ID: 1151352942

View in Genome Browser
Species Human (GRCh38)
Location 17:73542461-73542483
Sequence GGCTGGAGTTCGCTTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151352942_1151352955 27 Left 1151352942 17:73542461-73542483 CCTGCCACAAGCGAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1151352955 17:73542511-73542533 TCTCAATGAGCAGCCGGGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 131
1151352942_1151352950 2 Left 1151352942 17:73542461-73542483 CCTGCCACAAGCGAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1151352950 17:73542486-73542508 GGCCTGGTGGTGAGCAGCACAGG 0: 1
1: 0
2: 5
3: 47
4: 456
1151352942_1151352951 3 Left 1151352942 17:73542461-73542483 CCTGCCACAAGCGAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1151352951 17:73542487-73542509 GCCTGGTGGTGAGCAGCACAGGG 0: 1
1: 0
2: 1
3: 63
4: 314
1151352942_1151352954 22 Left 1151352942 17:73542461-73542483 CCTGCCACAAGCGAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1151352954 17:73542506-73542528 AGGGCTCTCAATGAGCAGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 140
1151352942_1151352953 21 Left 1151352942 17:73542461-73542483 CCTGCCACAAGCGAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1151352953 17:73542505-73542527 CAGGGCTCTCAATGAGCAGCCGG 0: 1
1: 0
2: 3
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151352942 Original CRISPR GGCTGGAGTTCGCTTGTGGC AGG (reversed) Intronic
900460666 1:2800937-2800959 GGGTGGAGGTGGCTTGAGGCTGG - Intronic
900675139 1:3880737-3880759 GCCTGGAGCTCGCTTGGGCCTGG + Intronic
900919259 1:5660466-5660488 GGCAGGAGGTGGCTTCTGGCAGG - Intergenic
901734549 1:11304211-11304233 GGCTGCAGTTGGCTGGTGGCTGG + Intergenic
901735287 1:11308498-11308520 GGCTGCAGTTGGCTGGTGGCTGG - Intergenic
902250875 1:15153674-15153696 GGCTGGAGGCCGCTCCTGGCCGG + Intronic
904260526 1:29285077-29285099 GGCTGGAGTACAGTTCTGGCTGG + Intronic
904414131 1:30345432-30345454 GGCTGGAGTGCAGTGGTGGCAGG - Intergenic
904468204 1:30720188-30720210 GCCTGGAGTTCACCTGTGGGAGG - Intronic
905681465 1:39875094-39875116 GGCTGGAGTTGGGCTTTGGCTGG - Intronic
913494446 1:119415423-119415445 GGCTGGAGCTGCCTTGTGACAGG + Exonic
913497165 1:119439007-119439029 GGCTGGAGCTGCCTTGTGACAGG + Intergenic
913500342 1:119467227-119467249 GGCTGGAGCTGCCTTGTGACAGG + Intergenic
913504848 1:119507483-119507505 GGCTGGAGCTGCCTTGTGACAGG + Exonic
913511179 1:119564072-119564094 GGCTGGAGCTGCCTTGTGACAGG + Intergenic
913515416 1:119601346-119601368 GGCTGGAGCTGCCTTGTGACAGG + Intergenic
917611689 1:176695166-176695188 GGCTGGAGCTAGCTTGTGAAGGG + Intronic
923717509 1:236437558-236437580 GCCTGGATTTGGGTTGTGGCAGG + Intronic
1063010312 10:2015362-2015384 GGCTGGAGTACACTCGTGGCAGG + Intergenic
1064097640 10:12435716-12435738 GGATGTAGGTCGCCTGTGGCTGG + Intronic
1067850562 10:49751360-49751382 GGCTGGAGTTTGGATCTGGCTGG - Intronic
1069704299 10:70448120-70448142 GGCAGGTGTTTGCATGTGGCTGG - Intergenic
1071454373 10:85833188-85833210 GGCTGGGGACTGCTTGTGGCAGG - Intronic
1076150383 10:128157506-128157528 GGCTGGAGTTCAGTGGGGGCAGG + Intergenic
1077094642 11:794143-794165 GGCTGGACCCCGTTTGTGGCTGG - Intronic
1080260873 11:30348340-30348362 GGCTGGAGTTGGCTTTGGTCTGG + Intergenic
1087388401 11:97503732-97503754 GGCTGGAGCTAGGCTGTGGCAGG - Intergenic
1087881300 11:103419118-103419140 GGCTGGAGTCTGCCTGAGGCAGG + Intronic
1090780670 11:130003395-130003417 GGCGGGAGTTCGGTTTTCGCCGG - Intergenic
1091776100 12:3185826-3185848 AGCTGGAGTTCGGGTGTGGCTGG + Intronic
1092351404 12:7758880-7758902 GGCAGGATTTCCCCTGTGGCTGG + Intergenic
1093466403 12:19453838-19453860 GGCTGGAGTGCGGTGGAGGCGGG + Intronic
1097895871 12:64824622-64824644 GGCAGGAGATCGCTCGAGGCGGG - Exonic
1100100049 12:91092110-91092132 GGCTGGAGTCTGCCTGAGGCAGG - Intergenic
1102251223 12:111388832-111388854 GGCTGGAGTGTGGTGGTGGCAGG - Intergenic
1103395529 12:120604046-120604068 GGCTGGTGCTGGCTTCTGGCAGG + Intergenic
1103835119 12:123812792-123812814 GGCTGGGGTTCTCTTGTGTATGG + Intronic
1104460031 12:128947876-128947898 GGCTGGACTTTGCAGGTGGCAGG + Intronic
1105451881 13:20507455-20507477 GTCTGGAGTCCACTTGGGGCTGG + Intronic
1113054094 13:106249110-106249132 GGCTGGAGTCCGCTTTTGCCAGG - Intergenic
1114549085 14:23522997-23523019 GGCTGGAGGTGGCCTATGGCAGG - Intronic
1118498547 14:66333614-66333636 TGCTGGAGTTTGCTGGAGGCTGG - Intergenic
1119802333 14:77457326-77457348 CGCTGGAGTACGCTTGGGACTGG - Exonic
1122262456 14:100531140-100531162 GGCTGGAGCTGGCCTGGGGCTGG + Intergenic
1125054511 15:35341801-35341823 GGCTGGAGATCCCTTTTGGGAGG + Intronic
1128654895 15:69453229-69453251 GCATGGAGTGCGCTTGAGGCTGG + Intronic
1129463920 15:75713193-75713215 GGCTGGAGTGTGCCTGTGGAGGG - Intergenic
1129591984 15:76924154-76924176 GGCTGGAGTTCAGTTGTGCCAGG + Intergenic
1133416416 16:5610594-5610616 GGCAGGAGGTCGGTTGAGGCAGG + Intergenic
1133775129 16:8889690-8889712 GGGCAGAGTTCGCTGGTGGCTGG + Intergenic
1139831455 16:69801639-69801661 GGCAGGAGATGGCTTGAGGCTGG - Intronic
1142282436 16:89155526-89155548 GGCAGGAGTTCGGGTGGGGCAGG - Exonic
1145786686 17:27598280-27598302 GGCTGGAGACGGCCTGTGGCTGG - Intronic
1146926115 17:36746759-36746781 GGTTTGAATTCGCTTGTGCCAGG + Intergenic
1151352942 17:73542461-73542483 GGCTGGAGTTCGCTTGTGGCAGG - Intronic
1151936232 17:77263338-77263360 GGCTGGAGAGTGCCTGTGGCTGG + Intergenic
1155182384 18:23358990-23359012 GGATCGAGTTTGCATGTGGCTGG - Intronic
1156890346 18:42183842-42183864 GGTTGAAGTTCGTTTGTGACAGG + Intergenic
1159692318 18:71504485-71504507 GGCTGGAGTTAGTTAGTGGAAGG + Intergenic
1160533032 18:79576674-79576696 GGCTGGTGGTCGGTGGTGGCCGG - Intergenic
1161363392 19:3864153-3864175 GGCAGGAGATCTCTTGAGGCCGG + Intronic
1161450752 19:4344051-4344073 GCCTGGAGTTCCCTTGCTGCAGG + Intronic
1163211077 19:15840743-15840765 GGCTGGAGATCGCTTGAACCCGG + Intergenic
1165962603 19:39547933-39547955 GGCGGGAGATCGCTTGAGCCAGG - Intergenic
926186817 2:10697060-10697082 GGCGGGAGATCGCTTGAGGCTGG + Intergenic
926776616 2:16429688-16429710 TGCTGGAGCTCTCTTTTGGCAGG + Intergenic
929588956 2:43132999-43133021 GGCTGGAGTCTGAGTGTGGCTGG - Intergenic
934614904 2:95764727-95764749 GGCTGCAGGTCCCTAGTGGCAGG + Intergenic
934645999 2:96059760-96059782 GGCTGCAGGTCCCTAGTGGCAGG - Intergenic
934839402 2:97615850-97615872 GGCTGCAGGTCCCTAGTGGCAGG - Intergenic
936347209 2:111684160-111684182 GGTGGGAGTTCCCTAGTGGCTGG + Intergenic
937097795 2:119247158-119247180 GGCTGGAGCTGGCTTGTAGAAGG + Intronic
937343190 2:121104928-121104950 GGCTGGAGAAGGCCTGTGGCTGG + Intergenic
943367405 2:186979488-186979510 TGCTGGAGTTCCATTGAGGCAGG + Intergenic
944684989 2:202110177-202110199 GGCTGGAGTTGACTTCTGTCTGG - Intronic
946263639 2:218519679-218519701 GGCTGGAGTGCAGTAGTGGCGGG + Intronic
946782332 2:223204821-223204843 GGCTGGGGTTGGCTTGGAGCTGG + Intergenic
947567051 2:231201019-231201041 GCCAGGAGTTCGCTGTTGGCAGG + Intronic
947898123 2:233694248-233694270 GGCTGTAGTTCGCTGGTCCCTGG - Intronic
948031399 2:234820625-234820647 GGCTGGAGAAGGCTTGTGGCTGG - Intergenic
1170169240 20:13392994-13393016 GGCTGGAGCTCACTTGCAGCAGG + Intronic
1171959854 20:31485749-31485771 GGCTGGAGGACGCTGCTGGCTGG - Intergenic
1172590310 20:36113064-36113086 GGTTGGAGTTGGCGTGGGGCTGG + Intronic
1173136918 20:40446960-40446982 GGCTGGAGTGAGCTTTGGGCAGG + Intergenic
1173871933 20:46347782-46347804 GGCTGCAGTTTGCCTGTGGGAGG - Intronic
1177970825 21:27787478-27787500 GGCTGGAGATCCCTTTTGGGAGG - Intergenic
1183529902 22:38347697-38347719 GGCTGGAGAACCCTGGTGGCAGG + Intronic
1184164034 22:42717004-42717026 TGCTGGAGTAGGCTTGTGGTGGG + Intronic
1184758871 22:46533686-46533708 AGCTGCAGTTCGCCCGTGGCGGG + Exonic
1184888922 22:47367676-47367698 GGCTGGGGTTCACTGGTGGCAGG + Intergenic
949535789 3:4995308-4995330 GGCTGGAATTCCTTTGGGGCAGG + Intergenic
950975567 3:17239254-17239276 GGCTGGTCTTCCATTGTGGCAGG - Intronic
952205229 3:31174696-31174718 GGCAGGAGTGCGCATGTGGTGGG - Intergenic
954922024 3:54199455-54199477 GGCTGGGGATCGCTTGAGCCTGG - Intronic
955807666 3:62754264-62754286 AGCTGGAGGTCGCTTGAGCCTGG - Intronic
957287010 3:78230120-78230142 GGCTGGTTTTCTCCTGTGGCTGG - Intergenic
961269828 3:125680438-125680460 GACTGGAGTTCTCTTGGGTCTGG - Intergenic
962808864 3:138945676-138945698 GCCTGCAGTTCGCTTGTGCCCGG - Exonic
964722793 3:159783952-159783974 GGGTGGAGTGCTCATGTGGCTGG - Intronic
964748257 3:160031798-160031820 GGCTGAAGTTCCCGAGTGGCTGG - Intergenic
965472727 3:169115557-169115579 GGCTGGTCTTGGCTTGTGGCAGG + Exonic
965614211 3:170576601-170576623 GGCTGGATTTCACCTGTGGGTGG + Intronic
968519823 4:1030248-1030270 GGCTGGAGCTAGCTTCTGGTAGG + Intergenic
970069584 4:12142407-12142429 GGCGGGAGATCACTTGAGGCTGG + Intergenic
971433600 4:26594822-26594844 GGCTGGAGTGCAGTTGTAGCGGG - Intronic
976900773 4:90172841-90172863 GGCTGGAGTTAGGTAGTGGTTGG + Intronic
977951775 4:102979433-102979455 GACTGGAGTTCACTAGAGGCTGG - Intronic
979888733 4:126063563-126063585 GGCTGGAGGTCCCTTGAGGAAGG + Intergenic
982835325 4:160115157-160115179 GGCTGGGGTTCCCTTGAGGAAGG + Intergenic
983872188 4:172835282-172835304 AGCTGGAGTTCTCTCGTGCCAGG - Intronic
992766262 5:80003549-80003571 GGCTGGAGCTGTTTTGTGGCTGG - Intronic
995298592 5:110550927-110550949 GGCTGGATTTGGCCTGTGGGTGG - Intronic
996045976 5:118873810-118873832 AGATGGAGTTGGCTTGGGGCAGG - Intronic
997990693 5:138542719-138542741 GGCGGGAGTTGGCTAGTGCCTGG + Intronic
1002424842 5:179168806-179168828 GGCTGGAGGTCTCTTGTTCCAGG + Intronic
1003489752 6:6611085-6611107 GGCTGGAGGTCGGAGGTGGCTGG - Intronic
1004224015 6:13769926-13769948 GGCTGGCGGTCGCGCGTGGCGGG - Intergenic
1013359566 6:109382030-109382052 GCCTGGAGTCCACTCGTGGCCGG - Intronic
1014205251 6:118650614-118650636 GGCTGAAGTTCCCTTGGGGGTGG + Intronic
1017944203 6:159080382-159080404 GCCTGGAGTTCACTTCTGACTGG - Intergenic
1019875159 7:3803792-3803814 GGCTGGAGTGCAGTGGTGGCTGG + Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1034474449 7:151274561-151274583 GGCAGGGTTCCGCTTGTGGCAGG - Intronic
1036707964 8:11059370-11059392 GGCTCCAGTTCGCTGGGGGCTGG - Intronic
1036802736 8:11804648-11804670 GGCTGGAGTGCAGTGGTGGCGGG + Intronic
1040536642 8:48316529-48316551 GGCTGGAGTTCACTGGTGGAGGG + Intergenic
1040546091 8:48398997-48399019 GGCTGGAGTCCTCTGGAGGCAGG + Intergenic
1041501483 8:58543327-58543349 GGCTGAAGGTCGCATGTGGGTGG + Intergenic
1046732986 8:117745863-117745885 GGCTGGAGGTGGCTTGGGGGTGG - Intergenic
1049726078 8:144147176-144147198 GGCTGGCGTTCGTTTGTGATCGG + Intergenic
1052323444 9:27192741-27192763 GGCAGGAGTTCGCTTTTGAATGG + Intronic
1053136855 9:35656486-35656508 GGCTGGTGCTGGCCTGTGGCCGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060666221 9:125433602-125433624 GGCTGGATTTCTCCTGGGGCTGG - Intergenic
1188699393 X:33239225-33239247 GGCTGGAGTTCAGTGGTGGCTGG - Intronic
1190237314 X:48626363-48626385 GGCTGGTGTTGGCTATTGGCTGG + Intergenic
1194226056 X:91259321-91259343 GGCTGGAGTGCAGTGGTGGCAGG + Intergenic
1199551195 X:149063475-149063497 GGCTGCAGTACGCTTGTGATGGG + Intergenic