ID: 1151354921

View in Genome Browser
Species Human (GRCh38)
Location 17:73552702-73552724
Sequence CTGACTGCAGAGCTTGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151354921 Original CRISPR CTGACTGCAGAGCTTGAGGA CGG Intronic
900095347 1:937937-937959 CTGACGGCAGGGCTTGTGGGGGG + Intronic
900329123 1:2125441-2125463 CTGACAGCAGCATTTGAGGACGG + Intronic
900606769 1:3527179-3527201 CTGACGCCAGAGTTTTAGGATGG - Intronic
901082045 1:6589033-6589055 CCGCCTGCAGAGCTGGAGGTGGG + Exonic
902106165 1:14037968-14037990 CTACCTGCAAAGCTTAAGGAAGG + Intergenic
903798528 1:25948745-25948767 GTGACTGAAAAGCTTGAGGCAGG - Intergenic
904231404 1:29076794-29076816 CTTACTGAAGAGGTTGAGGCAGG + Intronic
906188564 1:43880690-43880712 CCAACTGCAGGGGTTGAGGAGGG - Intronic
906300492 1:44678037-44678059 GTGACTGGAGAGGCTGAGGATGG + Intronic
906844547 1:49177600-49177622 CTGAGTGCAGAGCTTCACGCTGG - Intronic
906964417 1:50442623-50442645 CTGACTGCAGCACCTGAGGCAGG + Intronic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
909109781 1:71460254-71460276 CTGACTGCAGAGCTTGTACTTGG - Intronic
912978830 1:114352686-114352708 CTCCCTGCTGAGGTTGAGGAGGG - Intergenic
913960108 1:143332872-143332894 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914054464 1:144158445-144158467 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914124682 1:144807916-144807938 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
914521151 1:148417584-148417606 CTGCCTGCAGAGCAGGAGGCAGG - Intergenic
916164487 1:161953591-161953613 CTGACAGGAGAGATTCAGGATGG - Intronic
916430939 1:164727791-164727813 CTGACTGCTGATCTGGAGGCTGG - Intronic
917591295 1:176479783-176479805 CTGACTGCAGTGCTTGGAGAAGG - Intronic
918140031 1:181712500-181712522 TTGACTGCAGAGCTTAGAGAGGG - Intronic
918296573 1:183162706-183162728 CTGAGTGCAGTCCTTGATGAGGG + Intergenic
920258041 1:204669765-204669787 CAGAGTGCAGAGCATGAGGGAGG + Intronic
920798321 1:209162012-209162034 TTGACCCCAGAGCTTGACGATGG - Intergenic
920844798 1:209584671-209584693 CTGACTCCAGAGCAAGAGGCTGG - Intronic
921157737 1:212451423-212451445 CTGACTTCAGAGGCTGAGGAGGG - Intergenic
921528507 1:216249348-216249370 TAGATTCCAGAGCTTGAGGAAGG - Intronic
922770071 1:228176875-228176897 CTGACTGCAGCGGGTGAGGCTGG - Exonic
923151212 1:231235092-231235114 CTGTCTGCAGACCTTGCAGATGG - Intronic
923402275 1:233626538-233626560 CTCACTGCAGAGGCTGAAGAAGG + Intronic
923508151 1:234624637-234624659 CTTACTGCAGAGGTTGATGGGGG + Intergenic
923903074 1:238350550-238350572 CTGACTGAAGGGATTGGGGAAGG - Intergenic
923978839 1:239297250-239297272 TTGGAAGCAGAGCTTGAGGAGGG + Intergenic
924402349 1:243699409-243699431 GTGACTGCAGTGCTTGCTGAAGG - Intronic
924432777 1:244010736-244010758 TGGACAGCAGGGCTTGAGGATGG - Intergenic
1063483880 10:6401328-6401350 TTGAGTACAGAGCTTGAGAACGG - Intergenic
1063988732 10:11536638-11536660 TTGAGTCCAGAGCTTGAGGATGG - Intronic
1064106099 10:12502219-12502241 ATGGATGCAGAGCTTTAGGAAGG + Intronic
1069411478 10:68158196-68158218 CTGAGCGCACAGCTTCAGGAGGG - Intronic
1069728681 10:70597622-70597644 GTGACTGCAGGGCTTGAGAATGG + Exonic
1070452562 10:76576622-76576644 CTGAATGCAGAGCTCTAGGAAGG + Intergenic
1070666575 10:78349320-78349342 CTGGCTGCTGATCTTGCGGATGG + Intergenic
1070871736 10:79760530-79760552 GTGACTCCAGAGCCTGAGGCAGG + Intergenic
1070969211 10:80549690-80549712 CTCACTGCTGGGCCTGAGGAAGG - Intronic
1071638657 10:87282693-87282715 GTGACTCCAGAGCCTGAGGCAGG + Intergenic
1071656583 10:87455259-87455281 GTGACTCCAGAGCCTGAGGCAGG - Intergenic
1073461915 10:103670714-103670736 CTGACTGCTGAACCTGGGGAGGG - Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1075675318 10:124292005-124292027 CTGGCTGTTGACCTTGAGGAAGG + Intergenic
1075816967 10:125271862-125271884 CTGAGTGCAGAGCTTGAGCTGGG - Intergenic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1080437215 11:32256140-32256162 CTGTCTGCAGAGCTGGCAGATGG + Intergenic
1080743670 11:35088427-35088449 ATGAGGGCAGAGCTTAAGGAGGG - Intergenic
1081743196 11:45455281-45455303 CTGGATGCAGAGCCTGAGGCAGG - Intergenic
1081918787 11:46753385-46753407 CGGATTGAAGATCTTGAGGAAGG - Exonic
1083961587 11:66017587-66017609 CTGACTACACAGCATGATGAAGG - Intronic
1084144729 11:67258942-67258964 CTGACTGCTGAGTCTCAGGAGGG + Intergenic
1085064724 11:73483691-73483713 CTGTATGCAGGGCTTGAAGAGGG + Intronic
1085083635 11:73652583-73652605 CTGACCCCAGAGCCTCAGGAAGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1085980259 11:81716262-81716284 GTCAATGCAGTGCTTGAGGATGG + Intergenic
1086607324 11:88711186-88711208 CTGACAGCAGAGTTTGTGAAAGG + Intronic
1086929052 11:92672315-92672337 CAGGCTGCAGAGCATGTGGATGG - Intronic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088776155 11:113085383-113085405 ATAACTGCAGAGCTGGAGGCAGG - Intronic
1089343495 11:117775498-117775520 CTGACTTCAGAGCTTGTAGCAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092182095 12:6452978-6453000 ATGACTCCACAGCTTGAGGGCGG + Intronic
1094293932 12:28882242-28882264 TTGTCTGCAGAGCATGAGAAAGG - Intergenic
1094312908 12:29105327-29105349 CAGACTTCAGATCTTGAGGATGG - Intergenic
1094364205 12:29662920-29662942 TTAAATGCAGTGCTTGAGGATGG - Intronic
1094607102 12:31958514-31958536 TTGAGTGCAAAGTTTGAGGATGG + Intergenic
1095428567 12:42107344-42107366 CTGACTGCAGGGCCTGAGTAGGG + Intronic
1095631526 12:44382275-44382297 TTGACTTCAGAGCCAGAGGAAGG + Intronic
1095750302 12:45703185-45703207 ATGATTGCAGAGCTTGAATAGGG - Intergenic
1095990998 12:48034559-48034581 GTGAGAGAAGAGCTTGAGGAGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098516111 12:71377857-71377879 ATGACTGAAGAGCTTGTGGGAGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1103690354 12:122767954-122767976 ATGACAGGAGAGGTTGAGGAAGG + Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1103978634 12:124721044-124721066 CTGACTGCAGAGCAGGGTGATGG - Intergenic
1104060940 12:125267684-125267706 CTCATTACAGAGCTTGAGCATGG + Intronic
1104275701 12:127325417-127325439 ATGATGGCAGAGCCTGAGGATGG + Intergenic
1104462747 12:128968853-128968875 CTGACTGCAGAGCCTGAGCTCGG + Intronic
1104933153 12:132351028-132351050 GGGACTGCAGGGCTTGGGGAGGG + Intergenic
1105296612 13:19092059-19092081 CTGAAGGAGGAGCTTGAGGAAGG - Intergenic
1107301144 13:38966935-38966957 CTACCTGCAGACCTTGAGCACGG - Exonic
1107494538 13:40913107-40913129 TTGACTGAAGAGCTTTAGGAAGG - Intergenic
1110810543 13:79807443-79807465 CTGACTGCAGAGACCCAGGAGGG - Intergenic
1111186044 13:84736985-84737007 CTGAGTTCATACCTTGAGGAGGG - Intergenic
1111353300 13:87062533-87062555 ATGACCGCAGGGCTTGAGTATGG + Intergenic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113830624 13:113292746-113292768 TTGAGTGCAGAGCTTGAGGATGG - Intergenic
1115125219 14:29984582-29984604 CTGATTCCAGAGCTTGAAAATGG + Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116112168 14:40599939-40599961 CCTACTGCAGAGCTTGAGACAGG + Intergenic
1116551974 14:46251776-46251798 CTGACTGGAACTCTTGAGGACGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1117815338 14:59592384-59592406 CTGATTAAGGAGCTTGAGGAGGG + Intergenic
1119739680 14:77006251-77006273 CTGACAGCAAAGCTGGTGGAAGG - Intergenic
1121316327 14:92962967-92962989 GGGACTGCAGAGGTTGGGGACGG - Intronic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122392293 14:101398200-101398222 CTTTCTGCAGAGGTTGACGACGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123187482 14:106534012-106534034 CTGACTTCAGACCTTGCAGAAGG + Intergenic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124200148 15:27672299-27672321 CTGACTGCAGAGGCTGTGGCTGG + Intergenic
1124602959 15:31150013-31150035 CTTCCTGCACAGCTAGAGGATGG - Intronic
1124628182 15:31322099-31322121 CTCACTGTGGAGTTTGAGGATGG - Intergenic
1125770173 15:42159924-42159946 GTGACTGCAGCTCCTGAGGATGG - Exonic
1126418869 15:48450165-48450187 CTGATTTCCGATCTTGAGGAAGG + Intronic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1128645521 15:69376022-69376044 CTGGATGCTGAGCTTGAGGCAGG + Intronic
1128830622 15:70764793-70764815 ATGACTGGAGATCTAGAGGAAGG - Intergenic
1130106569 15:80932930-80932952 CCAACTGCAGAGATGGAGGAGGG - Intronic
1130150956 15:81311178-81311200 ATGCCTGCAGTGTTTGAGGATGG - Exonic
1131687052 15:94779452-94779474 TTGGATGCAGAGCCTGAGGAAGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132355864 15:101170817-101170839 ATGACTGCAAAGCTTGAGTCAGG - Intergenic
1134108371 16:11499568-11499590 CTGACCGCAGGGTTTGAGGTGGG - Intronic
1135324866 16:21519958-21519980 CTCGATCCAGAGCTTGAGGAAGG + Intergenic
1135925170 16:26687634-26687656 CTGGCTGCATGGCTTGGGGATGG + Intergenic
1136336353 16:29613233-29613255 CTCGATCCAGAGCTTGAGGAAGG + Intergenic
1136499820 16:30664600-30664622 CAGACAGCAGGGCTTGAGGAGGG + Intronic
1136664717 16:31799831-31799853 CTAACTTCAGATCCTGAGGAAGG - Intergenic
1137494861 16:48961879-48961901 CTGATCACAGACCTTGAGGAAGG - Intergenic
1137747268 16:50831717-50831739 CTAAAAGCAGAGCTTGAGAAAGG + Intergenic
1138295350 16:55880514-55880536 CTGAAAGCAGAGCCTGAGGCAGG - Intronic
1138813479 16:60177853-60177875 GTGACTGCAGGGCTAGAGGAAGG + Intergenic
1139021935 16:62760702-62760724 CTGACAGCAGCTGTTGAGGAGGG + Intergenic
1139081584 16:63528550-63528572 GTGACTTCAGAGGCTGAGGAGGG - Intergenic
1140451128 16:75071655-75071677 CAGACTCCAGTGCTTGATGAAGG + Intronic
1140550395 16:75859388-75859410 ATGATAGCAGAGCTTGAGAAGGG + Intergenic
1140735482 16:77894386-77894408 CTGAATGCAGAGGTTGGTGAAGG + Intronic
1141574021 16:84952715-84952737 CTGACTTCAGAGGTTGAGCAAGG + Intergenic
1141824912 16:86472133-86472155 CTGACTGGAGTGCGTGAGGAGGG - Intergenic
1141886952 16:86898833-86898855 CTCACTGCAGGGCTGGAGGGTGG - Intergenic
1141916809 16:87103524-87103546 GTGACTACACAGCTTCAGGATGG - Intronic
1142037071 16:87869015-87869037 CTCGATCCAGAGCTTGAGGAAGG + Exonic
1142157412 16:88538948-88538970 CTGACTGCTGGGCATGGGGAGGG - Intergenic
1142602321 17:1059754-1059776 CTAACTGAGGAGCTTGAGGATGG - Intronic
1143702212 17:8669284-8669306 CTGAGGGCAGAGCTGTAGGACGG - Intergenic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1146212125 17:30950835-30950857 CTGACTGCTGACTATGAGGAGGG + Intronic
1149612019 17:57964783-57964805 CCGATTGCAGAGCTTGGGCAGGG - Intergenic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1152153732 17:78619122-78619144 CTGCCAGGAGAGCTTGATGAGGG - Intergenic
1152235180 17:79134928-79134950 GTCACAGCAGAGATTGAGGAGGG + Intronic
1154151668 18:11910945-11910967 CTGACTCCGGAGATGGAGGAAGG + Intergenic
1156257332 18:35410505-35410527 GTCTCTGCAGAGCTTGAGGTGGG + Intergenic
1156368968 18:36455694-36455716 CTCACCTCAGAGCCTGAGGAAGG - Intronic
1159028981 18:63211828-63211850 ATGACTGAAGAGCTTCAGGCTGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162954853 19:14091966-14091988 CTGACAGCTAAGCTGGAGGAGGG + Exonic
1163727811 19:18932491-18932513 CTGATTGCTGAGCTTGGGGATGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1165639118 19:37369261-37369283 AGGACTGCAGAGCAGGAGGAAGG + Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1165885702 19:39076703-39076725 CAGACTGCAGGGGGTGAGGAGGG + Intergenic
1166701079 19:44882050-44882072 CAAACTGCTGAGCATGAGGAAGG - Intronic
1166976266 19:46606896-46606918 CTGACAGCAGAGCTGGGGGCTGG - Intronic
1167141064 19:47651118-47651140 CGGACTGCAGAAGGTGAGGACGG - Intronic
1167464825 19:49645197-49645219 CTGACTCCAGGGCCTGAGGCAGG + Intronic
1167619899 19:50554992-50555014 GTGACTGCAGGGGCTGAGGAAGG - Intronic
1167801212 19:51743513-51743535 CTGACCCCAGAGCTTCTGGAGGG - Intergenic
1202693943 1_KI270712v1_random:111123-111145 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
926951892 2:18252254-18252276 CTGACTGCAGGGCTTTTGGGGGG + Intronic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
929578220 2:43066033-43066055 CTGGCGGGAGAGGTTGAGGAAGG + Intergenic
929926811 2:46219418-46219440 CAGATTTCAGAGCTTGGGGATGG - Intergenic
931175470 2:59850083-59850105 CGGCCTGCAGAGCTTGAGAGTGG + Intergenic
932975531 2:76595602-76595624 CTGACTGCACAGTCTGGGGAGGG + Intergenic
933952618 2:87343452-87343474 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934236863 2:90239798-90239820 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
936018429 2:108976880-108976902 CTGACTCCAGAGCTGGGGCAGGG - Intronic
937662049 2:124442169-124442191 CTGACTTTAGACCTTGAGGAGGG + Intronic
939164513 2:138626212-138626234 CTGACTGTAGCCATTGAGGATGG - Intergenic
939506111 2:143049397-143049419 CTGACCCCAAAGTTTGAGGAGGG - Exonic
940021097 2:149156556-149156578 CTGTCTGCATAGCCTGTGGATGG + Intronic
941063819 2:160878377-160878399 ATGAGTGCTGAGCTTGAAGATGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
945451272 2:209999398-209999420 CAGACTGGGGAGGTTGAGGATGG - Intergenic
945829474 2:214765492-214765514 CTGACTGTATAGCTTCAGGCAGG - Intronic
946425159 2:219590846-219590868 CTGAGCGCACAGCTTCAGGAGGG + Intergenic
947710307 2:232309870-232309892 CTGGCTGCTGCACTTGAGGAGGG + Intronic
1171361772 20:24590899-24590921 CGGACTCCAGAGCAAGAGGAAGG + Intronic
1172563134 20:35906850-35906872 AAGAATGCAGGGCTTGAGGAGGG + Intronic
1173679564 20:44868315-44868337 CTGACTTCAGAGCCTGTGGTGGG + Intergenic
1174098498 20:48108455-48108477 CTGGCTGCAGAGCTTGCACATGG + Intergenic
1174751776 20:53118353-53118375 CTGAAAGCAGAGCCTGAGGCAGG + Intronic
1175571337 20:60025011-60025033 CTATCTGCAGAGCTTGGGAAGGG + Intronic
1177376155 21:20273267-20273289 CAGACTGCAAAGATTGGGGAAGG + Intergenic
1178019608 21:28394128-28394150 CTGGCTACAGAGCTTGAAAAAGG + Intergenic
1178411064 21:32364178-32364200 CTCACTGCAGAGACTGAGTAGGG + Intronic
1180049115 21:45323365-45323387 CTGACTCGAGAGCTTGAGCCCGG + Intergenic
1182031902 22:27165789-27165811 CTGCCTGCAGACCTTGAGCGAGG + Intergenic
1182444845 22:30384102-30384124 ATGCCTGCAGAACATGAGGACGG + Intronic
1184112247 22:42402185-42402207 CTGAGTGCAGGGCTTGCTGAGGG + Intronic
1184268546 22:43364058-43364080 CTGCATTCAGAGCTTGGGGAAGG + Intergenic
1184709541 22:46240464-46240486 CTAACTGCAGAGGGTGAGGCTGG - Exonic
1185376469 22:50484741-50484763 CTGACTACAGGGCATGAGGAGGG - Exonic
1185377926 22:50490755-50490777 GTGGCTGCAGAGCCTGTGGAGGG - Intergenic
949358541 3:3207229-3207251 CTGACTCCAGAGCCTAAGGGAGG + Intergenic
949535092 3:4989348-4989370 GTGAAGGCAGTGCTTGAGGAAGG - Intergenic
951676867 3:25250777-25250799 ATGACAGCATTGCTTGAGGAAGG - Intronic
953464759 3:43109895-43109917 CTCTCTCCATAGCTTGAGGATGG + Intergenic
954562404 3:51568933-51568955 TTGAGTGCAAAGCTTGAGGATGG + Intronic
955082443 3:55670536-55670558 CTGACTCCAGAGCTGCAGGGCGG - Intronic
955776578 3:62440232-62440254 GTGACTGAAGAGCTTGAAAAAGG - Intronic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
961770732 3:129248273-129248295 GTGACCGCAAAGCTGGAGGAAGG - Intergenic
966410635 3:179642842-179642864 CTGCTTGCTGAGCTTGGGGATGG - Intergenic
968423587 4:505708-505730 CTGACTGCAGGCATTGATGACGG + Exonic
968800965 4:2743045-2743067 CAGGCTGCAGTGCTTCAGGACGG - Intronic
973616566 4:52684730-52684752 TTGAGCTCAGAGCTTGAGGATGG - Intergenic
975332090 4:73128001-73128023 CTGACTGCAGAGATCAGGGATGG + Intronic
976621710 4:87134942-87134964 ATGACAGCAGAGCTTCAGAAGGG - Intronic
976657718 4:87506709-87506731 CTGACTGCAGATCTTGGGACTGG + Intronic
977480494 4:97568679-97568701 CTGAGTCCAGAACTTGAGCAAGG + Intronic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981330061 4:143497946-143497968 CCCACTGCAGAGGTTGAGGTGGG + Intergenic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
984885680 4:184447144-184447166 CTGACTCCAGAGCTGGGGCAGGG + Intronic
985214311 4:187634317-187634339 CTGACAGCAGAGCTCCAGGTGGG - Intergenic
986238716 5:5937551-5937573 CTGCCTGGAGTGCTTGAGGTTGG + Intergenic
987094375 5:14535065-14535087 CAGACTCCAGAGCATGGGGAGGG - Intergenic
988207964 5:28164748-28164770 GTGACTGCAGAGTTAGAGAATGG + Intergenic
988699363 5:33658033-33658055 ATGAAAGCAGAGGTTGAGGAGGG + Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
990439055 5:55825436-55825458 CAGACTGCAGAGCCACAGGATGG - Intergenic
990528391 5:56650781-56650803 ATAACTCCAGAGCTTGGGGAAGG + Intergenic
991113465 5:62927603-62927625 CTGAGTCTAAAGCTTGAGGATGG + Intergenic
991270374 5:64772153-64772175 CTGATTCCAGAGCCTGTGGAGGG + Intronic
996316609 5:122167575-122167597 CTGACTGCATTGCATGAGCATGG + Intronic
997486633 5:134236459-134236481 CTGTCTGCTTAGCTTGAGAAAGG + Intergenic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
999426209 5:151489631-151489653 CTGAAGGCTGACCTTGAGGAGGG - Exonic
1001438619 5:171720510-171720532 CTGACTTCAAAGTTTAAGGAGGG - Intergenic
1001449043 5:171810051-171810073 CAGACAGCAAAGCTGGAGGAAGG + Intergenic
1002961082 6:1915395-1915417 CTGAGTGCTGAGCCTGAGCAGGG + Intronic
1005326242 6:24703438-24703460 CTGACTCCAGGGCTTGAGGCTGG + Exonic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1006139016 6:31916149-31916171 CTGACAGCAGAGCTTGAGACAGG + Intronic
1007302192 6:40875900-40875922 CTGAGTGGAGAGCTTGCTGAGGG + Intergenic
1009660471 6:66605237-66605259 CTGGCTCCACAGCTTGTGGATGG - Intergenic
1010376863 6:75180980-75181002 GTGACTGCGGAGTATGAGGATGG - Exonic
1011186767 6:84685707-84685729 CTGAAAGCAGAGGTTGAGTAGGG + Intergenic
1013244644 6:108274940-108274962 CTGAGCCCAAAGCTTGAGGATGG - Intergenic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1016075159 6:139787334-139787356 ATGACTATATAGCTTGAGGACGG + Intergenic
1017055588 6:150433017-150433039 CTGGCTGCAGAGCTTGACGCTGG - Intergenic
1017631181 6:156397545-156397567 ATGTCTGCAGAGCTTGAGGTTGG + Intergenic
1018203561 6:161416291-161416313 ATAACTGGAGAGCTTGATGACGG + Intronic
1018559877 6:165090672-165090694 CTAACTGCTGAGTTTGAGGATGG + Intergenic
1019123827 6:169825872-169825894 CTGTCTGCAGTGCTTGAAGTGGG - Intergenic
1019128677 6:169858515-169858537 CTGGCCGCAGAGCTTCAGGAGGG + Intergenic
1019228023 6:170531364-170531386 TCGAGTGCAGAGCTTGAGAATGG + Intergenic
1019462080 7:1165409-1165431 CTGACTGCAGGGTTGGAGCAGGG - Intergenic
1022112883 7:27242205-27242227 TTGACTGGAGAGCTTGAGGCTGG - Intergenic
1022472835 7:30692320-30692342 CTGACTGGAGAGCTGGGGAAGGG - Intronic
1023134683 7:37039348-37039370 CTGACTGCAGGCCATGAGGAGGG + Intronic
1023914503 7:44578617-44578639 CTGAATGCAGAGGCTGAGGCAGG + Exonic
1023956860 7:44893512-44893534 CTGGCAGGAGAGCTTGGGGATGG + Intergenic
1025638860 7:63349288-63349310 ATGGCTGCAGATCCTGAGGAAGG - Intergenic
1025643839 7:63398804-63398826 ATGGCTGCAGATCCTGAGGAAGG + Intergenic
1027201949 7:76069520-76069542 CAGGCTGAAGAGCTTGTGGATGG + Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1028955149 7:96681000-96681022 CTGACTTAAGAGGATGAGGAGGG + Intronic
1029113368 7:98224449-98224471 CAGACTGAGGGGCTTGAGGAGGG - Intronic
1029170017 7:98623919-98623941 GTGACTAGAAAGCTTGAGGAAGG - Intronic
1032382520 7:131499681-131499703 TTCACTGCAGACCTGGAGGAGGG + Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033599627 7:142879568-142879590 TTGACTCCAGAGCTGGAGGTGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037853867 8:22355502-22355524 GTGACTGCACAGCTTGGAGATGG + Exonic
1038087580 8:24216866-24216888 GTGAATGCGGGGCTTGAGGAAGG + Intergenic
1040384993 8:46909037-46909059 CTCACTGCACAGCCTCAGGATGG + Intergenic
1042028846 8:64452090-64452112 CAGCCTGCAGAGCTTAAAGAAGG + Intergenic
1042102765 8:65291678-65291700 TTCAGTGTAGAGCTTGAGGATGG + Intergenic
1042551874 8:70001444-70001466 CTGGCTGCAGAGCTTGGCCATGG - Intergenic
1043925726 8:86034545-86034567 CTGACATCAGAGCTTGGGGAAGG - Intronic
1044071352 8:87764073-87764095 GTGACTTCATAGCTTAAGGATGG + Intergenic
1045636588 8:104198721-104198743 CTCACTCCAGAGCCTGAGGATGG - Intronic
1047507106 8:125488599-125488621 CTGACTGCAGATCATGGGTATGG - Intergenic
1048290628 8:133178750-133178772 CAGACTGGAGACCTTCAGGAAGG + Intergenic
1049043450 8:140129990-140130012 CTGATTGCAGGGCTGGAGCAGGG + Intronic
1049818236 8:144618538-144618560 CTGCCTGCAGAGGTTGTGGTGGG + Intergenic
1051151497 9:14084683-14084705 AGAACTGCAGAGCTTCAGGATGG - Intronic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1057687342 9:97247064-97247086 CTGACCGAAGAGCTTTAAGAAGG + Intergenic
1058725517 9:107799808-107799830 CTGGCTGAAGAAGTTGAGGATGG + Intergenic
1059285639 9:113169395-113169417 CTGACTTCAGACCCCGAGGAGGG - Exonic
1060014995 9:120079274-120079296 ATGAGTCCAGAGCTTGAGGCTGG + Intergenic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061203693 9:129151131-129151153 CTGGCTGCAGAGCTGAAGGGCGG + Intergenic
1061402584 9:130376475-130376497 CTGAGAGCAGAGCTGGGGGATGG - Intronic
1061524210 9:131144714-131144736 TTGACAGCAGAGGTTGAGGGTGG - Exonic
1061946728 9:133912685-133912707 GTGACTGCAGCCCCTGAGGATGG - Intronic
1062041706 9:134407413-134407435 CTGACTGCAGAGCTGGGTGGAGG + Intronic
1062101611 9:134731477-134731499 CTGGCTGCAGAGGGAGAGGAAGG - Exonic
1062233734 9:135498133-135498155 CTGACGGCACAGCTTGTGGGTGG - Intronic
1186188730 X:7047507-7047529 CTGAAAGCAGATCTTCAGGATGG - Intergenic
1186545651 X:10446450-10446472 CTGACTGCAAATATTGACGATGG - Exonic
1186821030 X:13288176-13288198 TTGAGTGCAAAGCTTGAGGATGG - Intergenic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1187275207 X:17810787-17810809 CTGACTGCAGGGCTACAGTATGG + Intronic
1187296957 X:18011564-18011586 CTGCCTGCAGAGCCTGAGCCAGG + Intergenic
1188907758 X:35808745-35808767 CAGACGGCAGAGCTTGTGCAGGG - Intergenic
1189027077 X:37406931-37406953 TTGAGTGCAAAGGTTGAGGACGG + Intronic
1190580878 X:51892635-51892657 CTGAATGCAGAGCATGAGCTTGG + Intronic
1190585145 X:51932419-51932441 CTGAATGCAGAGCATGAGCTTGG + Intergenic
1190794277 X:53726353-53726375 CTGACTCCTGACCATGAGGATGG - Intergenic
1194382604 X:93213789-93213811 CTGACTCCTGACCTTGAGCAAGG + Intergenic
1194625673 X:96224332-96224354 CAGACTCTAGAGCTTGAAGATGG + Intergenic
1200157607 X:153985573-153985595 TGGACTGCAGAGCTGGAGGGAGG - Intergenic