ID: 1151354182

View in Genome Browser
Species Human (GRCh38)
Location 17:73548773-73548795
Sequence CCCACCATGCAGAGCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151354182_1151354195 30 Left 1151354182 17:73548773-73548795 CCAACCAGGCTCTGCATGGTGGG 0: 1
1: 1
2: 1
3: 26
4: 232
Right 1151354195 17:73548826-73548848 GCTATCCCACGGAGGGCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1151354182_1151354194 23 Left 1151354182 17:73548773-73548795 CCAACCAGGCTCTGCATGGTGGG 0: 1
1: 1
2: 1
3: 26
4: 232
Right 1151354194 17:73548819-73548841 GCTTGCTGCTATCCCACGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1151354182_1151354193 22 Left 1151354182 17:73548773-73548795 CCAACCAGGCTCTGCATGGTGGG 0: 1
1: 1
2: 1
3: 26
4: 232
Right 1151354193 17:73548818-73548840 AGCTTGCTGCTATCCCACGGAGG 0: 1
1: 0
2: 1
3: 1
4: 63
1151354182_1151354192 19 Left 1151354182 17:73548773-73548795 CCAACCAGGCTCTGCATGGTGGG 0: 1
1: 1
2: 1
3: 26
4: 232
Right 1151354192 17:73548815-73548837 TTAAGCTTGCTGCTATCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151354182 Original CRISPR CCCACCATGCAGAGCCTGGT TGG (reversed) Intronic
900420745 1:2554989-2555011 CCCCACATGCAGAGCCATGTGGG - Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
900956547 1:5889631-5889653 CCCACCATGCAGAGCCTGCTGGG + Intronic
902390042 1:16098317-16098339 GCCACCATGCCCAGCCTGCTTGG - Intergenic
903538300 1:24081996-24082018 CCTACCTTGCAGACCCGGGTGGG + Exonic
904484368 1:30815034-30815056 CCGATCACGCAGAGCCTCGTGGG - Intergenic
905252371 1:36657931-36657953 GCCACTATGCCCAGCCTGGTTGG + Intergenic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905801592 1:40847586-40847608 TCCACCCTTCAGAGCCTGCTGGG - Intergenic
906179124 1:43803208-43803230 GCCACCATGCTTAGCCTGGTCGG + Intronic
906197488 1:43937854-43937876 CCCAAGATGCAGATCCTGCTGGG - Intergenic
907224578 1:52933298-52933320 GCCACCATGCCCAGCCTGATGGG - Intronic
911195533 1:94991021-94991043 GCAATCATGCAGACCCTGGTTGG + Intronic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915208019 1:154285533-154285555 GCCACCATGCCCAGCCTGGATGG + Intergenic
918265074 1:182834491-182834513 CCCAACATGCAGAGGCTGAGAGG - Intergenic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
921193105 1:212726931-212726953 CCCACCATGAAGAGACAGGACGG - Intronic
921813356 1:219539433-219539455 CCCACCAAACAAAGCCTGTTGGG - Intergenic
922893807 1:229083967-229083989 GCCACCATGCTTAGCCTGTTGGG + Intergenic
924745978 1:246834013-246834035 CACACCATGCAGAGCCACATGGG - Intergenic
1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG + Intergenic
1065277117 10:24096553-24096575 CAGACCCTGCAGAGCCTGGTAGG - Intronic
1067287177 10:44915003-44915025 CCCTCCATGCCCAGCCTGGACGG - Intronic
1067374306 10:45713242-45713264 CCCAGCATTCAGAACCTGGTAGG - Intergenic
1067731236 10:48812908-48812930 CCCACCAGGCAGACGATGGTGGG - Intronic
1067882141 10:50054996-50055018 CCCAGCATTCAGAACCTGGTAGG - Intergenic
1069744839 10:70708608-70708630 CCCAACCTGCTGGGCCTGGTGGG + Exonic
1070084870 10:73227369-73227391 GCCACCATGCCCAGCCTGCTTGG + Intronic
1072121674 10:92410395-92410417 ACCACCATGCAGAGCCATGGGGG - Intergenic
1073064238 10:100748915-100748937 CGCGCCTCGCAGAGCCTGGTTGG - Intronic
1073066420 10:100762075-100762097 GCCGCCATGCCGAGCCTGGCAGG - Intronic
1073308134 10:102519236-102519258 GCCACCATGCCCAGCCTGGTTGG - Intronic
1073559808 10:104487104-104487126 CAGACCATGCAGAGCCTGAATGG + Intergenic
1076629067 10:131841875-131841897 CCCACCGTGCAGGGCCTCCTGGG + Intergenic
1076798624 10:132810662-132810684 GCCATCCTGCTGAGCCTGGTGGG - Intronic
1078508717 11:11969702-11969724 CCCACCTGGAAGAGCCTGGCCGG + Intronic
1078904981 11:15675538-15675560 CCCACCATCCAGATCCAGGTAGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1080857447 11:36124521-36124543 CCCACCTTGCAGAGCCCAGTTGG - Intronic
1081692635 11:45088564-45088586 CCCAGCCTGCAGAGCCTGCAAGG + Intergenic
1081733959 11:45390880-45390902 CCCTCCATGGAGTGCCTGTTTGG - Intergenic
1083229636 11:61308142-61308164 CAGAACGTGCAGAGCCTGGTAGG - Intronic
1083770840 11:64866407-64866429 GCCACCATGCCCAGCCTGCTAGG - Intronic
1084485412 11:69445083-69445105 CCCACCAAACAGAGGCTGCTGGG - Intergenic
1084760662 11:71268694-71268716 CCCACCTTGCAGAGGCAGCTGGG - Intergenic
1086215371 11:84373281-84373303 GCCACCGTGCCGGGCCTGGTGGG - Intronic
1090032557 11:123219634-123219656 CCCAGCACCCAGAGCCTTGTGGG - Intergenic
1092877883 12:12864336-12864358 GGCACCATGCAGAGCCTGCCAGG - Intergenic
1093054056 12:14536800-14536822 GCCACCATGCACAGCCTGCAAGG - Intronic
1095458475 12:42415603-42415625 GCCACGAATCAGAGCCTGGTAGG - Intronic
1101725394 12:107384428-107384450 CCCAGAATGGAGACCCTGGTTGG + Intronic
1101821182 12:108185370-108185392 GACACCATGCAGAGACTGGGAGG - Intronic
1102012756 12:109628677-109628699 CCCACCTCACAGAGCCTGGGGGG + Intergenic
1102017991 12:109661111-109661133 CCCACCACACAGAGCCAGGATGG + Intergenic
1102025369 12:109711593-109711615 CCCACCAAGGAGAGTCTGATTGG + Intergenic
1102349722 12:112183626-112183648 CCCTCCTTGCAGAGCCTGCTGGG + Intronic
1103381622 12:120498094-120498116 CCCACGATGCAATGCCAGGTGGG - Exonic
1103710677 12:122910245-122910267 CCCACTGTGTAGAGCCTGGGAGG + Intergenic
1104417788 12:128609542-128609564 GCCACCGTGCACAGCCTGTTTGG + Intronic
1106751944 13:32781751-32781773 CCCATGATGCAGAGCTTCGTGGG - Intergenic
1107336063 13:39356881-39356903 GCCACCATGCCCAGCCTGATTGG - Intronic
1112316010 13:98362541-98362563 TCCACCATGGACAGCCAGGTAGG - Intronic
1112734936 13:102405927-102405949 TCAACAGTGCAGAGCCTGGTGGG - Intergenic
1113698213 13:112364061-112364083 ACCAGCATGCAGACCCCGGTGGG - Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1119390309 14:74287135-74287157 CCCACCAAGCTGTGCCTGGCAGG - Intronic
1120187850 14:81413123-81413145 CCCACGATGCAGTGTCAGGTGGG - Intronic
1120928913 14:89827520-89827542 CCCACCATGCAGAGTATAGAAGG + Intronic
1121996272 14:98606066-98606088 CCCACCCTCCAGAGCCAGTTAGG + Intergenic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1123136741 14:106034339-106034361 ACCAGCATGCAGATCCTGCTGGG - Intergenic
1202853965 14_GL000225v1_random:38153-38175 GCCACCATGGAGGGCCTGGCGGG + Intergenic
1124233917 15:27970469-27970491 CCCACCATGCCGTGCCTGCTGGG - Intronic
1124233992 15:27970965-27970987 CCCACCATGCCGTGCTTGCTGGG - Intronic
1124234000 15:27971004-27971026 CCCAGCATGCAAGGCATGGTGGG + Intronic
1125679321 15:41520949-41520971 CCCTCGGTGCAGAGCCTGGGAGG + Exonic
1125793689 15:42388939-42388961 CCCACCTTTCAGAGCTTCGTAGG - Exonic
1126515892 15:49537763-49537785 CCCACAATGTAGAACCTGGAAGG + Intronic
1127265369 15:57356593-57356615 GCCACCATGCCCAGCCTGGTTGG - Intergenic
1129196813 15:73973356-73973378 CCCAGCATGCAGACCAAGGTTGG + Intergenic
1130743202 15:86623268-86623290 TCAATCATGTAGAGCCTGGTTGG + Intronic
1132759036 16:1500099-1500121 CCCATGCTGCAGAGCCTGCTGGG + Exonic
1133150306 16:3823495-3823517 CCCTCCCTGCAGAGAGTGGTGGG - Intronic
1134552607 16:15145009-15145031 CCCACCCTTCACAGCCTGGGTGG + Intergenic
1135222651 16:20626097-20626119 GCCACCATGCCCAGCCTGGATGG - Intronic
1136068606 16:27775067-27775089 CCCATCCTGCCGGGCCTGGTGGG + Exonic
1137670618 16:50276177-50276199 CCCTCCATGTAGGGCCTAGTTGG - Intronic
1137965942 16:52933838-52933860 CCCACTCTGCAGGTCCTGGTAGG - Intergenic
1138673951 16:58637414-58637436 GCCACCATGCACAGCCTAGAGGG - Intergenic
1141300461 16:82810780-82810802 TGGACCATGCAGAGCCTTGTAGG + Intronic
1141995162 16:87632305-87632327 CCCACCAGGCAGAGGAGGGTGGG - Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142269465 16:89081647-89081669 CCCACGATCCAGAGCCTCCTGGG - Intergenic
1142325686 16:89413046-89413068 CCCATCAACCAGAGCCTGGAGGG + Intronic
1144966501 17:19079898-19079920 CCCACCATGCCCAGCCTGAATGG + Intergenic
1144981417 17:19172159-19172181 CCCACCATGCCCAGCCTGAATGG - Intergenic
1144986807 17:19206080-19206102 CCCACCATGCCCAGCCTGAATGG + Intergenic
1147175575 17:38654275-38654297 CCCAGCCTGCAGAGCCTGTCAGG + Intergenic
1147610949 17:41801516-41801538 CCCACATTCCAGAGCCGGGTTGG - Intergenic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1150287813 17:63963796-63963818 CCCACCTTCCAGAGCTTGGGCGG + Exonic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1152585269 17:81186471-81186493 ACCACCATGCCCAGCCTGTTGGG - Intergenic
1152616075 17:81338497-81338519 CCCACTGTGCAGAGGCTGCTTGG - Intergenic
1153968528 18:10203548-10203570 CCCAGCATCCAGTGCCAGGTAGG - Intergenic
1155026727 18:21947329-21947351 GCCACCATGCCCAGACTGGTGGG + Intergenic
1157601282 18:48894514-48894536 GCCACCACGCCCAGCCTGGTGGG - Intergenic
1158187864 18:54791948-54791970 CCCACCATGGAGAGCCAGAAGGG - Intronic
1161649110 19:5473418-5473440 GCCACCATGCCCAGCCAGGTTGG + Intergenic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1162602996 19:11683713-11683735 GCCACCATGCCAAGCCTGTTTGG + Intergenic
1162923877 19:13919853-13919875 CCCACCCAGCAGAGTCTGGTGGG + Exonic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1164676488 19:30104888-30104910 CCCACCATGTAGAGCTCTGTGGG - Intergenic
1165097815 19:33419286-33419308 CCCACAGTGCAGTGCCTTGTGGG - Intronic
1166749061 19:45156113-45156135 CCCACCAGGCTGAGGCTGGGAGG + Intronic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
925615653 2:5742378-5742400 CCCACCTTGCAGCTCCTGCTTGG - Intergenic
925835610 2:7943463-7943485 CCCATCCTGGAGAGGCTGGTGGG + Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
926220771 2:10934304-10934326 CTCTCCAAGCAGAGCATGGTGGG - Intergenic
927742236 2:25581925-25581947 CCCACCATTCAGAGGCAGGGTGG + Intronic
929321582 2:40550259-40550281 CCCAATATGCAGATGCTGGTGGG + Intronic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
931365852 2:61618128-61618150 GCCACCATGCAGAGCCACATGGG - Intergenic
931934610 2:67182754-67182776 CCCATCATGAAGAACCTTGTAGG + Intergenic
932721634 2:74142961-74142983 CCCTCGAGGCAGAGCTTGGTGGG + Intronic
933159401 2:79007507-79007529 CGCACCATGCAGAGTGTGGCAGG + Intergenic
933837370 2:86256668-86256690 CACACCATGCAGAGCCATGTTGG - Intronic
937884305 2:126889574-126889596 AGCACCCTGCAGAGCCTGGCAGG - Intergenic
937906269 2:127054353-127054375 GCCACCATCCACAGACTGGTGGG + Intronic
938248732 2:129797806-129797828 CACAGCATGCAGAACCTCGTGGG + Intergenic
938810653 2:134849798-134849820 CACCCCATGCAGATCCTGGCAGG - Intronic
941483515 2:166048352-166048374 CCCACCTTGCACACTCTGGTAGG + Intronic
944388116 2:199187417-199187439 GCCACCATGCCCAGCCTGGAAGG - Intergenic
947447450 2:230174905-230174927 CCCACCTTCCAGGGCCAGGTTGG - Intronic
948066822 2:235087322-235087344 CCCACCATGCTGTTCCTGGCGGG + Intergenic
1170408397 20:16063470-16063492 CCCATCATGGAAAGCCTTGTAGG + Intergenic
1171881141 20:30618002-30618024 CCCAGTCAGCAGAGCCTGGTGGG - Intergenic
1172386498 20:34537650-34537672 GCCACCACGCAGAGCCTAGGAGG + Intronic
1173253242 20:41375515-41375537 CCCACCATGGAGTGGGTGGTTGG + Intergenic
1174149925 20:48478628-48478650 CACCCCATGCAGAGCTTGATGGG + Intergenic
1174703748 20:52635142-52635164 CCCACCATGAACTGCCTGCTAGG - Intergenic
1175416394 20:58804137-58804159 CACAACATCCAGAGCCTGGATGG + Intergenic
1176040747 20:63064567-63064589 CCCACCAACCAGAGCCCGGGCGG - Intergenic
1176919564 21:14670755-14670777 GCCACCAGGCACAGCCTGGAAGG + Intergenic
1179790908 21:43755503-43755525 CCCACCACGGAGAGCCCGGAGGG - Intronic
1180004611 21:45014569-45014591 CCCGCCGAGCAGGGCCTGGTTGG + Intergenic
1180210852 21:46294988-46295010 CCCGCCATGCACACCCTGCTGGG + Intronic
1181044117 22:20206620-20206642 CCCACCATAAAGAGCCCGGCTGG - Intergenic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1181166079 22:20983759-20983781 CCCAGTATGCAGATCCTGGTGGG - Intronic
1183231790 22:36586982-36587004 CCCACCAGGCAGTGCCAGATTGG - Intronic
950092422 3:10305220-10305242 CACCCCAGGCAGAGCCTGTTGGG - Intronic
953442028 3:42926573-42926595 CACACCATGCAGAGCCATATGGG - Intronic
954942942 3:54391795-54391817 GCCACCATGCCCAGCCTGGCAGG + Intronic
954988069 3:54813271-54813293 CCAGCAAGGCAGAGCCTGGTTGG + Intronic
955347784 3:58173628-58173650 CCCACCGGGCAGAGCCTGAATGG - Intergenic
958575583 3:95946592-95946614 GCCACCATGCCTAGCCTGATGGG + Intergenic
961257341 3:125567704-125567726 GCCACCATGCCTAGCCTAGTAGG - Intronic
961444508 3:126972840-126972862 CCAGCCATGGAGAGCCTGCTGGG - Intergenic
962731958 3:138291897-138291919 CAGACCATGAAGAGCCTTGTAGG + Intronic
963633812 3:147768083-147768105 TCCCCAATGCAGGGCCTGGTGGG + Intergenic
967461007 3:189745420-189745442 GCCACCATGCCCAGCCTGTTTGG - Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969418539 4:7076424-7076446 CCCACCATGCAGCGCACAGTGGG - Intergenic
969691914 4:8708599-8708621 CCCAGGATGCAGGGCGTGGTGGG - Intergenic
970795239 4:19904519-19904541 CCCACCATTCACGCCCTGGTGGG - Intergenic
970800165 4:19963952-19963974 GCCACCATGAGGTGCCTGGTGGG - Intergenic
975165170 4:71170056-71170078 CCAGCCATGCAGAGCATGTTGGG - Intergenic
976536899 4:86227961-86227983 CACACCATGCAGGGCCATGTGGG + Intronic
978154376 4:105473288-105473310 TCCACCATCCAAAGCCTCGTTGG - Intronic
978536815 4:109771268-109771290 GCCACCATGCACAGCCTGCCTGG - Intronic
981198551 4:141949803-141949825 CTCAGCATGTAGGGCCTGGTGGG + Intergenic
981499161 4:145429799-145429821 CCCACCATGGCTAGCATGGTGGG - Intergenic
983354482 4:166638080-166638102 GCCACCATGCAGAGCCCTGGGGG - Intergenic
983374414 4:166906454-166906476 GCCACCATGCCTGGCCTGGTTGG + Intronic
985170063 4:187139190-187139212 CCCACTATGCAGAGGCTGATGGG + Intergenic
985586952 5:745424-745446 CCCACCATGCAGGCCCTGTGAGG + Intronic
985601524 5:837606-837628 CCCACCATGCAGGCCCTGTGAGG + Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987128008 5:14833425-14833447 CCTACCCTGCAGAGCTTGTTAGG + Intronic
987860734 5:23484891-23484913 ACCACCATGCATGGCCTGGGTGG - Intergenic
990502544 5:56410756-56410778 CCCAGCTTGCTGAGCATGGTGGG + Intergenic
992210864 5:74478370-74478392 CACAGGATGCAGAGCATGGTGGG + Intergenic
992414361 5:76538695-76538717 TCCACCATTCAGAGACTGGAAGG - Intronic
993571999 5:89552295-89552317 CTTACCATGCAGTGCTTGGTAGG - Intergenic
994080615 5:95705251-95705273 GCCACCATGCCTAGCCAGGTTGG + Intergenic
994516317 5:100776760-100776782 CTCACCATCCAGAGGCTGGGAGG - Intergenic
996765407 5:127030580-127030602 CCTCCCCTCCAGAGCCTGGTCGG - Exonic
997183767 5:131860731-131860753 GCCACCATGCCCAGCCTGTTTGG + Intronic
997367544 5:133335544-133335566 CCAACCATGCAAGGCCTGGAGGG - Intronic
998130671 5:139649700-139649722 CGCAGCGTGCAGAGCCTGGGAGG + Intronic
998137235 5:139680518-139680540 CCCACCATGTCGAGCCTCGGCGG + Exonic
998633590 5:143928073-143928095 CCCACCATGCCCAGCCTGCCTGG - Intergenic
999083158 5:148863395-148863417 CCCACTCTGCAGAGCCAGCTGGG - Intergenic
1001671796 5:173479810-173479832 TCCAGCATGCAGAGGCTGCTTGG + Intergenic
1002834644 6:855794-855816 CCCACCATCATGAGCCTGGGAGG - Intergenic
1003365993 6:5475587-5475609 CCCATGATGCAGAGCCTTGAAGG - Intronic
1003473666 6:6461574-6461596 GCAACCATGCAGAGCCTGGGAGG + Intergenic
1003489636 6:6610081-6610103 ACCACCATACAGATCCTGGCTGG - Intronic
1004171680 6:13300130-13300152 CCAATCATGTAGAGCCTAGTGGG - Intronic
1007178921 6:39914609-39914631 CCCAGCCTGCACAGCCTGGGTGG + Intronic
1009455930 6:63856108-63856130 CCAACCAAGCAGAGCCTGATAGG + Intronic
1009994081 6:70879911-70879933 CCAACCATGCAGGGCCTGGGAGG + Intronic
1010906614 6:81499261-81499283 GCCACCACACACAGCCTGGTGGG + Intronic
1011107208 6:83795844-83795866 CTCACCATGCAGACTCTGCTGGG - Intergenic
1013327497 6:109062174-109062196 GCCACCATGCCCAGCCTGGAAGG + Intronic
1015437283 6:133203701-133203723 GCCACCATGCCGAGCCTGTTTGG + Intergenic
1017613757 6:156221773-156221795 GCCACCATGCCCAGCCTGATTGG - Intergenic
1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG + Intronic
1019356519 7:582751-582773 CTGACTATGCAGTGCCTGGTGGG + Intronic
1019405831 7:883660-883682 CGCAGCATGCAGAGCCGGGCCGG + Intronic
1023643334 7:42283476-42283498 CCCACCCTGCAGACTCTGCTGGG - Intergenic
1024188285 7:46977185-46977207 ACCACCAGTCACAGCCTGGTGGG + Intergenic
1024230723 7:47361295-47361317 CCCACCATGGAGGGCCAGGATGG - Intronic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1025258981 7:57404660-57404682 CCCAGCATGCAGAGCCAGGCCGG - Intergenic
1026844988 7:73693727-73693749 CTCAGCCTGCAGAGCCTGCTGGG + Intronic
1029572485 7:101379387-101379409 CCCATCAGGCAGAGCCAGGACGG - Intronic
1030729664 7:112971644-112971666 TAGACCATGCAGAGCCTTGTAGG + Intergenic
1032084162 7:128874797-128874819 TGCACCATGCGGAGCCTGGAGGG + Intronic
1034212954 7:149381218-149381240 CCCACCATGCAGAGCCACATGGG + Intergenic
1034252322 7:149702051-149702073 CACACTCTGCAGAGCCTGTTGGG - Intergenic
1035044715 7:155956101-155956123 CCCACCATGGAGAGCAGGGAGGG - Intergenic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036103506 8:5814225-5814247 CCCACCATACAAACCCTGGGAGG + Intergenic
1036543945 8:9748165-9748187 CCCACCATGAAGAACCAGGAAGG + Exonic
1036684054 8:10897200-10897222 CCCACTTTGCAGAGCCTTCTAGG - Exonic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038446562 8:27608633-27608655 CACCCCATCCAGAGCCTGCTTGG + Intronic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1045571034 8:103370107-103370129 CCCACCACGTAGGGCCAGGTTGG - Intergenic
1049210656 8:141385041-141385063 CCCTCCATGGGGAGCCTGGTGGG - Intergenic
1049767843 8:144363207-144363229 CCCACCACGCAGGGCCTGCTGGG + Intergenic
1051357850 9:16255753-16255775 GGCACCATGCACAGCCTGCTGGG - Intronic
1053242122 9:36504589-36504611 CCCTCCCTGCAGAGGCTGTTGGG + Intergenic
1053321978 9:37106833-37106855 GCCACCATGCCCAGCCTGATGGG + Intergenic
1057215401 9:93225110-93225132 GCCACCATGCCCAGCCTGCTTGG - Intronic
1057585072 9:96321673-96321695 CCCTGCATGCCGAGCCTAGTGGG + Intronic
1058425733 9:104874247-104874269 GCCACCATGCCCAGCCTGTTTGG - Intronic
1061719066 9:132540459-132540481 CCCACCATACTGTGCCTGTTGGG + Intronic
1061806601 9:133140637-133140659 CCCACCATGCAGTGCAGGGAGGG + Intronic
1062011277 9:134268186-134268208 CCCACCAAGCAGATCCTGGTGGG + Intergenic
1186943695 X:14541108-14541130 CCCAGCATGGGGAGCCTGGAGGG - Intronic
1187008816 X:15259025-15259047 CCCTCCATCCAGGGCCTGTTAGG - Intronic
1189249054 X:39585910-39585932 GCCACCAGGCAGAGAGTGGTGGG + Intergenic
1189938803 X:46098885-46098907 TCCACCATTCAGAGCCTCCTGGG + Intergenic
1190307589 X:49094120-49094142 GGCACCATGCTGAGCCTGGGAGG - Intronic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1195447489 X:104971059-104971081 CCCACCATGCCCGGCCTCGTAGG - Intronic
1196029071 X:111075673-111075695 TCCACCAGGCAGTACCTGGTTGG - Intronic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1198910151 X:141604656-141604678 CATACCATACAGAGCCTTGTAGG + Intronic
1199844149 X:151678717-151678739 ACCACCATGCAAAGCCTGGCTGG + Intergenic
1200181470 X:154153400-154153422 CCCACCTTTCAGAGGCTGCTTGG + Intronic
1200187116 X:154190514-154190536 CCCACCTTTCAGAGGCTGCTTGG + Intergenic
1200192765 X:154227652-154227674 CCCACCTTTCAGAGGCTGCTTGG + Intronic
1200198520 X:154265456-154265478 CCCACCTTTCAGAGGCTGCTTGG + Intronic