ID: 1151351342

View in Genome Browser
Species Human (GRCh38)
Location 17:73533798-73533820
Sequence ACTTCCTTGAAGGAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151351342_1151351347 8 Left 1151351342 17:73533798-73533820 CCCTCCAGCTCCTTCAAGGAAGT 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1151351347 17:73533829-73533851 GAGACTCTGCCCCCAAAGAAGGG 0: 1
1: 0
2: 3
3: 47
4: 418
1151351342_1151351346 7 Left 1151351342 17:73533798-73533820 CCCTCCAGCTCCTTCAAGGAAGT 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1151351346 17:73533828-73533850 TGAGACTCTGCCCCCAAAGAAGG 0: 1
1: 0
2: 2
3: 39
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151351342 Original CRISPR ACTTCCTTGAAGGAGCTGGA GGG (reversed) Intronic
900463990 1:2815092-2815114 AGATCCTGGATGGAGCTGGATGG - Intergenic
900766672 1:4510576-4510598 GCCTCCTTCATGGAGCTGGAAGG - Intergenic
901091818 1:6646743-6646765 ACTTCATTCAAGGTGCTGAAGGG + Intronic
902306690 1:15545708-15545730 AGTTCCTTAAAGGAGCGTGAAGG - Intronic
904054770 1:27662819-27662841 ACTTCCTTTAAGCAGATGGCTGG - Intergenic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
904826541 1:33276948-33276970 ACTTCCTTGGAGGAGCCAAAAGG + Intronic
906157780 1:43623989-43624011 ACTACCTTGGAGGAGAGGGATGG + Intergenic
908619656 1:65963312-65963334 TCTCTCTTCAAGGAGCTGGAGGG - Intronic
911772899 1:101769755-101769777 ATGTCCTTGAAGGCGATGGATGG - Intergenic
912951333 1:114122701-114122723 ACTCCCTAAAAAGAGCTGGATGG + Intronic
915648939 1:157293650-157293672 AGTCCCTTGAGGGAGCTGAAAGG - Intergenic
915661761 1:157410869-157410891 AGTCCCTTGAGGGAGCTGAAGGG + Intergenic
916538437 1:165728031-165728053 ACTTCCCAGAAGGAGGTGGTGGG + Exonic
917300359 1:173567746-173567768 CCTTCATTGAAAGGGCTGGAAGG - Intronic
917794861 1:178525985-178526007 ACTTCCTTCTTGGAGTTGGAGGG + Intronic
920404317 1:205697525-205697547 ACTTTCTGGAAGGCGTTGGAGGG + Intergenic
920519867 1:206615368-206615390 AATTCTTTGATGGATCTGGATGG + Intergenic
1062928785 10:1338842-1338864 GCTTCCTTGCATGGGCTGGAGGG + Intronic
1068666550 10:59682124-59682146 AAGTACTTGAAGGAGCTTGAGGG - Intronic
1069628521 10:69882877-69882899 GCTTCCTGGAAGGAGCTGAGGGG - Intronic
1072532138 10:96329731-96329753 TCTTCCCAGAAGGAGTTGGAGGG + Intronic
1072704352 10:97669573-97669595 ACATGTTGGAAGGAGCTGGATGG - Intronic
1073514080 10:104061663-104061685 ACTTCCTGGAAGTAGCTAGAAGG - Intronic
1073827357 10:107339431-107339453 ACTTCTTTGAAGGTGCAGGATGG + Intergenic
1074021383 10:109587979-109588001 CCTTCCTGGAATGAGGTGGATGG + Intergenic
1074150561 10:110755921-110755943 CCTAACTTGAAGGGGCTGGATGG - Intronic
1074553964 10:114471259-114471281 ACTGCCTTGATGGAGCTGCTGGG + Intronic
1075069091 10:119308910-119308932 ACTTCCCAGACGGAGCTGAAGGG + Intronic
1075648847 10:124114513-124114535 ACCTCCTTGAAGGAGGAGGAGGG + Intergenic
1076068710 10:127469119-127469141 ACCTCCTGGAAACAGCTGGAGGG - Intergenic
1076581232 10:131513357-131513379 ACTTCCCAGGGGGAGCTGGAAGG - Intergenic
1076632106 10:131857522-131857544 GCTTCCTTCTAGAAGCTGGAAGG - Intergenic
1076767518 10:132644639-132644661 GCTTCCTTGGAGGAGCGGAAAGG - Intronic
1079321602 11:19456106-19456128 ACTGTCTTGGAGGAGCTGGTGGG - Intronic
1079603637 11:22341194-22341216 ACTTTCTTGCAGGATCTGCAGGG - Intronic
1081989156 11:47328369-47328391 ACTTCTTTGAAAGCCCTGGATGG - Intronic
1083419384 11:62544723-62544745 ACTTCCTTTCAGAAGCTGAATGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1086029429 11:82336186-82336208 ACTACCTTGAAGGCACTGTATGG - Intergenic
1086055218 11:82638738-82638760 ACATCTTTGGAGGAGGTGGAGGG + Intergenic
1086509416 11:87540803-87540825 GCTTACTGGAAGGAACTGGAAGG + Intergenic
1088676788 11:112202015-112202037 TCTCCCTGGAAGGAGCTGCAGGG - Exonic
1090264016 11:125342822-125342844 ACCACCGTGGAGGAGCTGGAGGG + Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1091253351 11:134162826-134162848 ACTTTCTAGAAGTGGCTGGAGGG - Intronic
1091622554 12:2100355-2100377 AATTCCTTGAAGGAGGTTCAAGG + Intronic
1092927963 12:13289269-13289291 ACTGCCATAAAGGAGCTGGCAGG + Intergenic
1093362659 12:18249971-18249993 ATTTCCTTGAAGGAGGTAAATGG + Intronic
1094144879 12:27218037-27218059 ACTTTCTTCATGGAGCTGGCTGG + Intergenic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097745857 12:63302421-63302443 ACTGCTTTGAGGGAGCTGAAAGG + Intergenic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1101889822 12:108703182-108703204 ACTTGCTTGAAGATGCTGGTAGG - Intronic
1102502262 12:113360489-113360511 GCTTCCTTGATTGTGCTGGATGG + Intronic
1102995380 12:117346091-117346113 ACTTCCTGAAAGCAGCTGCAGGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106770160 13:32954053-32954075 ACTTCCTGGAAAGATCTAGATGG - Intergenic
1108836542 13:54557038-54557060 AGTTCCTTGTAGATGCTGGATGG - Intergenic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1112792354 13:103016726-103016748 AGTCCCTTGAAGGAGGTGAATGG - Intergenic
1112908127 13:104448912-104448934 ACTTCCTGGAAAGATCTGTATGG - Intergenic
1120247735 14:82026303-82026325 TCTTCCTTCAAGGACCTGAAAGG - Intergenic
1120829784 14:88987663-88987685 ACTTCCTTAAAGGAGTGGCATGG - Intergenic
1121187144 14:91983888-91983910 ACTACCTTTACGGTGCTGGATGG - Intronic
1202903050 14_GL000194v1_random:54167-54189 AGTTCCTTGAAGGAACTGAGGGG + Intergenic
1127644741 15:60947129-60947151 ACTTCCCAGAAGGGGCTGGCCGG - Intronic
1128349256 15:66878115-66878137 ACTTCCTGGAATCTGCTGGAAGG - Intergenic
1129633968 15:77294641-77294663 ATTTCCTTTCAGGACCTGGAAGG - Intronic
1129748193 15:78039553-78039575 ACTTCCTTGAGTCAGGTGGATGG - Intronic
1131870494 15:96758600-96758622 ACTTCCTAGAATGAGCTCGATGG + Intergenic
1135007270 16:18837285-18837307 AGTTTCTAGAAGGAGCTGAAGGG - Exonic
1137471757 16:48766785-48766807 ACTTTCATAATGGAGCTGGAAGG + Intergenic
1137844882 16:51677519-51677541 ACTTCCCAGAAAGAGGTGGAGGG - Intergenic
1137917629 16:52450299-52450321 TCTTCATTGATGGAGCTGGAAGG + Exonic
1137966697 16:52941802-52941824 GCTTCCATGATGGCGCTGGAAGG + Intergenic
1140449120 16:75055867-75055889 ACATCCTTGAAGGACCAAGAGGG + Intronic
1141297771 16:82785731-82785753 ACTGCATGGAAGGGGCTGGAGGG + Intronic
1141399305 16:83733217-83733239 TGTTCTGTGAAGGAGCTGGAGGG - Intronic
1141689706 16:85589160-85589182 GCTTCCTAGCAGGAGCTGAAAGG + Intergenic
1143312831 17:6007391-6007413 ACCTAATTGAAGGAGATGGAAGG - Intronic
1143724728 17:8837205-8837227 GCTTCCCTGATGGAGCAGGAGGG - Intronic
1146636003 17:34505207-34505229 ACTTCGTTGAAGGAGATATAAGG + Intergenic
1147920287 17:43912152-43912174 ACTTCAGTGGAGGTGCTGGAGGG - Intergenic
1149536281 17:57436006-57436028 ACTTCCATGCTGGAGGTGGAGGG + Intronic
1150660695 17:67074229-67074251 ACTACCATTGAGGAGCTGGAGGG + Exonic
1150722895 17:67628559-67628581 ACTTCATTGGAGAAGCAGGATGG + Intronic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151552446 17:74829915-74829937 ACTGCCTGGGAGGACCTGGAAGG + Intronic
1151679786 17:75617160-75617182 TTTTCCTTGATGGAGCTAGAGGG - Intergenic
1151908402 17:77064897-77064919 AGTTCCTTGAAGTGGCAGGATGG + Intergenic
1152268964 17:79312682-79312704 ATGTGCATGAAGGAGCTGGAGGG - Intronic
1153995310 18:10435082-10435104 GCTTCCTTGAAGTATCTGTATGG + Intergenic
1156457256 18:37301728-37301750 ACCTCCTTTAAAGAGCCGGAAGG + Intronic
1163088027 19:14996929-14996951 CCTTCCTTGGAGGATCTGGTGGG + Intronic
1163673957 19:18646020-18646042 TCTTCCTAGCAGGAGCTGGGGGG - Intronic
1164740307 19:30570982-30571004 TCTTCCTTTGAGGAGCTGGGGGG - Intronic
1167359778 19:49023910-49023932 ATTGCCTGGAAGGAGGTGGAAGG + Intronic
1167363780 19:49044249-49044271 ATTGCCTGGAAGGAGGTGGAAGG - Intronic
1167364717 19:49048678-49048700 ATTGCCTGGAAGGAGGTGGAAGG + Intronic
1168156808 19:54478180-54478202 ACTACCCTGAGTGAGCTGGAAGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
926099177 2:10103210-10103232 AAAGCCTTGAAGGAGCTGCAAGG + Intergenic
929326956 2:40625589-40625611 ACTGCCTTAAAAGAGCAGGAAGG - Intergenic
932375562 2:71232689-71232711 ACTTCCTTGAAGTCTCTTGAGGG - Intergenic
933526746 2:83450564-83450586 TCTTCCTTGAAACAGTTGGAAGG - Intergenic
933724873 2:85421000-85421022 CCTTCCTTGATGGGCCTGGAGGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934503609 2:94876226-94876248 AGTTCCTTGAAGGAACTGAGGGG - Intronic
935589757 2:104835698-104835720 ACTTCCCTGAATGGGATGGAGGG - Intergenic
936532922 2:113289453-113289475 ACTTCCTTGCAGTAACTGAATGG - Intergenic
938595484 2:132783716-132783738 ATTACGGTGAAGGAGCTGGAGGG + Exonic
940936156 2:159497324-159497346 ACTTCCTGGATGGAGGTGGAGGG - Intronic
942122856 2:172795392-172795414 ACTTTCTAGATGGAGCTGGAGGG + Intronic
946093971 2:217256102-217256124 ACTTCAGTGAAGGGGCTTGATGG + Intergenic
947951948 2:234155429-234155451 ACATCCTTGAGGAAGCTGCAGGG - Intergenic
948631695 2:239306852-239306874 ACCTTCTGGAAGGAGCTGCAGGG + Intronic
1169192502 20:3667181-3667203 AGTTCCTTGAAGGGGGTGGTTGG - Intergenic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1169408996 20:5350960-5350982 ACTTCCTGGAAGGAGACAGATGG + Intergenic
1169447934 20:5688058-5688080 ACTTCCTTGCATGAGCAGGAAGG - Intergenic
1170485193 20:16808321-16808343 ACTTCCTGAAATGAGATGGAGGG - Intergenic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1170990279 20:21295094-21295116 ATTCCCTGGAAGAAGCTGGATGG - Intergenic
1171148919 20:22810044-22810066 ACTTCATAGATAGAGCTGGAAGG - Intergenic
1171241162 20:23568206-23568228 AATTCCTGGAAGGAGCAGGTTGG - Exonic
1173789030 20:45815725-45815747 ACCTCCTAGAAGGCTCTGGATGG - Exonic
1175766850 20:61598215-61598237 AATTCCTGGAAGGTGCTAGAAGG - Intronic
1176622414 21:9068934-9068956 AGTTCCTTGAAGGAACTGAGGGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183501861 22:38184995-38185017 TTTTCCTTCAAGGAGCTAGATGG + Intronic
1183943975 22:41313513-41313535 ACAACCTTGAAGGAGCAAGAGGG + Intronic
1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949987453 3:9552396-9552418 GCCGCCTTGAAGGCGCTGGACGG + Exonic
952527221 3:34223383-34223405 GCTGGCTAGAAGGAGCTGGAAGG - Intergenic
954189354 3:48945688-48945710 ACTTGCTTGAATGCGGTGGAGGG + Intronic
954358840 3:50106689-50106711 ACTTCTTTGAATGGGGTGGATGG + Intronic
960973458 3:123155258-123155280 ACTTACTTGGAGGAGAGGGATGG + Intronic
961321249 3:126078048-126078070 ACCTCCCTGAAGGACCTGCAGGG + Intronic
962189531 3:133295965-133295987 ACTAACATGAAAGAGCTGGACGG + Intronic
962255108 3:133865190-133865212 ACATCCTGCAATGAGCTGGACGG - Intronic
964118374 3:153159595-153159617 ACCTCCTACACGGAGCTGGATGG + Intergenic
964918055 3:161860089-161860111 ATCTCCTTTCAGGAGCTGGAGGG - Intergenic
966226727 3:177605717-177605739 AATTCCTTAAAGGAAATGGAAGG + Intergenic
966465465 3:180227009-180227031 ACTCCCTAGAACTAGCTGGAAGG + Intergenic
966825768 3:183963744-183963766 ACTTCGTTGAAGGATCAGCATGG - Intronic
967240722 3:187436736-187436758 GCTTCCTAGAAGGAAGTGGAGGG - Intergenic
970217172 4:13771712-13771734 GCTTCATAGAAGGAGTTGGAAGG + Intergenic
971255207 4:25008118-25008140 ACTTCCCTGAAGGAGGTAGAAGG - Intronic
972280021 4:37592966-37592988 CCGTCCTTAAAGGTGCTGGAAGG - Intronic
972318846 4:37953692-37953714 CCTCCCTTGAAGGAGCTCTAAGG - Intronic
975702136 4:77076252-77076274 TTTTCCTTGAAGGAGCGGAAGGG + Intergenic
980136193 4:128861008-128861030 ACTTCCTTGAAGCAGCACGAAGG - Intronic
981489428 4:145324002-145324024 ACTTCCTTGTCGGAGCTGAGAGG - Intergenic
986012322 5:3726887-3726909 AGTTTCTTCAAGAAGCTGGATGG + Intergenic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
990447076 5:55903360-55903382 CCTTCCTTGAAGAAGCAGGGAGG - Intronic
991272234 5:64797593-64797615 ACTTACTTTAAATAGCTGGAAGG - Intronic
991302457 5:65142520-65142542 ACTTCCTTGAAAACTCTGGAAGG + Intergenic
991537427 5:67686274-67686296 ACTTCCTTCAAGGATCTGCTTGG + Intergenic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
993361366 5:86980814-86980836 ACTTGAATGAAGGAACTGGATGG + Intergenic
995149759 5:108829152-108829174 AATTCCTTGAATTAGCTGGGTGG - Intronic
996589415 5:125129331-125129353 ACTGCCTTAAAAGGGCTGGAGGG - Intergenic
998463312 5:142324838-142324860 ACTTACTTTGAGGAGCTGCAGGG + Exonic
998975075 5:147636422-147636444 ATTTCTTTGAAGGAGCTGGCAGG - Intronic
1000366342 5:160494711-160494733 ATGGCCTTGAAGGAGATGGAAGG + Intergenic
1002501297 5:179649373-179649395 ACTTCCTGGAAGGAGCTATGAGG + Intergenic
1004506675 6:16252539-16252561 ACTCCCTTAAAGAAGGTGGAGGG - Intronic
1004971314 6:20913657-20913679 ACCTCCTGGAAGAAGATGGATGG - Intronic
1006378221 6:33683509-33683531 ACTTCCAGGAAGGGGCTGGTTGG + Intronic
1007334245 6:41140370-41140392 GTTTCCTTGAAGTAACTGGATGG + Intergenic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1010053063 6:71531146-71531168 AATATCTTGGAGGAGCTGGAGGG + Intergenic
1013180328 6:107711987-107712009 TCTTCCTTGTGGGACCTGGAAGG + Intronic
1015176495 6:130314881-130314903 TATTCCTAGAAGCAGCTGGAGGG - Intronic
1015553299 6:134434705-134434727 ATTTCCCTGAAGGAGGTGGGAGG + Intergenic
1017434024 6:154398719-154398741 ATTTCATTGAAGGAAGTGGAAGG + Exonic
1017588888 6:155957104-155957126 ACTTGCCTGAAAGAGCAGGAAGG - Intergenic
1018439682 6:163799608-163799630 ACTTCCTTGTAGATTCTGGATGG - Intergenic
1018599114 6:165520141-165520163 ACTTTCTAGAAGGAACTTGATGG - Intronic
1018856787 6:167680716-167680738 ACCTCCTGGACGAAGCTGGAAGG - Intergenic
1019051113 6:169184793-169184815 ATGTCCCTGAAGGAGTTGGAGGG - Intergenic
1019607292 7:1916611-1916633 ACTCCCTTGCAGGGCCTGGAGGG - Intronic
1020545249 7:9520286-9520308 ACTTACCTGAAGGTGCAGGATGG + Intergenic
1021622103 7:22559226-22559248 CCTGCCTTAACGGAGCTGGAAGG - Intronic
1021793168 7:24226914-24226936 ACTTCCCTGAAGCAGTGGGAGGG - Intergenic
1022901163 7:34811843-34811865 ACCTCCTTGAAGGAACTTCATGG - Exonic
1023441566 7:40190082-40190104 TCTTTCTTAGAGGAGCTGGAAGG + Intronic
1023603555 7:41905735-41905757 ACATGCTTGAAGGTGCCGGAGGG - Intergenic
1029630326 7:101746262-101746284 GCTTCCTGGAAGGGTCTGGAAGG - Intergenic
1030163350 7:106530158-106530180 ACATACCTGAAGGAGCTGGGGGG + Intergenic
1030760996 7:113351633-113351655 ACTGCCTTCAAAGAGCTGAAAGG - Intergenic
1033658864 7:143390488-143390510 AATTCCAAGATGGAGCTGGATGG + Intronic
1034547791 7:151800440-151800462 AAGGCCTTGGAGGAGCTGGAGGG - Intronic
1035412624 7:158657512-158657534 ACATCCTTGAGGGAGGTGGGGGG + Intronic
1038404441 8:27311183-27311205 TCCTCCTTGAAGGAGCGGGAAGG + Exonic
1039631345 8:39114870-39114892 ACTTACTTGAAGGTGGAGGATGG - Intronic
1039742203 8:40393187-40393209 GCTGCCTTGAAGGGGCTGCAGGG + Intergenic
1040762265 8:50863352-50863374 ACTTCTGTGACGGTGCTGGAGGG - Intergenic
1041174769 8:55183957-55183979 GCATCCTTGATGGAGCTGGCAGG - Intronic
1047756064 8:127919309-127919331 AATTACTTCAAGGAGCAGGAAGG + Intergenic
1047986314 8:130238058-130238080 ACTTCCCTGAAGAAGCCGAAAGG + Intronic
1048211825 8:132460633-132460655 ACCTCATTGAAGGTGATGGAGGG - Intronic
1049222920 8:141436058-141436080 TCTGCCTTGCAGGAGCGGGACGG - Intergenic
1052317744 9:27133652-27133674 ACTTGCTTTATGGAGCTCGAGGG + Intronic
1055673237 9:78628358-78628380 ACTTCCTTGATGGAGTTGTCAGG + Intergenic
1057987503 9:99732178-99732200 ATTTCCTTGGAAGAGCTGGATGG + Intergenic
1059328748 9:113521229-113521251 ACGTCCTTGAAGGAGCTCTCAGG - Intronic
1060009066 9:120027412-120027434 ACCTCCTTGATGGGGGTGGAAGG - Intergenic
1060309523 9:122446848-122446870 AGTAACTGGAAGGAGCTGGAGGG - Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1062685973 9:137813677-137813699 CCTCCCGTGAAAGAGCTGGAAGG + Intronic
1203745611 Un_GL000218v1:39363-39385 AGTTCCTTGAAGGAACTGAGGGG + Intergenic
1203564499 Un_KI270744v1:80120-80142 AGTTCCTTGAAGGAACTGAGGGG - Intergenic
1186510161 X:10124651-10124673 ACTTCCTTGACGGTGAGGGAGGG - Intronic
1188900155 X:35722373-35722395 ACTCCATTGGAGGAGCCGGAAGG - Intergenic
1190401339 X:50038654-50038676 ACTTCCTGAAAAGTGCTGGAAGG - Intronic
1191129484 X:56993055-56993077 ACTTCCTTGCAGGGACTGGTGGG - Intronic
1193247877 X:79251259-79251281 ACTGCCTTGAGGGAGGTGGGAGG + Intergenic
1201158937 Y:11154375-11154397 AGTTCCTTGAAGGAACTGAGGGG + Intergenic
1201787026 Y:17795834-17795856 AATTATTTGAAGGAGCTGGAAGG - Intergenic
1201814527 Y:18110154-18110176 AATTATTTGAAGGAGCTGGAAGG + Intergenic
1201865795 Y:18652801-18652823 GGTACTTTGAAGGAGCTGGAAGG - Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202348628 Y:23962661-23962683 AATTTTTTGATGGAGCTGGAAGG - Intergenic
1202522146 Y:25707443-25707465 AATTTTTTGATGGAGCTGGAAGG + Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic