ID: 1151356034

View in Genome Browser
Species Human (GRCh38)
Location 17:73559121-73559143
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151356031_1151356034 -3 Left 1151356031 17:73559101-73559123 CCTAAATACTGATTTCAACTGGA 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1151356034 17:73559121-73559143 GGACTCTCCTGCCTGCACCGGGG 0: 1
1: 0
2: 1
3: 43
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type