ID: 1151351261

View in Genome Browser
Species Human (GRCh38)
Location 17:73533478-73533500
Sequence GTCCCTGGACACAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 3, 2: 14, 3: 87, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151351252_1151351261 12 Left 1151351252 17:73533443-73533465 CCCAGCAAGAGTGCAAACAGTCT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG 0: 1
1: 3
2: 14
3: 87
4: 452
1151351253_1151351261 11 Left 1151351253 17:73533444-73533466 CCAGCAAGAGTGCAAACAGTCTG 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG 0: 1
1: 3
2: 14
3: 87
4: 452
1151351251_1151351261 28 Left 1151351251 17:73533427-73533449 CCACACAGGTTTGTGTCCCAGCA 0: 1
1: 0
2: 3
3: 27
4: 278
Right 1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG 0: 1
1: 3
2: 14
3: 87
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151351261 Original CRISPR GTCCCTGGACACAGGCCCTG AGG Intronic
900423697 1:2566694-2566716 GTCCCTGGGCCCAGGTCATGGGG - Intergenic
900555367 1:3277583-3277605 GTCCCTGGACAACGTCCCAGGGG - Intronic
900867140 1:5276602-5276624 TGCCCTGAACACATGCCCTGTGG + Intergenic
901045233 1:6392327-6392349 GCCACTGCACACAGGCTCTGTGG - Intronic
901061394 1:6473510-6473532 GGCCCTGGAAACCCGCCCTGGGG - Intronic
901815188 1:11789737-11789759 GTCACTGCCCCCAGGCCCTGGGG + Exonic
903350362 1:22713052-22713074 GGCCCTGGACACAGGGCTGGTGG + Intronic
903408948 1:23123699-23123721 CTCCCTGCTCTCAGGCCCTGAGG + Intronic
903542921 1:24107029-24107051 GTCGCAGGTCCCAGGCCCTGGGG + Intronic
903734713 1:25522797-25522819 GTCCTAGGACCCAGGCCCTCTGG - Intergenic
904330837 1:29757019-29757041 GGCCCTGGACCCAGGCTCCGAGG - Intergenic
904415831 1:30360545-30360567 GGCCCTGGACCCAGGCCCTGGGG + Intergenic
904433666 1:30480411-30480433 GACCCTGGACACATCCCTTGGGG - Intergenic
904860831 1:33536598-33536620 CCACCAGGACACAGGCCCTGCGG - Intronic
905886108 1:41493068-41493090 GCCCCTAGACTCAGGCCCTGAGG - Intergenic
906033084 1:42735580-42735602 ATCCCTGGAGACAGGCCCTCAGG - Intronic
906212864 1:44021835-44021857 GTCTCTAGACACAGCCTCTGAGG - Intronic
906215371 1:44035206-44035228 CAGCCTGGTCACAGGCCCTGTGG + Intergenic
906297501 1:44658210-44658232 GTCCCTCTACACACTCCCTGGGG + Intronic
906551751 1:46671336-46671358 TTCCCAGGCCCCAGGCCCTGTGG - Intronic
906567625 1:46812225-46812247 GTTCCTGGACCCAGGCTTTGTGG + Intronic
906645681 1:47472638-47472660 GTCCCTGGATAGAGTACCTGGGG - Intergenic
907311868 1:53543421-53543443 GGCCCTGGGCTCAGGCCCTCTGG - Intronic
909789560 1:79658466-79658488 ATCCCTGCACACATGCCCTTTGG + Intergenic
912553849 1:110501861-110501883 GTCCCTGGAGCAAGGACCTGAGG + Intergenic
914446944 1:147758410-147758432 GTGCCTGGAGAATGGCCCTGGGG - Exonic
915016972 1:152743539-152743561 CTCCCTGGACAGAGGCCAAGAGG - Intronic
915268383 1:154734527-154734549 CTCGCTGGGCACAGACCCTGTGG - Intronic
916140586 1:161693655-161693677 CTCCCTGGACAGAGCACCTGAGG + Intergenic
916284653 1:163093400-163093422 GTCCATGGGCACAGGCCCTGGGG - Intergenic
917485633 1:175452380-175452402 AACCCTGGAAACAGGGCCTGGGG + Intronic
919044693 1:192435897-192435919 TTCCCAGGAAACAGGCTCTGAGG - Intergenic
919539177 1:198827814-198827836 GTCCCTGGGCACAGGACTAGGGG + Intergenic
921821399 1:219621185-219621207 GACCCAGCACACAGGTCCTGGGG + Intergenic
921890941 1:220353168-220353190 GTCCGTGCCCACAGGCCCGGAGG - Intergenic
922886664 1:229025548-229025570 GTCGCAGGACATAGGCCCTGGGG + Intergenic
923246306 1:232136265-232136287 GTTCCTGGACACGGGACCTGGGG + Intergenic
923653819 1:235898311-235898333 ATCCCAGGACACAGGCCCGAGGG - Intergenic
1063125414 10:3132734-3132756 GTCTTGGGACACAGTCCCTGAGG - Intronic
1065852976 10:29806013-29806035 GTCCCTGGAAACAGGGGCAGGGG + Intergenic
1066011930 10:31202253-31202275 GTCAGTGGACAGAGGCTCTGAGG - Intergenic
1066616660 10:37301765-37301787 GTGCCTGAATACATGCCCTGTGG - Intronic
1067508664 10:46877342-46877364 GCCCATGGACACAGGGCCAGCGG - Intergenic
1067653585 10:48174508-48174530 GCCCATGGACACAGGGCCAGCGG + Intronic
1067658152 10:48212821-48212843 TTCCCTGAACACAGACTCTGGGG + Intronic
1068310341 10:55266479-55266501 GTCCATGGGCACAGGCCCATGGG - Intronic
1069633870 10:69913753-69913775 GTCCCTGGAGACAAGCCCCAGGG + Intronic
1069825511 10:71252993-71253015 TGTCCTGGACACAGGTCCTGGGG - Intronic
1070161902 10:73871973-73871995 GAGCCAGGACACATGCCCTGGGG - Intronic
1070599197 10:77853933-77853955 GCCCCTGGACAGAGACCCAGAGG + Intronic
1070784625 10:79155822-79155844 CTCCCTGGGCAAAGGCCCAGAGG - Intronic
1071220364 10:83458707-83458729 GTCCGTGGGCACCGGCCCTGGGG - Intergenic
1071570210 10:86692576-86692598 GTGCCTGGACTCAGGCTCTGTGG + Intronic
1071924393 10:90389197-90389219 GTTCCTCAACACAGGTCCTGGGG - Intergenic
1072664732 10:97384899-97384921 CAGCCTGGACACAGGCCCTAAGG + Intronic
1072664757 10:97384975-97384997 CAGCCTGGACAGAGGCCCTGAGG + Intronic
1072664769 10:97385012-97385034 CAGCCTGGACACAGGCCCTAAGG + Intronic
1073836007 10:107443749-107443771 GTCCGTGGGCACAGGCCCCGGGG - Intergenic
1074783503 10:116819108-116819130 GTCACGGGACACAGGGCTTGGGG - Intergenic
1075065171 10:119284597-119284619 GCCCCTGGACACAGAAGCTGAGG - Intronic
1075119749 10:119655866-119655888 GAGCCTGTACACAGGACCTGCGG + Intronic
1075388235 10:122073238-122073260 GTGTCTGTACACAGGGCCTGGGG + Intronic
1075691009 10:124394151-124394173 ACCACTGGACATAGGCCCTGAGG + Intergenic
1076096179 10:127736618-127736640 GGGCCTGGACAGCGGCCCTGGGG - Intergenic
1076484265 10:130805772-130805794 GACCCGGGACACAGACCCAGAGG + Intergenic
1076701519 10:132275613-132275635 GCCCCTGGCCACTGGCCCCGTGG - Intronic
1077006556 11:360620-360642 GTCCACGGAGCCAGGCCCTGAGG + Intergenic
1077034965 11:490117-490139 GTCCCTTGGCACAGGCACTGTGG + Intronic
1077100178 11:819172-819194 GTCCCTGGACAGAGGCGCACCGG - Intronic
1077118371 11:895671-895693 GGCCCTGGACAGAGGCTCAGGGG - Intronic
1077372979 11:2192361-2192383 GTCCCCAGCCATAGGCCCTGTGG + Intergenic
1077586762 11:3459707-3459729 GTCCGTGGGCACAGGCCCTGGGG + Intergenic
1078736413 11:14024730-14024752 GTCCATGGGCACAGGCCCAAGGG + Intronic
1079766911 11:24405910-24405932 GTCTCTGGGCACAGGCCCGAGGG - Intergenic
1081075517 11:38668134-38668156 GTCCATGCGCACAGGGCCTGAGG + Intergenic
1081649146 11:44812017-44812039 TTCGGTGGAAACAGGCCCTGTGG + Intronic
1083388919 11:62333850-62333872 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1083723954 11:64618824-64618846 GTCCCTGGGCCCAGGCCCATGGG + Intronic
1083731258 11:64653831-64653853 GTCCCCGGAAAGTGGCCCTGGGG - Intronic
1084206130 11:67594172-67594194 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1084430537 11:69108315-69108337 CATCCTGGACAAAGGCCCTGAGG - Intergenic
1084979048 11:72819076-72819098 GACTGTGGACACAGGCCCTAAGG - Intronic
1085315734 11:75543804-75543826 GTCTATAGGCACAGGCCCTGGGG + Intergenic
1087462009 11:98457096-98457118 GTTCGTGGGCACAGGCCCGGGGG + Intergenic
1088221074 11:107570434-107570456 TTCCCTGGGCACAGGCCTGGGGG + Intergenic
1088250534 11:107858088-107858110 TTCCCTGGACCCCAGCCCTGGGG + Intronic
1088507370 11:110539639-110539661 GTCCATGGGCACAGGCCCGAGGG + Intergenic
1089122056 11:116144493-116144515 GTCCATGGGCACAGGCCAGGAGG - Intergenic
1089342043 11:117764681-117764703 CTTCCTGGGCGCAGGCCCTGGGG + Intronic
1089588205 11:119523306-119523328 CACCCTGGACTAAGGCCCTGAGG + Intergenic
1090628047 11:128622907-128622929 CTCCCTGGACACACTCCCTTCGG + Intergenic
1090660052 11:128875723-128875745 ACCCCTCCACACAGGCCCTGTGG + Intergenic
1090733506 11:129591577-129591599 GTCCCTGGACACTGGACTTCAGG + Intergenic
1092412998 12:8268440-8268462 GTCCGTGGGAACAGGCCCTGGGG + Intergenic
1093112969 12:15174962-15174984 GTCAATGGAAACTGGCCCTGAGG - Intronic
1096185999 12:49580968-49580990 GACCCTTGAGGCAGGCCCTGGGG - Intronic
1096414496 12:51401744-51401766 GTCCCTGGGCACAGGCCTGGGGG + Intronic
1096475585 12:51907217-51907239 GGCCTTGGACTCAGGCCGTGGGG - Intronic
1098697753 12:73581094-73581116 GTCCATGGGCACAGGCCCGAGGG - Intergenic
1099055453 12:77834174-77834196 GTCCATGGGCACAGGCCCAGGGG + Intronic
1099253674 12:80289508-80289530 CTCCCTGGACAGAGCACCTGCGG - Intronic
1101455115 12:104824132-104824154 GTCCATGGGCACAGGCCCGGGGG - Intronic
1101455701 12:104827962-104827984 GTCCATGGGCACAGGCCTGGGGG - Intronic
1101725657 12:107386108-107386130 GTGCCAGGGCAAAGGCCCTGAGG - Intronic
1102033734 12:109759338-109759360 GTCCCATATCACAGGCCCTGTGG + Intronic
1102252518 12:111397162-111397184 GTCCCAGGCATCAGGCCCTGAGG - Intergenic
1103224324 12:119274093-119274115 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1103233978 12:119356576-119356598 GTCCCCAGATACAGGCACTGTGG + Intronic
1103352058 12:120290916-120290938 GTCCATGGACAGAGGTCCTCAGG - Intergenic
1103991176 12:124800400-124800422 GTCCCTCATCACAGGGCCTGGGG - Intronic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1106016101 13:25870378-25870400 GTCCCTGGACACAGGCCTGGGGG + Intronic
1106510639 13:30409488-30409510 GAACCAGGATACAGGCCCTGCGG + Intergenic
1109140726 13:58711740-58711762 GTCCATGGGCACAGACCCAGGGG - Intergenic
1109151774 13:58856991-58857013 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1109152502 13:58861270-58861292 GTCCATGGCCACAGGCCCAGGGG + Intergenic
1109172945 13:59118312-59118334 GTCCATGGGCACCGGCCCAGGGG + Intergenic
1110484333 13:76020121-76020143 GTCCCTGAGCACAGGCCTGGGGG + Intergenic
1110964579 13:81676465-81676487 GTCCTTGGGCACAGGCCCAAGGG + Intergenic
1111217163 13:85159444-85159466 GTCCGTGGACAGAGGCCCGGGGG - Intergenic
1111343996 13:86924860-86924882 GTCCCTGGGCACAGGCCTGGGGG + Intergenic
1112058852 13:95716915-95716937 GTCCGTGGGCACAGGCCCAAGGG + Intronic
1112705219 13:102060759-102060781 GTCCATGGGCACAGGCCCGAGGG - Intronic
1112784136 13:102933384-102933406 GTCCTTGGCCACAGTCTCTGCGG + Intergenic
1112836100 13:103515891-103515913 CTTCCTGGACACTGGCCCTGTGG + Intergenic
1112929186 13:104713731-104713753 GTCCATGGACGCAGGCCCAAGGG - Intergenic
1114633905 14:24176908-24176930 TCCCCTGCACACAGGGCCTGAGG + Intronic
1114670213 14:24407000-24407022 TCCCCTGGACACTGGCCCAGTGG + Intronic
1114674624 14:24431960-24431982 GTCCCTGGACACTGGATCTATGG + Exonic
1114996881 14:28365172-28365194 GTCCCTGGGCACAGGCCCAAGGG - Intergenic
1115013002 14:28572968-28572990 GTCCATGGGCACAGACCCAGGGG + Intergenic
1115748298 14:36460925-36460947 GTGCCAGGACTCAGGCACTGGGG + Intergenic
1118487131 14:66224779-66224801 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1118807903 14:69253681-69253703 GTCCCTGGACCCAGTCTCTTAGG - Intergenic
1119265297 14:73260632-73260654 ATCCCAGGACCCAGGCTCTGAGG - Intronic
1120079720 14:80202212-80202234 GTCCTTGAACCCAGGCCATGTGG - Intronic
1120744631 14:88142536-88142558 GTCCATGGGCACAGGCCCAGAGG - Intergenic
1120855099 14:89205379-89205401 GTCCTTGGGCACAGGCCCAAGGG - Intronic
1121437990 14:93931541-93931563 GTCCCTGCTCACAGCCCCAGGGG + Intergenic
1121475715 14:94200002-94200024 GTCCGTGGGCACAGGCCCAGGGG + Intronic
1122141211 14:99664134-99664156 GTTCCTGGACAAAAGCCCAGGGG + Intronic
1122447522 14:101780891-101780913 GTCCCTGGACTCTGGGTCTGGGG - Intronic
1122611420 14:102985913-102985935 GGCTCAGGCCACAGGCCCTGTGG - Intronic
1122628956 14:103098779-103098801 GTCCCTGAACCCTGGCGCTGGGG + Intergenic
1122971896 14:105155667-105155689 GGCCCCGGGCACAGGCCTTGCGG - Intronic
1123026636 14:105427418-105427440 GTCCCTGGACACAGGCAGGCTGG + Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123824075 15:24063395-24063417 GTTCATGGGCACAGGCCCAGGGG + Intergenic
1124631496 15:31340081-31340103 GACCCTGGAAACAGGCCTAGAGG - Intronic
1125446849 15:39767489-39767511 GTCCATGGGCACAGGCCCAAGGG - Intronic
1125749980 15:42021468-42021490 GTCCCTGGCCACAGCTCCTGGGG - Intronic
1125759206 15:42085440-42085462 GTCTCAGGACTCAGGCTCTGAGG - Intronic
1128326225 15:66725886-66725908 CTCGGAGGACACAGGCCCTGAGG - Intronic
1128372272 15:67049108-67049130 GCCCCTGGTCACATGCTCTGTGG + Intergenic
1129270136 15:74415229-74415251 CTCCCTGGGCACAGGCTGTGGGG + Intronic
1130051832 15:80490297-80490319 GTCACTGGTCGCAGGCCTTGAGG + Intronic
1130312600 15:82768272-82768294 CTGCATGAACACAGGCCCTGGGG - Intronic
1130682767 15:86010823-86010845 GTCCGTGGGGACAGGCCCAGGGG + Intergenic
1131445394 15:92494583-92494605 GTCCCTGTGCACATGCCTTGTGG - Intronic
1131484650 15:92809580-92809602 GTTCATCGACCCAGGCCCTGCGG + Intronic
1132018439 15:98339361-98339383 GTCCCAGGATCCAGGGCCTGCGG + Intergenic
1132498465 16:274665-274687 GTCCCTAGGCCCAGGTCCTGAGG - Intronic
1132578524 16:674830-674852 GTCCCAGAAGACAGGCCGTGGGG - Intronic
1132752473 16:1465145-1465167 TTCCCTGAACCCCGGCCCTGGGG + Intronic
1132849855 16:2020107-2020129 GTCCCTGGCCAGGGGCCCGGCGG - Exonic
1132858476 16:2058059-2058081 ATCCTTGGAACCAGGCCCTGGGG + Intronic
1133354199 16:5123945-5123967 GTCCGTGGGCAAAGGCCCTGGGG + Intergenic
1135166315 16:20142117-20142139 GTCTCTGGACGAAGGCTCTGTGG - Intergenic
1139017802 16:62711392-62711414 GTCCGTGGGCACAAGCCCTGAGG - Intergenic
1139064077 16:63291294-63291316 GTCCGTGGGCACAGGCCCAGGGG - Intergenic
1139357680 16:66377118-66377140 CTCACTGGACCCAGACCCTGTGG - Intronic
1139436330 16:66938673-66938695 GTCAGTGGACACAGTGCCTGTGG - Intronic
1140838882 16:78820620-78820642 TTCCCTGAAGACAGGCCCTGTGG - Intronic
1141503494 16:84460462-84460484 GCCCATGGACCCAGGCTCTGGGG + Intronic
1141767304 16:86067090-86067112 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
1141797840 16:86286777-86286799 GTCCCTGGACCCAAGTCCCGTGG - Intergenic
1141909357 16:87047986-87048008 GGCCCTGCACACAGGCCCCTGGG + Intergenic
1142160050 16:88552658-88552680 GTCCCTAGCCCCAGGACCTGTGG + Intergenic
1142219831 16:88848702-88848724 GTCACTTCACACAGGCCCCGAGG - Intronic
1142239360 16:88938167-88938189 TCACCTGGATACAGGCCCTGGGG - Intronic
1142725470 17:1810618-1810640 GTCAGTGGACACAGGCCCAAGGG - Intronic
1143146619 17:4780783-4780805 ATCCCCGGACACAGTACCTGTGG - Exonic
1143465608 17:7134269-7134291 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1144320893 17:14118232-14118254 GTCCATGGACACAGGCCTGAGGG + Intronic
1144331514 17:14228321-14228343 GTCCATGGTCACAGGGCATGTGG + Intergenic
1145159174 17:20563006-20563028 CTTCCTAGACACAGGCTCTGGGG + Intergenic
1145205271 17:20981489-20981511 AGCCCTGCTCACAGGCCCTGTGG - Intergenic
1145208673 17:20997563-20997585 GGCCTGGGACTCAGGCCCTGGGG - Intergenic
1145768187 17:27473718-27473740 GTCCCTGGGGAGAGTCCCTGTGG + Intronic
1145778016 17:27543102-27543124 GTCCCTGTCCACACACCCTGTGG + Intronic
1145971728 17:28960280-28960302 CTGCCTGGACCCAGGCCCTATGG - Intronic
1146575317 17:33985894-33985916 GACCCAGGCCAAAGGCCCTGAGG - Intronic
1147189710 17:38731306-38731328 TTCCCTGGCCACAGGCCCAGTGG + Exonic
1147921599 17:43920636-43920658 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1148055740 17:44794261-44794283 GTCTCTGGTCCCAGACCCTGCGG + Intergenic
1150489326 17:65563544-65563566 GTCCCTTGTCACAGTCCCTTAGG - Intronic
1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG + Intronic
1151402402 17:73864397-73864419 GCCTCTGGAAACAGGCCCAGGGG + Intergenic
1151455388 17:74222664-74222686 GTCCCTGGACGCTGGGCTTGGGG + Intronic
1151697105 17:75723329-75723351 GTCCCTGGCCACAGCCCCTCAGG - Intronic
1151815838 17:76471013-76471035 CTCCCTGGGAGCAGGCCCTGGGG + Exonic
1152000873 17:77644658-77644680 GTCCAAGGACACAGGCCATCTGG + Intergenic
1152149292 17:78588991-78589013 GTCTCTGCACACAGGTCCTAAGG + Intergenic
1152457664 17:80425478-80425500 CTTCCTTGTCACAGGCCCTGAGG + Exonic
1152460344 17:80439065-80439087 GAGGCAGGACACAGGCCCTGGGG - Intergenic
1152685414 17:81691406-81691428 GGGCCTGGTCACAGGCACTGGGG - Intronic
1152748967 17:82053802-82053824 GACCCTGGCCCCAGGCCCTGAGG - Intronic
1152922681 17:83073723-83073745 GTCCGTGGAGACTCGCCCTGTGG + Intergenic
1152931760 17:83113598-83113620 GCCCCTGGACACCGGCCCTCCGG - Intergenic
1155274005 18:24168717-24168739 GTTCCTGAACACAGACGCTGCGG - Intronic
1155791152 18:29972017-29972039 GTTCCTGGGCACAAGCCCAGCGG + Intergenic
1156263751 18:35467835-35467857 GACAGTGGAAACAGGCCCTGGGG - Intronic
1156456959 18:37300106-37300128 GACCCTGGACACCTGGCCTGGGG + Intronic
1157200969 18:45659215-45659237 GTCCCTGGGCTCAGGCCCTCTGG + Intronic
1159416191 18:68152400-68152422 GTCCGTGGGCACAAGCCCAGGGG - Intergenic
1159721733 18:71899343-71899365 GTACATGGGCACAGGCCCGGGGG + Intergenic
1160190482 18:76710764-76710786 TGCCCAGGACACAGGCCCTCAGG - Intergenic
1161296720 19:3523886-3523908 GTCCCGGGACCCAGGCTTTGGGG - Intronic
1161341579 19:3746005-3746027 GGTCCTGGACACAGTCTCTGTGG - Exonic
1161733069 19:5974041-5974063 GTCTCCTGACACAGCCCCTGGGG - Intronic
1161855219 19:6760729-6760751 GTCCCAGGCCACAGGGGCTGTGG - Exonic
1163158232 19:15450148-15450170 CTCCCTGGACTCAGGCCGTGCGG - Intergenic
1164248791 19:23458790-23458812 ATCCCTGGACACAGGGCCTAAGG + Intergenic
1165059259 19:33196833-33196855 GTCCCTGAAGACAGGCCTTCAGG + Intronic
1165735159 19:38171217-38171239 GCCACTGAACACAGGCCCTTGGG + Intronic
1166621679 19:44306619-44306641 GTCCGTGGCCACAGGCCTGGGGG + Intergenic
1167550037 19:50154087-50154109 CTCCCTAGGCACAGGGCCTGGGG + Intronic
1167777913 19:51573360-51573382 TTCTCTGGACCCAGGACCTGAGG - Exonic
1168081618 19:54014362-54014384 GTCCATGGGCACAGGCCCTAGGG + Intergenic
925034091 2:672776-672798 GGACCTGGTCACAGGCCCGGGGG + Intronic
925049230 2:798221-798243 GTCCATGGACACAGGCCCGAGGG + Intergenic
925092452 2:1166654-1166676 GTCCATGGGCACAGGCCTGGGGG - Intronic
925148079 2:1594426-1594448 GCTCCTGCAGACAGGCCCTGAGG + Intergenic
925720334 2:6820992-6821014 GACCATGGACACAGGGACTGAGG + Intergenic
925839747 2:7980198-7980220 GTCAATGGGCACAGGCCCAGGGG - Intergenic
926108236 2:10165849-10165871 GTCCCTGTGCACATGCCCCGTGG + Intronic
926309595 2:11665964-11665986 GTCCATGGTCACAGCCTCTGAGG + Intronic
926961759 2:18365018-18365040 GTCTATGGGCACAGGCCCGGGGG + Intergenic
927153153 2:20207069-20207091 GGCCCTGGCCACAGGCCCACGGG + Intronic
928462162 2:31485194-31485216 CTCCCTGGACACAGCCCCCAGGG - Intergenic
928537987 2:32258451-32258473 GTCCGTGGGCACAGGCCTGGGGG + Intronic
928557476 2:32442884-32442906 GTCTTGGGACACATGCCCTGGGG - Intronic
929562301 2:42963499-42963521 GTCCCTGGGAAGAGGCACTGGGG - Intergenic
930818200 2:55620154-55620176 GTTTCTGGACAAGGGCCCTGCGG + Intergenic
931034804 2:58227763-58227785 GTCAGTGGGCACAGGCCCGGGGG + Intronic
931470231 2:62531996-62532018 GTCCATGGGCAGAGGCCATGGGG + Intergenic
932417927 2:71584881-71584903 ATCCCTGCATAAAGGCCCTGTGG + Intronic
932576465 2:72964967-72964989 GTCCGTGGGCACAGGCCTGGGGG - Intronic
933187063 2:79290411-79290433 GTCCGTGGGCACAGGGCCGGAGG - Intronic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
935171127 2:100612302-100612324 GGCTTTGGACACAGGGCCTGGGG + Intergenic
935297869 2:101666123-101666145 GTTCGTGGGCACAGGCCCGGGGG + Intergenic
935625335 2:105167995-105168017 GTCCCTGGAGAAAGGAGCTGTGG + Intergenic
936002685 2:108849937-108849959 GTGCCTGCACACAAGACCTGGGG + Intronic
936163531 2:110102092-110102114 ATCCCTGGACTCAGGCTCAGGGG + Intronic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
936864009 2:117056273-117056295 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
937304056 2:120860403-120860425 GGCCCCCAACACAGGCCCTGGGG + Intronic
937321520 2:120963717-120963739 CACCCTGGGCATAGGCCCTGTGG + Intronic
937642990 2:124235020-124235042 GTCTCTGGAGATAGGGCCTGAGG + Intronic
937921995 2:127137405-127137427 GTCCCAGGGGACAGGCCCGGGGG + Intergenic
938080367 2:128366938-128366960 TCCACGGGACACAGGCCCTGAGG - Intergenic
938695887 2:133835187-133835209 GTCCCTGGAGGCAGACTCTGAGG + Intergenic
938998235 2:136703378-136703400 GCCCATGAACAGAGGCCCTGGGG - Intergenic
939436143 2:142180697-142180719 GTCCCTGGGCACAGGTCCCCGGG - Intergenic
939778378 2:146413447-146413469 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
940124888 2:150311818-150311840 CTCCCTGGACAGAGCACCTGAGG + Intergenic
940404756 2:153287875-153287897 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
941216033 2:162710418-162710440 GTCCTTTGGCACTGGCCCTGCGG + Intronic
942401676 2:175609629-175609651 GTCTCTGGACAGAGGCTCAGGGG + Intergenic
942450345 2:176105096-176105118 GACGCTGCACACTGGCCCTGCGG - Intronic
942821700 2:180122738-180122760 GGCCCTGGACCCTGGACCTGTGG + Intergenic
944454180 2:199876449-199876471 GTCCCTGGACCCAGGTGATGGGG + Intergenic
944578493 2:201112789-201112811 GCCCTTGGACCCAGGCACTGGGG + Intergenic
946023059 2:216654987-216655009 GGCCCTGGACACTGCCTCTGTGG + Intronic
946196630 2:218036015-218036037 GGCCCAGAACACAGGCCCTGTGG + Intronic
946200906 2:218070182-218070204 GACCCAGAACACAGGCCCTGTGG + Intronic
946304456 2:218847755-218847777 GTCCCTGCAGTCAGGCCCTGGGG + Intergenic
947525489 2:230874561-230874583 GTCCCAGGGCACAGACCCAGGGG - Intronic
948375890 2:237519998-237520020 GTCCCTGGCCTCAGGGACTGAGG - Exonic
948525281 2:238567409-238567431 GTCCGTGGGCACAGGCCCGGGGG - Intergenic
1170486037 20:16817033-16817055 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1171411646 20:24951921-24951943 CTGCCTGGACAGGGGCCCTGGGG + Intronic
1171459663 20:25291482-25291504 ATCCCTGGGCACCGTCCCTGTGG + Intronic
1172213019 20:33214281-33214303 TTCCTTGGACACTGGCGCTGTGG - Intergenic
1172301364 20:33852782-33852804 GCCCCTAGAGACAGCCCCTGGGG + Intronic
1174092102 20:48057682-48057704 GTCCTTGGTCAAAGGTCCTGAGG + Intergenic
1174432346 20:50479414-50479436 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1175015702 20:55787689-55787711 GCCCCTGTACACAGGACTTGTGG + Intergenic
1175450988 20:59067944-59067966 CTCCATGTACAGAGGCCCTGGGG + Intergenic
1175795479 20:61767790-61767812 GGGCCTGGAAACTGGCCCTGTGG - Intronic
1176019127 20:62953613-62953635 GGGCCTAGACTCAGGCCCTGTGG + Intronic
1176222784 20:63978046-63978068 GTCCCGGGCTGCAGGCCCTGTGG - Intronic
1177204424 21:17994922-17994944 GTCAGTGGACCCAGGCTCTGGGG + Intronic
1177838842 21:26214581-26214603 GACCCAGGACATAGGCGCTGGGG + Intergenic
1178195875 21:30344634-30344656 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1178438609 21:32580974-32580996 GTCCATGGGCACAGGCCCAGGGG - Intronic
1180172488 21:46067054-46067076 GGCCCAGGACACAGGGCCAGAGG + Intergenic
1180898652 22:19355544-19355566 GCTCCTGCACACAGGCTCTGAGG + Intronic
1181027302 22:20133349-20133371 GCCCAAGGACAGAGGCCCTGGGG - Intronic
1181235805 22:21446999-21447021 GACCCAGCCCACAGGCCCTGCGG - Exonic
1181325077 22:22038689-22038711 GTGACTAGACACAGGCCCAGGGG + Intergenic
1182832076 22:33312506-33312528 GTCCCTGGAGTCAGGCACTGTGG - Intronic
1183121972 22:35737074-35737096 GTACCTGGAAGCAGCCCCTGAGG - Intergenic
1183585680 22:38751673-38751695 GGCCCAGAAGACAGGCCCTGAGG - Intronic
1183608956 22:38884385-38884407 GTCCCTGGGCACAAGATCTGGGG - Intergenic
1184032269 22:41902103-41902125 TTCCCAGGACACTGGGCCTGAGG - Intronic
1184075461 22:42174475-42174497 GTCCCTGAACACAGCCTCAGTGG + Intronic
1184449566 22:44574898-44574920 GTCCCCAGCCACAGGCCCTAGGG + Intergenic
1184478569 22:44734769-44734791 TGCCCTGGAAAAAGGCCCTGTGG - Intronic
1184651167 22:45920086-45920108 GGCACTGGACACAGACCCTGAGG - Intergenic
1184934960 22:47714398-47714420 GTGACCGCACACAGGCCCTGAGG - Intergenic
1185078093 22:48694033-48694055 GTCCCTGCCCACAGGCCACGCGG + Intronic
1185092224 22:48782091-48782113 GTCGCCGGACACAGGACCTCTGG + Intronic
1185127129 22:49017542-49017564 GTCCCTGGGCACAGGCCCTGGGG + Intergenic
1185318353 22:50188788-50188810 GTCCTGGGACAGAAGCCCTGCGG + Intronic
1185411400 22:50684816-50684838 TTCACTCAACACAGGCCCTGTGG - Intergenic
949492122 3:4599246-4599268 GGCCATGAACACAGGCTCTGTGG - Intronic
950148728 3:10669676-10669698 GTCTCTGGGCACAGTCCCTGAGG - Intronic
950153923 3:10708284-10708306 GTACCTGGAGACACGCCCCGGGG - Intergenic
951129975 3:19030356-19030378 GGCCTTGGGCACAGGCTCTGGGG + Intergenic
951133677 3:19077977-19077999 CTCCCTGGCCACTGCCCCTGTGG + Intergenic
951549327 3:23861467-23861489 GTCTGTGGGCACAGGCCCGGGGG - Intronic
951704877 3:25534468-25534490 GTCACTGCTCACAAGCCCTGTGG + Intronic
952003040 3:28808904-28808926 GTCCGTGGACACAGGCCCAAGGG + Intergenic
952354205 3:32570159-32570181 GACCCTTGACCCAGGACCTGCGG - Intronic
952551071 3:34477497-34477519 GTTCCTGGACAGAGGCAGTGAGG - Intergenic
953786842 3:45917386-45917408 GAGCCTGGACAGAGGCCCAGAGG - Intergenic
953923171 3:46966121-46966143 GTCCCTGCACGTAGGTCCTGAGG - Intronic
955274076 3:57530821-57530843 GTCCCTGCACACAGACTGTGTGG + Intronic
956302996 3:67792770-67792792 GCCACTGCACCCAGGCCCTGAGG + Intergenic
956390778 3:68770816-68770838 GTCCATGGGCACAGGCCCGAGGG - Intronic
956735334 3:72233570-72233592 GTCCATGGGCACAGGCCTTTGGG + Intergenic
956982395 3:74654249-74654271 GTCCATGGACATAGGCCCAAAGG - Intergenic
957058106 3:75459633-75459655 GTCCTTGGGCACAGGCCCTGGGG + Intergenic
959587746 3:108040854-108040876 GACACAGGACACAGGTCCTGTGG + Intergenic
961379344 3:126487117-126487139 GTCCCTGCCCTAAGGCCCTGAGG + Intronic
961555532 3:127694467-127694489 GGCCCTGAGGACAGGCCCTGCGG - Intronic
961637257 3:128341367-128341389 GTCCCTGCACACTGTCCATGCGG + Exonic
962095182 3:132285535-132285557 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
962368098 3:134798881-134798903 CTCCCTGGACACAGGGAGTGGGG - Intronic
963239926 3:142992705-142992727 GTCCATGGGCACAGGCCCGGGGG + Intronic
963312909 3:143728398-143728420 GTGGATGGACACAGGCCTTGAGG + Intronic
964805476 3:160605368-160605390 GTCCTTGGACACTGGGCCTTTGG - Intergenic
966914005 3:184575111-184575133 GCCCCTGGACACAGGCTCTGTGG - Intronic
968763762 4:2457591-2457613 GACCCTGGACTCAGGCCCTCAGG + Intronic
968963653 4:3758403-3758425 GTGCCTGGCCACAGGAGCTGAGG - Intergenic
968982286 4:3856795-3856817 GTCCCAAGACCCAGGCACTGGGG - Intergenic
969001944 4:3989506-3989528 GTCCATGGGCACAGGCCCTGTGG + Intergenic
969476944 4:7427234-7427256 GTGGCTGGACTCAGGCTCTGGGG + Intronic
969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG + Intronic
969752060 4:9119027-9119049 GTCCGTGGGCACAGGCCCTGGGG - Intergenic
969811974 4:9655302-9655324 GTCCGTGGGCACAGGCCCTGGGG - Intergenic
970054709 4:11957585-11957607 GTTCCTGGGCACAGGCCCCGGGG + Intergenic
970190290 4:13509663-13509685 GCCCCTCATCACAGGCCCTGAGG + Intergenic
971306414 4:25486129-25486151 GTCCCGGGACACAGGACTTTTGG - Intergenic
971831447 4:31701325-31701347 GTCCATGCGCACAGGCCCGGGGG - Intergenic
972279480 4:37588337-37588359 GTCCCATGATTCAGGCCCTGAGG - Intronic
973936365 4:55850580-55850602 GTCCATGGGCACAGGCCCAGTGG + Intergenic
974250690 4:59379045-59379067 GTCCCTGGGCAGAGGCCTGGGGG + Intergenic
975993070 4:80280885-80280907 GTCCCTGGAGATAGGGCTTGAGG + Intronic
976541824 4:86286298-86286320 GTCCCTGAACAAAGGCTTTGGGG + Intronic
977766673 4:100806345-100806367 GTCCATGGGCACAGGCCCGGTGG + Intronic
978414714 4:108463409-108463431 GTCCATGGGCACAGGCCCAAGGG - Intergenic
979286662 4:118933388-118933410 GGCCCTGGCCAGATGCCCTGAGG + Intronic
979721674 4:123906866-123906888 TTTCCTGGAAACTGGCCCTGAGG + Intergenic
980286312 4:130782790-130782812 GTCCGTGGACACAGGCCCAGGGG - Intergenic
980734437 4:136867103-136867125 GTCCGTGGGCACAGGCCCGAGGG - Intergenic
980900190 4:138897504-138897526 GTCCCTTTTCACAGGACCTGTGG + Intergenic
982325617 4:154125946-154125968 GTCCCTGGACCCCAGCCCAGGGG + Intergenic
983146015 4:164215520-164215542 GTCTGTGGGCACAGGCCCAGGGG + Intronic
983640516 4:169940632-169940654 GACACTGGCCAAAGGCCCTGGGG - Intergenic
984081190 4:175252193-175252215 GTCCATGGGCACAAGCCCCGGGG - Intergenic
984097179 4:175447877-175447899 GTCCATGGGCACAGGCCCGGGGG - Intergenic
986364812 5:7019622-7019644 GTCCATGGGCACAGGCCTAGAGG + Intergenic
987380058 5:17276325-17276347 TTGCCTTGGCACAGGCCCTGTGG - Exonic
987524515 5:19030397-19030419 GTCCCTGGGCACAGTCCCGAAGG + Intergenic
988038160 5:25853799-25853821 GTCCCTGGGCACAGGCCAGGAGG + Intergenic
988205275 5:28126155-28126177 GTCTGTGGACACAGGCCTGGGGG - Intergenic
988331767 5:29850424-29850446 GTCCGTGGGCACAGGCCCAAGGG + Intergenic
989498535 5:42138333-42138355 GTCCTTGGGCACAGGCCCAAGGG + Intergenic
990638055 5:57751066-57751088 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
990792419 5:59496413-59496435 GTCCGTGGGCACAGGCCTGGGGG + Intronic
992852139 5:80821680-80821702 ATGCAGGGACACAGGCCCTGTGG - Intronic
994448711 5:99911984-99912006 GTCCATGGACACAGGCCTGAGGG + Intergenic
994661593 5:102660921-102660943 GTCCGTGGGTACAGGCCCGGGGG - Intergenic
996566107 5:124881024-124881046 GTCCCTGGGCACAGGGCTGGGGG + Intergenic
996606432 5:125328708-125328730 GGTCCTGGACACAGGCCCCTGGG - Intergenic
999147591 5:149406406-149406428 GTCCTGGGACACAGGGGCTGGGG + Intergenic
999230990 5:150061631-150061653 GCCCTTGGACAGAGGCCCTTTGG - Intronic
999445292 5:151633963-151633985 GCCCCTGGAGTCAGGCTCTGTGG + Intergenic
999609468 5:153353392-153353414 GACCCTGGACACAAGTCCTGGGG - Intergenic
1000532770 5:162444444-162444466 GTCCATAGGCACAGGCCCAGGGG - Intergenic
1001181096 5:169521596-169521618 GTCCCTGGGCACAGGCCTGGAGG - Intergenic
1001518196 5:172372076-172372098 GCCCCTGGGTACGGGCCCTGTGG - Intronic
1001587878 5:172845447-172845469 GTCTGTGGACAGGGGCCCTGGGG - Intronic
1001732147 5:173968502-173968524 GTCCCAGGACACAGCCCCTCTGG - Intergenic
1001936585 5:175709855-175709877 GTCCCAGCACACAGGGCCTGAGG - Intergenic
1002107923 5:176889287-176889309 GTCCCTGTTCTCAGGCCCTTAGG - Intronic
1002779735 6:357135-357157 CTCCCAGGACACTGGCTCTGAGG - Intergenic
1003160542 6:3630461-3630483 GTCCCTGGTTAATGGCCCTGGGG - Intergenic
1003244432 6:4371982-4372004 GTCACTGGACACAGAATCTGGGG + Intergenic
1003499839 6:6695145-6695167 GTCTGTGGGCACAGGCCCGGGGG + Intergenic
1003533446 6:6956276-6956298 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1003567397 6:7232090-7232112 GCCCCTGCACAAAGGCCATGTGG - Intronic
1003809964 6:9768314-9768336 GTCCATGGGCACAGGCCTGGGGG + Intronic
1004027267 6:11831451-11831473 ACCCCTAGACACAGGCCGTGGGG - Intergenic
1005461139 6:26071302-26071324 GTCCCTGGGCACAGGCCTGGGGG - Intergenic
1005532576 6:26722543-26722565 ATCCATGGGCACAGGCCCGGCGG - Intergenic
1005535832 6:26755060-26755082 GTTCATGGGCACAGGCCCGGGGG + Intergenic
1005538219 6:26779122-26779144 ATCCATGGGCACAGGCCCGGCGG + Intergenic
1005561981 6:27050020-27050042 GTCTGTGGGCACAGGCCCGGGGG - Intergenic
1005813887 6:29535069-29535091 GTATCTGGACCCAGGCTCTGTGG + Intergenic
1006208859 6:32375679-32375701 GTCTGTGGGCACAGGCCCAGGGG - Intergenic
1006429698 6:33988163-33988185 GTCCTGGGACCCAGGCCCTGTGG + Intergenic
1006436298 6:34027661-34027683 GGCCCTGCACACTGGCCCTTTGG - Intronic
1006438837 6:34040925-34040947 GTGCCTGGAGACAGGCCCATGGG + Intronic
1006510943 6:34520765-34520787 GACCCTGGAACCGGGCCCTGAGG + Intronic
1007119346 6:39367312-39367334 GTCCCTGGCCAGAGTCCCCGTGG - Intronic
1007307513 6:40918557-40918579 GTCCATGGGCACAGGACCAGGGG - Intergenic
1007605345 6:43113993-43114015 GTCCCCGGCCACAGGCCCCGGGG - Intronic
1007788457 6:44295448-44295470 GACCCTGGACCCTGGTCCTGAGG - Intronic
1008727727 6:54442056-54442078 GTCCATGGGCACAGGCCTAGGGG + Intergenic
1008864027 6:56188514-56188536 CTCCCTGGACAGAGCACCTGGGG + Intronic
1009006856 6:57798709-57798731 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1009009069 6:57821472-57821494 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1010014295 6:71086499-71086521 GTCCGTGGGCACAGGCCCGAGGG - Intergenic
1010028440 6:71246054-71246076 GTCCATGGGCACAGGCCCGAGGG + Intergenic
1010504055 6:76634135-76634157 GTCTGTGGGCACAGGCCCCGGGG + Intergenic
1011801551 6:91021827-91021849 GTCCATGGGCACAGGCTCAGGGG - Intergenic
1011873582 6:91927229-91927251 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1012724901 6:102798739-102798761 GTCCCTGGGCACAGGCCCGAGGG - Intergenic
1014371731 6:120617835-120617857 TTTCCAGGACACAGGCCCCGAGG - Intergenic
1015729548 6:136334391-136334413 GTCCATGGGCACAGGCCCAGGGG - Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1016020939 6:139235694-139235716 GTCCCTGGGCACAGGCTCGAGGG - Intergenic
1018392253 6:163349591-163349613 CTCCCTGGACATAGGACCAGAGG - Intergenic
1018794472 6:167175136-167175158 GTCCCTGGGCACAGGCCCGGGGG + Intronic
1018821847 6:167379931-167379953 GTCCCTGGGCACAGGCCTGGGGG - Intronic
1019080715 6:169427700-169427722 GTTTCTCCACACAGGCCCTGGGG - Intergenic
1019266628 7:120807-120829 GCCCCTGTCCAGAGGCCCTGAGG - Intergenic
1019442882 7:1056268-1056290 GAGCCTGGACCCAGGACCTGGGG + Intronic
1019447283 7:1077942-1077964 GTCCCCGCACACACGCCCAGCGG - Intronic
1019648134 7:2141827-2141849 GTCCCGGGAGCCAGGCCATGTGG - Intronic
1019659865 7:2218230-2218252 GTCCCAGGCCCCAGCCCCTGTGG + Intronic
1019716994 7:2543682-2543704 GCCCCTGGACGGAAGCCCTGTGG - Exonic
1021820759 7:24495244-24495266 GTCCGTGGGCACAGGCCCACGGG + Intergenic
1022205178 7:28157057-28157079 GTGCATGCACACAGCCCCTGTGG + Intronic
1022640180 7:32174600-32174622 ATCTCTGGACACTGCCCCTGTGG - Intronic
1023155300 7:37245234-37245256 ATCGCAGGCCACAGGCCCTGAGG + Intronic
1023828319 7:44024570-44024592 GTCCCTGGACCCAGGGCCTTGGG + Intergenic
1023879184 7:44308871-44308893 GGCCATGGACAGAGGCCCCGGGG - Intronic
1024547604 7:50535545-50535567 GAGCCTGGCCACAGGGCCTGTGG + Intronic
1024643924 7:51355743-51355765 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1025751004 7:64293841-64293863 ATCCCTGGACCCAGTCCCTTAGG - Intergenic
1025992013 7:66503855-66503877 GTCCCGGGAGGCAGTCCCTGGGG + Intergenic
1026036414 7:66833200-66833222 GTCCCTGGAGACAGGGCACGGGG - Intergenic
1026270040 7:68828687-68828709 GTTCCTGGTCACAGTCACTGTGG - Intergenic
1026557840 7:71423199-71423221 GTCCGTGGGCACAGGCCCGAGGG + Intronic
1026772228 7:73209811-73209833 GTCCCTGGAGGGAGGTCCTGCGG + Intergenic
1026888103 7:73966526-73966548 GTCTCTGGACTCTGGGCCTGGGG + Intergenic
1027013097 7:74763204-74763226 GTCCCTGGAGGGAGGTCCTGCGG + Intergenic
1027074944 7:75182830-75182852 GTCCCTGGAGGGAGGTCCTGCGG - Intergenic
1027127233 7:75565420-75565442 GTCCAAGGAGACAGGCCCTGAGG - Intronic
1028134552 7:87211687-87211709 ATCCCTGGACACAGGGCCTGAGG - Intronic
1029103930 7:98158531-98158553 ATCCATGGACACAGAACCTGTGG - Intronic
1029374229 7:100168316-100168338 CTCCCTGATCACAGCCCCTGGGG + Intronic
1029611675 7:101629906-101629928 GTCCGTGGGCACAGGCCCAAGGG + Intergenic
1029756620 7:102578017-102578039 GTCCCTGGACCCAGGGCCTTGGG + Intronic
1029774562 7:102677086-102677108 GTCCCTGGACCCAGGGCCTTGGG + Intergenic
1031765587 7:125773062-125773084 GCCCCTGAGCACAGGCCCGGGGG - Intergenic
1031926317 7:127642146-127642168 GTCTCTATTCACAGGCCCTGGGG + Intergenic
1032454583 7:132063786-132063808 CTCCCTGGACATGGGGCCTGGGG + Intergenic
1033896224 7:146073966-146073988 GTCCTTGGTCACAGGCCCTAGGG - Intergenic
1034474358 7:151274158-151274180 GTCCCTGTCCTCAGGGCCTGCGG - Intronic
1034984268 7:155497603-155497625 GCCCCTGGGCACAGGCAGTGAGG - Intronic
1035316773 7:158001509-158001531 AGCCGTGGACTCAGGCCCTGTGG - Intronic
1035652166 8:1275436-1275458 GGCCTTGGACACTGGTCCTGGGG + Intergenic
1036375279 8:8194433-8194455 GTCCGTGGACACAGGCCCTGGGG - Intergenic
1036553824 8:9839203-9839225 CTCCCTGGACAGAGCACCTGGGG + Intergenic
1036690472 8:10941614-10941636 GTCCCTCAGCACATGCCCTGTGG - Intronic
1036788908 8:11704870-11704892 GTCCCTGGACCCCAGCCCCGAGG - Intronic
1036854260 8:12228715-12228737 GTCCGTGGACACAGGCCCTGGGG + Intergenic
1036875622 8:12471215-12471237 GTCTGTGGACACAGGCCCTGGGG + Intergenic
1037138933 8:15496617-15496639 GACCCTAGATACAGGCCCAGTGG + Intronic
1037226726 8:16601917-16601939 GTCCATGGGCACAGGCCCGAAGG - Intergenic
1037346617 8:17907806-17907828 GTCCCTGAACAAAGGTCTTGTGG - Intronic
1038248528 8:25881640-25881662 GTCCATGGGCACAGGCCAAGGGG - Intronic
1038862318 8:31401268-31401290 GTTCATGGGCACAGGCCCAGGGG - Intergenic
1040652459 8:49464774-49464796 GTCCATGGACACCGGCCCAGGGG - Intergenic
1041556398 8:59161265-59161287 GGCCCTGGTCACAGCCTCTGAGG + Intergenic
1041934647 8:63322106-63322128 GTCTGTGGGCACAGGCCCAGGGG - Intergenic
1044206151 8:89494033-89494055 GTCCATGGGCACAGGCCCAAGGG - Intergenic
1044765746 8:95572297-95572319 GTCCATGGGCACAGGCCCGAGGG - Intergenic
1044938041 8:97312087-97312109 GTCCCAGGGCACAGGGACTGAGG - Intergenic
1045906099 8:107346914-107346936 GTCTGTGGACTCTGGCCCTGGGG + Intronic
1045942443 8:107755064-107755086 GTCCATGGGCACAGGCCCGGGGG - Intergenic
1046006781 8:108495853-108495875 GTACTTAGAAACAGGCCCTGTGG + Intergenic
1046260835 8:111765706-111765728 GTCCCTGGGCACAGGCCCCAGGG - Intergenic
1047586469 8:126279370-126279392 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1047835833 8:128689458-128689480 GTCTGTGGACACAGGCCCGAGGG + Intergenic
1048167005 8:132071339-132071361 GTCCCAGGACAGAGGACATGAGG - Exonic
1049224365 8:141442603-141442625 GTCACTGAACGCAGTCCCTGGGG + Intergenic
1049562168 8:143317319-143317341 GGCCGTGGACAGAGGCCCAGAGG + Intronic
1049574212 8:143382979-143383001 TGCCCTGGGCACAGACCCTGAGG + Exonic
1049675615 8:143887595-143887617 GTGCCAGGGCACAGGGCCTGGGG + Intergenic
1050202221 9:3157384-3157406 GTGCATGGGCACAGGCCCAGTGG + Intergenic
1051103634 9:13551263-13551285 GTCCATGAGCACAGGCCCAGGGG + Intergenic
1052370076 9:27654792-27654814 GTCCGTGGGCACAGGCCCAGGGG - Intergenic
1052566581 9:30160824-30160846 GTCCATGGGCACAGGCCAGGGGG + Intergenic
1054927663 9:70604432-70604454 GTTCCTGCTCACAGCCCCTGAGG - Intronic
1055054439 9:72010862-72010884 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1055894849 9:81162930-81162952 CTCCCTGGACAGAGCACCTGGGG + Intergenic
1056327294 9:85490603-85490625 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1056573313 9:87834889-87834911 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1056999357 9:91493193-91493215 TTCCCTTAGCACAGGCCCTGGGG - Intergenic
1058206953 9:102119926-102119948 GTCCATAGGCACAGGCCTTGGGG + Intergenic
1059281343 9:113136642-113136664 GGCACTGGACACAGGCTCTGTGG + Intergenic
1059285666 9:113169544-113169566 GTCCATGGATACAGGGCCTAGGG + Exonic
1060233177 9:121840731-121840753 GTGTCTGGACACAGGCCACGTGG - Intronic
1060303689 9:122391963-122391985 TTCCCTAGACCCAGTCCCTGAGG + Intronic
1060939854 9:127536901-127536923 GTTCCTGGGCCCAGGACCTGCGG - Intronic
1061444043 9:130627526-130627548 GTCCCTGCTCACAGACACTGTGG + Intronic
1061806527 9:133140348-133140370 GTTCCTGGACTCAGGGCCTCTGG + Intronic
1061845849 9:133387587-133387609 GACCTGTGACACAGGCCCTGCGG + Intronic
1062173374 9:135147707-135147729 GTGCCTGGACAGAGGCCAGGTGG - Intergenic
1062317865 9:135977334-135977356 GGCCCAGGTCACAGGCTCTGGGG + Intergenic
1062378282 9:136274802-136274824 GTCTCTGGGCACAGGCAGTGGGG - Intergenic
1062444097 9:136586141-136586163 CTCCCTCCACACAGGGCCTGAGG + Intergenic
1185837812 X:3361293-3361315 GTCCGTGGGCACAGGCCCACAGG + Intergenic
1187138458 X:16570810-16570832 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1187365375 X:18661982-18662004 GTCCGTGGGCACAGGCCTGGGGG + Intronic
1187843883 X:23515988-23516010 TTCCCTAGAAACAGACCCTGAGG - Intergenic
1188649649 X:32616276-32616298 GTCACTATACACAGCCCCTGTGG + Intronic
1189084003 X:38001092-38001114 GTCCCTGGTCACAGGCCCAGGGG + Intronic
1190333562 X:49249842-49249864 GTCCCAGGTCACAGGCACTAAGG - Intronic
1190702194 X:52997402-52997424 GTCCCTAGACACAGTTTCTGGGG - Intergenic
1191006515 X:55716127-55716149 GTCCATGGGCACAGGCCCCAGGG + Intergenic
1191184181 X:57592383-57592405 CTCCCTCAACACAGGCCCTGCGG - Exonic
1191205878 X:57833751-57833773 GTCCATGGGCACAGGCCCAAGGG - Intergenic
1191213210 X:57910076-57910098 CTCCCTCAACACAGGCCCTGCGG + Exonic
1192098594 X:68239467-68239489 GTCCGTGGGCACAGGCCCAGGGG + Intronic
1193893041 X:87075378-87075400 TGCTCTGGACTCAGGCCCTGAGG - Intergenic
1195367352 X:104139037-104139059 GTCCATGGGCATAGGCCCGGGGG + Intronic
1195961686 X:110393752-110393774 GTCCATGGACAGTGGCCCTGGGG - Intronic
1196241991 X:113353055-113353077 GTACATGGGCACAGGCCCAGTGG - Intergenic
1196258942 X:113555106-113555128 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
1196414275 X:115454446-115454468 GTCCCTGGACACAGGCTGCCTGG - Intergenic
1197241428 X:124127062-124127084 GTCCATGGGCACAGGCCCAAGGG - Intronic
1197459526 X:126723568-126723590 GGCCGTGGGCACAGGCCCAGAGG - Intergenic
1198279026 X:135124168-135124190 TTCCCTGGAAATAGACCCTGAGG + Intergenic
1198291932 X:135248352-135248374 TTCCCTGGAAATAGACCCTGAGG - Intergenic
1198386676 X:136135337-136135359 GTCTGTGGACACAGGCCTGGGGG + Intergenic
1198711345 X:139507812-139507834 GCCCATGGGCACAGGCCCAGAGG - Intergenic
1200042559 X:153380550-153380572 GTCCCAGGACCCAGCCCCCGAGG + Intergenic
1200047964 X:153412656-153412678 TCCCCTGTACAAAGGCCCTGAGG + Intergenic
1201238029 Y:11930440-11930462 GTCCATGGGCACAGGCCCACAGG - Intergenic