCTGCCAGGTGG - Intronic
1077242639 11:1518587-1518609 GGCTCGTCTGCACAGCCAGCCGG + Intergenic
1077551259 11:3201307-3201329 CCATCCTCTGCTCCGCCAGGAGG - Intergenic
1077724617 11:4661613-4661635 GGTTCCTCTTCACAGCCAGGAGG + Intergenic
1080756827 11:35208562-35208584 CCCTCTTCTGCACTGGCTGGAGG - Intronic
1082794088 11:57367675-57367697 CGCACCACTGCACTGCAATGTGG + Intronic
1083171510 11:60926157-60926179 CTCTCCTCTGCTCTGCCCGGTGG - Intronic
1083172774 11:60932949-60932971 CACACCCCTGCTCTGCCAGGAGG + Intronic
1083634400 11:64112468-64112490 CGCTCCACTGCACTCCCACCTGG + Intronic
1085837727 11:79974446-79974468 CCCTCCTCTGAATTGCAAGGTGG - Intergenic
1086831463 11:91570546-91570568 CGCTCCTCTTCCCTACTAGGTGG - Intergenic
1088521650 11:110708281-110708303 GACTCATATGCACTGCCAGGGGG + Intronic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1089069417 11:115688002-115688024 CACTCCTCTGCCATGTCAGGTGG - Intergenic
1089299815 11:117491944-117491966 GGCTAGTCTGCACTGCCAGGTGG + Intronic
1091358622 11:134957385-134957407 GGCCACTCTGCACAGCCAGGCGG - Intergenic
1091399438 12:173395-173417 CGGACCTGTGCACTCCCAGGGGG - Intronic
1092003105 12:5047279-5047301 TGCTCCTCTGCCATGCCAAGAGG - Intergenic
1092240305 12:6831941-6831963 CACCCCTCCGCACTCCCAGGAGG + Intronic
1092912655 12:13161248-13161270 CACTCCTCTCCTCTGCCAGTAGG + Intergenic
1096543474 12:52321620-52321642 CGCTCCACAGCAGTGCCAGTGGG - Intergenic
1096617464 12:52841986-52842008 GACTCCTCAGCTCTGCCAGGAGG + Intronic
1097292708 12:57932353-57932375 CGCACCTCTGCACTCCCACCTGG - Intergenic
1101065419 12:101015727-101015749 CACTCCCATGCACTGCTAGGGGG - Intronic
1101731537 12:107431270-107431292 GCCACCTCTGCACTCCCAGGAGG + Intronic
1102425444 12:112840631-112840653 TGCCCCTCTGCACTGCCCAGAGG + Intronic
1102707247 12:114892862-114892884 CTCTCTTCTGCAGTACCAGGAGG + Intergenic
1103447263 12:121002284-121002306 AGGTCCTGAGCACTGCCAGGAGG + Exonic
1103940889 12:124500643-124500665 GGCGCCTCTGCCCGGCCAGGTGG - Intronic
1105503171 13:20989463-20989485 CTCCCCTCTGCCCTGCCAGCAGG + Intronic
1106207763 13:27615515-27615537 AGCTCCTCTGCCCTCCCTGGAGG + Intronic
1108278730 13:48839737-48839759 AGCTCCTCTCCTCTTCCAGGAGG - Intergenic
1108559390 13:51627871-51627893 AGCTCCTCTCCACAGGCAGGTGG + Intronic
1109311815 13:60703825-60703847 CTCTCCTCTGAGCTGCCATGAGG - Intergenic
1109820795 13:67651316-67651338 CGCGCCACTGCACTCCAAGGTGG - Intergenic
1110572969 13:77026676-77026698 CGCTCCTCAGGAGTGCCGGGCGG - Intronic
1112739174 13:102454507-102454529 GCCTCCTCAGCTCTGCCAGGGGG - Intergenic
1113416519 13:110132657-110132679 GCCTCCTGTGCACTGGCAGGTGG - Intergenic
1113610333 13:111640217-111640239 TGCTCCTCTGCACTGCCATTTGG - Intronic
1113750072 13:112770758-112770780 CGCTTCCCTGGACTGCTAGGAGG + Intronic
1118614028 14:67562906-67562928 TGCTCCTCTGCCCAGCCCGGAGG - Intronic
1119539472 14:75428722-75428744 CGCGCTTCCTCACTGCCAGGAGG - Intronic
1119749459 14:77067123-77067145 CCCTGCTCTGCACCCCCAGGAGG + Intergenic
1120259498 14:82163758-82163780 CTCTTCTCAGCACAGCCAGGGGG - Intergenic
1125724407 15:41861014-41861036 CCCTCCTCTGCACTCCCTGGAGG + Intronic
1127217792 15:56843105-56843127 CCCTCCTCTGCACTGCTCTGTGG - Intronic
1127770157 15:62224356-62224378 CCCTCCCCTGCCCTGCCTGGTGG + Intergenic
1128062927 15:64746668-64746690 GGCACCTCTGCCCAGCCAGGTGG - Intronic
1128152734 15:65373347-65373369 CCTTCCCCTGCACTGCCGGGAGG + Intronic
1129268401 15:74407043-74407065 CCCTCCCCTGGAATGCCAGGAGG - Intergenic
1130699121 15:86161358-86161380 CTCTCATCTGCTCTGCAAGGCGG + Intronic
1131876131 15:96808042-96808064 CTCTTCTATGCACTGCCACGTGG - Intergenic
1132471587 16:106831-106853 CACTCTTCTGCACTGAGAGGAGG - Intronic
1136469253 16:30467941-30467963 CTATCATCTGTACTGCCAGGCGG - Intergenic
1136775797 16:32871151-32871173 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1136894820 16:33990361-33990383 CGCTCCTCTGGACTTCCCTGCGG + Intergenic
1137273581 16:46918815-46918837 GGCTCCTCTGCCCTGCCCCGTGG + Intronic
1138107637 16:54297816-54297838 AGTTCCTCTGCACTTGCAGGTGG - Intergenic
1138411177 16:56841582-56841604 CACTCCTCACCATTGCCAGGTGG - Intronic
1139590444 16:67930147-67930169 CGCTCCTCTGCGCTGTCCTGTGG - Intronic
1140479930 16:75256994-75257016 AGCCCCTCAGCACTGCCTGGGGG + Intronic
1141594147 16:85087236-85087258 GGCGCTTCTGCACTGCCAGAAGG + Intronic
1141901794 16:86995838-86995860 CGCTCCTCTGCCCTGCTGTGAGG + Intergenic
1203078213 16_KI270728v1_random:1133260-1133282 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1142601464 17:1054890-1054912 CCCTGCTCTTCACTGGCAGGTGG - Intronic
1146515176 17:33483482-33483504 CGGGGCTCTGCACTGGCAGGTGG + Intronic
1147338704 17:39741392-39741414 GGCTCCGCTGCAGTGCAAGGGGG - Intronic
1148921275 17:51036814-51036836 CCTTCCTCTGCCCTGCCTGGTGG + Intronic
1149754883 17:59178420-59178442 TGCTTCAGTGCACTGCCAGGGGG - Intronic
1151350259 17:73527671-73527693 CGCTCCTCTGCACTGCCAGGAGG - Intronic
1151690948 17:75685002-75685024 GGCTCCATTGCACTGCCAGAGGG + Intronic
1152407422 17:80105577-80105599 CCCTCATCTGCAGAGCCAGGAGG - Intergenic
1153816471 18:8794537-8794559 AGCGCCTCTCCACAGCCAGGCGG + Intronic
1154473699 18:14730543-14730565 AGCTCCTCTGTTCTGCCATGTGG + Intronic
1154496326 18:14963833-14963855 GGCCACTCTGCACAGCCAGGCGG + Intergenic
1155117598 18:22784436-22784458 CCTTCCCCTGCACTCCCAGGAGG + Intergenic
1155385532 18:25273181-25273203 CGCTCCTCTGTGCTCCCAAGAGG + Intronic
1156267818 18:35504139-35504161 TGCCACTCGGCACTGCCAGGAGG - Intergenic
1159143058 18:64420369-64420391 AGATCCGCTGCACTCCCAGGTGG + Intergenic
1159863289 18:73674453-73674475 GGCTACTCTAAACTGCCAGGAGG + Intergenic
1160474125 18:79167367-79167389 AGCTCCTCTCCACAGGCAGGTGG + Intronic
1160576388 18:79856656-79856678 CTGTCCTCTGCAGTCCCAGGCGG - Intergenic
1161579297 19:5071920-5071942 GGCTCCTCCGCATTGGCAGGTGG + Intronic
1162956344 19:14100737-14100759 GACTCCTCTGCATTCCCAGGGGG + Intronic
1163474283 19:17515929-17515951 ACCTCCTCTGCCCTGACAGGCGG + Intronic
1164854491 19:31510565-31510587 TGCTCCTCTGGACTCCCGGGTGG + Intergenic
1166569807 19:43786843-43786865 CCCTTCCCTGCACTGGCAGGTGG + Intergenic
1168266774 19:55227722-55227744 CTCTGCTCAGAACTGCCAGGAGG + Intronic
1168267410 19:55230387-55230409 CTCTCCTCTGGACCCCCAGGAGG - Exonic
927883438 2:26704678-26704700 ATCTCCTCTGCACGGGCAGGGGG - Intronic
928563828 2:32521510-32521532 CGCGCCACTGCACAGCCTGGGGG - Intronic
934568558 2:95353944-95353966 CCGTCCTGTGCACTGCCAGATGG - Intronic
935349906 2:102143734-102143756 TTCTCCTCTGCACTGCCGGGAGG + Intronic
936258526 2:110937134-110937156 AGCTCCTCTGCCCTTCCTGGAGG + Intronic
942241399 2:173965790-173965812 CGCTTCCCTGCGCTGCCAGGAGG + Intergenic
946045564 2:216818132-216818154 AACTGCTCTGCACTTCCAGGTGG - Intergenic
946624859 2:221600345-221600367 CACTCCGCTGCACTGCATGGGGG - Intergenic
948777386 2:240296799-240296821 CGGTCCTCTGCACTGACACAGGG - Intergenic
948825501 2:240571805-240571827 CGCTCCTGTCCCCTGCCAGCAGG + Intronic
1169199620 20:3701982-3702004 TGCTGCTCTGCCCTGTCAGGAGG - Intronic
1169315641 20:4588335-4588357 CACCCCTCTGCACCCCCAGGAGG + Intergenic
1169515463 20:6311817-6311839 CTCTCTTCTACACTCCCAGGTGG + Intergenic
1169518307 20:6342619-6342641 CTCACCCCTGCACTGCCAGATGG + Intergenic
1170685133 20:18562826-18562848 CGCACCACTGCACTCCCTGGGGG + Intergenic
1172061148 20:32188315-32188337 CTCTCCTGTGCATTGGCAGGTGG + Intergenic
1172858258 20:38025076-38025098 CGTACCTCATCACTGCCAGGTGG - Intronic
1174141114 20:48414421-48414443 CGATGCTCTGCACAGCCTGGAGG + Intergenic
1175171613 20:57085084-57085106 CGCACCTCAGCATTGCCAGTAGG - Intergenic
1175545133 20:59773166-59773188 CGCTCCCCTGCACCTCCAGGAGG - Intronic
1176125786 20:63473843-63473865 CCTTCCTCTGCACATCCAGGAGG + Intergenic
1176261351 20:64182497-64182519 CCTGCCTCTGCACAGCCAGGAGG - Intronic
1177024526 21:15905699-15905721 CACTCCACTGCCCTGCCTGGAGG + Intergenic
1177185861 21:17795516-17795538 CGCACCACTGCACTGCCACCTGG - Intronic
1179874170 21:44259192-44259214 CGCTCCCCTGCACAGCGATGTGG + Intronic
1181349161 22:22243213-22243235 CCCTCCTCTGCACAGGCTGGTGG - Intergenic
1181410308 22:22713696-22713718 GGCTTCTCAGCAGTGCCAGGTGG - Intergenic
1181482342 22:23208229-23208251 TGCTCTCCTGCACTGCCAGCCGG - Intronic
1181688536 22:24545300-24545322 CACTCCTGTGCACTGCCACTGGG - Intronic
1182079504 22:27518915-27518937 GGCTCCCCTGCACAGCCTGGGGG - Intergenic
1182760777 22:32720856-32720878 GGCTCCTCTTAACTGCCAGTGGG + Intronic
1184086250 22:42267221-42267243 CGCACCACTGCACTCCCAGCTGG + Intronic
1184097181 22:42322819-42322841 CGAGCCTCCCCACTGCCAGGAGG - Intronic
1184098882 22:42331160-42331182 CGCTCCGCGGCGCTGCCGGGAGG - Intronic
1185416769 22:50714901-50714923 AGCTTCTCTGCACAGCAAGGAGG - Intergenic
949318773 3:2785939-2785961 CGCCTCTCTGCTCTGCCAGTGGG - Intronic
954149974 3:48652465-48652487 GCCTCCTCTGCACTGCCGGGGGG + Exonic
960151301 3:114251467-114251489 CTCTCCTCTCCCCTGACAGGTGG + Intergenic
963042310 3:141078756-141078778 CCCTCCGCTGCAGTTCCAGGAGG + Intronic
969248658 4:5953107-5953129 CACTCCTCTGCTATGGCAGGAGG - Intronic
970191618 4:13523766-13523788 GGCTGCGCTGTACTGCCAGGTGG + Intergenic
973074043 4:45900663-45900685 CGCTCGGCTGCACTACCTGGAGG - Intergenic
976527829 4:86114740-86114762 CCCTCATCTGGACTGCCAGCAGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
979459191 4:120961388-120961410 CACTCCTCTCCACTTCCATGGGG - Intergenic
981532074 4:145762691-145762713 GGCCCCTCTGGACAGCCAGGAGG - Intronic
983485885 4:168331148-168331170 GCCTCCTTAGCACTGCCAGGGGG + Intergenic
985651493 5:1109751-1109773 TGATCCTAGGCACTGCCAGGTGG - Intronic
985721147 5:1489903-1489925 CGTTCCTCAGCCCTGCCTGGCGG - Intronic
985826185 5:2193262-2193284 TCCTCCTCAGCACTGCCAGGAGG - Intergenic
987140149 5:14937671-14937693 CCCTCCTCTGCACTGGCCAGGGG - Intergenic
987999637 5:25331401-25331423 AGCTCCTCTCCACAACCAGGTGG - Intergenic
991114261 5:62935851-62935873 CGCTGCCCTGCACTCCCATGTGG - Intergenic
992194823 5:74328691-74328713 TGCCCCTCTGCTCTGACAGGTGG - Intergenic
993857836 5:93097754-93097776 AGCTCCTCTCCTCTCCCAGGAGG + Intergenic
995685454 5:114766905-114766927 CGCTCATCAGAACTGCTAGGAGG - Intergenic
999796051 5:154990744-154990766 CACTTCACTGCTCTGCCAGGAGG + Intergenic
1001960994 5:175880348-175880370 CCCTGCTCCCCACTGCCAGGAGG + Exonic
1002929337 6:1622621-1622643 GCCTTCTCTGCACTCCCAGGCGG - Intergenic
1003260957 6:4515743-4515765 CACTTCTCTGCAGTGCCATGGGG + Intergenic
1004715549 6:18213390-18213412 CGCTCCATTGCACTCCCAGCTGG + Intronic
1011133591 6:84076103-84076125 CGCACCACTGCACTGCCACCTGG - Intronic
1011510527 6:88095327-88095349 CTCTCCTGTGCACTGACAAGTGG - Intergenic
1015143201 6:129958446-129958468 GGCATCTCTGCACTGTCAGGTGG + Intergenic
1016968367 6:149739949-149739971 CACTCCTCTACACTGCCACCAGG + Intronic
1018053957 6:160035823-160035845 CGCTCCGCTGCTTTACCAGGAGG + Intronic
1018693415 6:166368878-166368900 CACTCCTCTGCACTGTATGGTGG + Intronic
1019912632 7:4110043-4110065 CCCTCGTCAACACTGCCAGGAGG + Intronic
1022504112 7:30899984-30900006 CTCTCCTCTGCCCTGCTTGGGGG - Intergenic
1022840004 7:34155169-34155191 CCCTGCTCTGCCCTGACAGGAGG + Exonic
1027054716 7:75042307-75042329 GGCTCAGCTGCAGTGCCAGGCGG - Exonic
1027187697 7:75981769-75981791 CGTTGCTCTGCACTGCCCTGGGG + Intronic
1028267435 7:88743797-88743819 CGCTCCACTGCACTCCCGGCTGG - Intergenic
1028941363 7:96525748-96525770 CGCGCCTCTGATCTGACAGGAGG - Intronic
1033252044 7:139768788-139768810 TGCTAGGCTGCACTGCCAGGTGG - Intronic
1034188755 7:149197809-149197831 CGCCTCCCTGCACTGCCAGCTGG - Intronic
1034427024 7:151019311-151019333 CGCTCCGCTGCAGTGCCAAGAGG + Exonic
1035242597 7:157542064-157542086 CTCCCCTCTGCACTGCCAGAGGG + Intronic
1036649003 8:10630173-10630195 CCCTCCACTGCACTCCCAGCTGG - Intronic
1037761280 8:21743375-21743397 GGCTGCTCTGCAATGCCAGCAGG + Intronic
1037916374 8:22775727-22775749 CCCTCCTGTGCACTCACAGGAGG + Intronic
1039943450 8:42110503-42110525 CCCTCCTCTGTACTGACTGGTGG - Intergenic
1042439648 8:68810789-68810811 AGCTCCTCTCCACAGACAGGTGG + Intronic
1043519915 8:81033852-81033874 CCCTCCTCAGCACTGCCAGCGGG - Intronic
1045331771 8:101161581-101161603 AGCTCCTCTTCTCTCCCAGGAGG - Intergenic
1048291479 8:133184819-133184841 CACACATCTGCACTGCCGGGAGG + Intergenic
1049048951 8:140176499-140176521 CGTTTCTCTCCACTGCCACGTGG + Intronic
1049474566 8:142790693-142790715 CTCTTTCCTGCACTGCCAGGGGG + Intergenic
1049755331 8:144309025-144309047 CGCACCCCTGCGCTGCCTGGAGG - Intronic
1050584118 9:7092317-7092339 CTCTCCTTTACTCTGCCAGGTGG + Intergenic
1050700138 9:8329561-8329583 CGCTCATCAGAGCTGCCAGGTGG + Intronic
1057908081 9:98997735-98997757 TGCTCCTCTGCACAGGTAGGGGG - Intronic
1059649639 9:116303708-116303730 AGCTCATCTGCAAGGCCAGGAGG - Intronic
1060407422 9:123379767-123379789 AGCCCCTCAGCACAGCCAGGGGG + Exonic
1061087115 9:128405686-128405708 CGCTCCCATCCACTGCCAGCAGG - Intergenic
1061913126 9:133735279-133735301 CCCTACTCTGCAATCCCAGGTGG - Intronic
1062138657 9:134943596-134943618 CACTCCTGGGCTCTGCCAGGTGG + Intergenic
1062491858 9:136808576-136808598 CGCTCCACTGCACAGCGCGGCGG - Intronic
1062619937 9:137416182-137416204 CGCTCTTCTGCAGTGCCTGAGGG + Intronic
1187798748 X:23035663-23035685 CCCTCATCTGCACCGCCAAGTGG + Intergenic
1188838978 X:34991625-34991647 CGCTGGGCTGCACTCCCAGGAGG - Intergenic
1189167804 X:38878642-38878664 AGCTCTTGTGCACTGCCAGTGGG - Intergenic
1189245514 X:39560486-39560508 AGCTGATCTGCACTGCCAGAGGG - Intergenic
1191813405 X:65216667-65216689 CCCTGCACTGCACTGCCTGGTGG - Intergenic
1197030067 X:121802764-121802786 CATTCCTCTGAACTACCAGGAGG + Intergenic
1197342227 X:125287745-125287767 AGCTCCTCTCCACAGGCAGGTGG - Intergenic
1198313113 X:135438834-135438856 CTCTCCTCAGCACTGCCAGTGGG - Intergenic