ID: 1151356379

View in Genome Browser
Species Human (GRCh38)
Location 17:73561035-73561057
Sequence TCTCCTCTTTCCTGTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151356379_1151356380 -4 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356380 17:73561054-73561076 GAGAGACCCAGCCTCGCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 179
1151356379_1151356385 17 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356385 17:73561075-73561097 GGTCACTCTGCCCAAGCTTTTGG 0: 1
1: 0
2: 0
3: 6
4: 146
1151356379_1151356386 18 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356386 17:73561076-73561098 GTCACTCTGCCCAAGCTTTTGGG 0: 1
1: 0
2: 1
3: 8
4: 160
1151356379_1151356387 19 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356387 17:73561077-73561099 TCACTCTGCCCAAGCTTTTGGGG 0: 1
1: 0
2: 0
3: 30
4: 241
1151356379_1151356388 25 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356388 17:73561083-73561105 TGCCCAAGCTTTTGGGGACCTGG 0: 1
1: 0
2: 0
3: 98
4: 1537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151356379 Original CRISPR TCTCCTCTTTCCTGTACCTG TGG (reversed) Intronic