ID: 1151356379

View in Genome Browser
Species Human (GRCh38)
Location 17:73561035-73561057
Sequence TCTCCTCTTTCCTGTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151356379_1151356388 25 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356388 17:73561083-73561105 TGCCCAAGCTTTTGGGGACCTGG 0: 1
1: 0
2: 0
3: 98
4: 1537
1151356379_1151356385 17 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356385 17:73561075-73561097 GGTCACTCTGCCCAAGCTTTTGG 0: 1
1: 0
2: 0
3: 6
4: 146
1151356379_1151356380 -4 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356380 17:73561054-73561076 GAGAGACCCAGCCTCGCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 179
1151356379_1151356387 19 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356387 17:73561077-73561099 TCACTCTGCCCAAGCTTTTGGGG 0: 1
1: 0
2: 0
3: 30
4: 241
1151356379_1151356386 18 Left 1151356379 17:73561035-73561057 CCACAGGTACAGGAAAGAGGAGA 0: 1
1: 0
2: 2
3: 38
4: 376
Right 1151356386 17:73561076-73561098 GTCACTCTGCCCAAGCTTTTGGG 0: 1
1: 0
2: 1
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151356379 Original CRISPR TCTCCTCTTTCCTGTACCTG TGG (reversed) Intronic
900369934 1:2327774-2327796 CCTCCTCTTGCCTGTGCCTCTGG + Intronic
901037319 1:6344095-6344117 GCTGCTCTTTCCTCTCCCTGTGG - Intronic
902316764 1:15626383-15626405 TCTCTTGTTTTCTCTACCTGAGG - Intronic
902896633 1:19484650-19484672 GGTCCCCTTCCCTGTACCTGGGG - Intronic
903766118 1:25735733-25735755 TCTCATCCTTCCTGGACCAGTGG + Intronic
904400743 1:30254847-30254869 TCTGCTCCTTCCTGGACCCGTGG - Intergenic
904405103 1:30283366-30283388 TTTCCTGTTTGCTGTAGCTGTGG - Intergenic
905398384 1:37683265-37683287 TCTCCTCCTTTCTCTCCCTGTGG - Intronic
905898461 1:41564829-41564851 TCTTCTCTTTCCAGAACCTTGGG - Intronic
907145383 1:52226171-52226193 TCTGCTCCTTACTGTACATGTGG + Intronic
907276918 1:53321797-53321819 TTTCCTCTTGGCTGTGCCTGGGG - Intronic
909468116 1:75997283-75997305 TCTCCTCTTGCCATTACCTTTGG + Intergenic
910755067 1:90680793-90680815 TCTCATCTTTCCCTTACTTGAGG - Intergenic
911264153 1:95723761-95723783 TCTCCTCTTTTCTGTAACTTTGG - Intergenic
911998631 1:104800328-104800350 TCTTCTCTTTCCTGGAACTGGGG - Intergenic
912677785 1:111701282-111701304 TTTGCTCTTTCCTGTGCTTGGGG + Intronic
912976847 1:114338769-114338791 TCTCCTTTTTACTGTACACGTGG + Intergenic
918346092 1:183608623-183608645 TCTGATGTTTCCTTTACCTGAGG - Intergenic
918641430 1:186845467-186845489 TCTCCTCCTTTCTCTATCTGTGG - Intronic
918678012 1:187314202-187314224 TCTCCTCTATGCTTTAACTGAGG + Intergenic
918834910 1:189449805-189449827 TCTGCTCTTTACTGTACATATGG + Intergenic
919478996 1:198063350-198063372 TCTCCCCTTTCCTTCATCTGTGG + Intergenic
919492613 1:198224791-198224813 TCTCCACATTTCTTTACCTGAGG - Intronic
919847910 1:201653190-201653212 CCTCATCTTCCCTGGACCTGAGG + Intronic
919931464 1:202223907-202223929 TCTCCTCTTGCCTTTCCCTCGGG - Intronic
920792615 1:209107243-209107265 TCTCATCCTTCCTGATCCTGAGG + Intergenic
921011971 1:211150668-211150690 TCTCCAGTTTCCTGGAGCTGAGG - Intergenic
921181249 1:212633282-212633304 TCTTCTCCTTACTGTACATGTGG - Intergenic
1063540611 10:6930230-6930252 TCTCCTCTTCCTGGCACCTGGGG - Intergenic
1064300589 10:14119380-14119402 TCTCCTCGTTCAGGTACCTGGGG - Intronic
1064370489 10:14748461-14748483 TCCCATCTTTCCTGTATCTGTGG + Intronic
1064798162 10:19037619-19037641 TCTCCTCTTTCCCATCCCAGCGG + Intergenic
1067462845 10:46470523-46470545 TCTGCTCTTCCCTGTGCCAGGGG - Intergenic
1067624349 10:47914114-47914136 TCTGCTCTTCCCTGTGCCAGGGG + Intergenic
1069603429 10:69724517-69724539 TCTCCACTTTCCTCCACCTGAGG + Intergenic
1069614175 10:69796310-69796332 TCTCCTGTTTTCTGCACCTTTGG - Intergenic
1071122420 10:82294792-82294814 TCTGCTGTTTCATGTACTTGAGG + Intronic
1072373090 10:94785844-94785866 TCTGCTCCTTACTGTACATGTGG - Intronic
1072715940 10:97752828-97752850 TCTCCTCTTCCCCGCACCTTGGG + Intronic
1073431960 10:103492960-103492982 TCTTCTCCTTCCTGGACCCGGGG - Intergenic
1074252754 10:111768997-111769019 TCTCCTCTTCCCTCTATCTTGGG + Intergenic
1074254536 10:111787347-111787369 TCTCCTCTTTTCTGAACATGTGG + Intergenic
1075956550 10:126528214-126528236 CCTTCTTTTTCCTGTTCCTGAGG - Intronic
1076222804 10:128748103-128748125 ACTCCTTTTTCCTGTTACTGGGG + Intergenic
1076480622 10:130782875-130782897 TCTGCCCTTCCCTGTGCCTGTGG - Intergenic
1076865876 10:133166073-133166095 TCATCCCTTTCCTGTGCCTGGGG + Intronic
1077021174 11:417742-417764 TCTCCCCGTCCCTGCACCTGGGG - Intergenic
1077304770 11:1864135-1864157 TCTCCTCTCTCCTTTCCCTCTGG - Intronic
1077619978 11:3712547-3712569 TGTCCTTTTTTCTCTACCTGAGG + Exonic
1077758243 11:5059574-5059596 CCTCCTCCTTCCTGTTGCTGGGG - Exonic
1077760619 11:5092707-5092729 CCTCCTCCTTCCTGTTGCTGGGG + Intergenic
1078465407 11:11546433-11546455 TCATCTCTTGCCTGTACTTGAGG + Intronic
1078846906 11:15126751-15126773 TCTCCTCTCTCATCTAGCTGAGG + Intronic
1078884572 11:15487509-15487531 TGTCCTGTTCCCTGAACCTGGGG - Intergenic
1080047200 11:27821433-27821455 TCTCCTCTTTCCTGTAAAGCTGG - Intergenic
1080055897 11:27906004-27906026 CCTCCTCTTTCCTTCACTTGGGG + Intergenic
1080245211 11:30172386-30172408 TCTTTTCTTTCCTGTTGCTGAGG - Intergenic
1081493535 11:43584192-43584214 TATCCTCTTTCCCGGACCTGTGG + Intronic
1081917465 11:46741932-46741954 ACTCCACTATCCTGTGCCTGAGG - Intergenic
1081960854 11:47136199-47136221 TCTTCTCTTTTCTCTACATGGGG + Intronic
1082075732 11:47974753-47974775 TCTCCTATTCCCTGTTCTTGGGG + Intergenic
1083373803 11:62203466-62203488 TGTCCTTTCTCCTGTAGCTGGGG + Intergenic
1083519532 11:63295677-63295699 GCTCCTCTTTCTAGAACCTGAGG - Intronic
1083737694 11:64691011-64691033 TCTGTTCTTTCCTGTCCTTGAGG + Intronic
1083941022 11:65895861-65895883 GCTCATCTTTCCTCTCCCTGGGG - Intronic
1084014262 11:66369368-66369390 TCAACTCCTTCCTGTACCAGTGG - Exonic
1084576806 11:69993870-69993892 TCCCCTCTTCCCTGCTCCTGGGG + Intergenic
1084716147 11:70875237-70875259 CCTCCTGTTGCGTGTACCTGGGG + Intronic
1084982251 11:72836133-72836155 TCTCCTCTTTCCTGGAGCTGGGG - Intronic
1085187472 11:74588707-74588729 TCTGCTCCTTACTGTACATGTGG - Intronic
1085782684 11:79423709-79423731 TCTCCTGTTTCCAGGAGCTGAGG + Intronic
1086210337 11:84310646-84310668 TCTTCTGTTTCCCTTACCTGGGG + Intronic
1088714484 11:112536786-112536808 ACTCTTATGTCCTGTACCTGGGG + Intergenic
1089053647 11:115566755-115566777 TGTTCTCTTTCCTGGACCTGGGG - Intergenic
1089205460 11:116758039-116758061 TCTCCTCTTTCTAGTACCCTAGG + Intronic
1089636115 11:119812977-119812999 TCTCCCTTTGCCTCTACCTGAGG - Intergenic
1090552829 11:127841580-127841602 CCTCCTCCCTCTTGTACCTGCGG + Intergenic
1091754479 12:3042607-3042629 TCTCCCCTCCCCTGTCCCTGGGG + Intergenic
1091797711 12:3306686-3306708 TCTCTTCTTTCCTGTCTGTGTGG - Intergenic
1091977580 12:4837801-4837823 ACTCCTCGTTGCTCTACCTGTGG + Intronic
1092646343 12:10577695-10577717 TCTCCTCCTTCCTCTCTCTGAGG - Intergenic
1093336618 12:17912608-17912630 TCTGCTCCTTCCTTGACCTGGGG + Intergenic
1096740513 12:53690592-53690614 TCTCATCTTTCATCTCCCTGTGG + Intergenic
1096810522 12:54166759-54166781 TCTCCTGTCCCCTGTGCCTGAGG - Intronic
1097198082 12:57255329-57255351 TCCCTTCTTTCCTGTATCTCTGG - Intronic
1098014147 12:66086597-66086619 TCTCCTCTTATGTGTACCTCTGG + Intergenic
1101147613 12:101855818-101855840 TCTTCTCTTTCTTTTCCCTGAGG + Intergenic
1102448908 12:113025935-113025957 TCTCCTATTTCCTGGCTCTGTGG - Intergenic
1104004974 12:124885397-124885419 TCCCTTCCTTCCTGTGCCTGGGG - Intergenic
1104108412 12:125684732-125684754 TCTCCTGTTTCCAGTACGTGGGG + Intergenic
1104649945 12:130524279-130524301 TCTTCTTTGTCCTCTACCTGTGG + Intronic
1105272065 13:18886204-18886226 TCTCCAGTTTCCTGTACATATGG - Intergenic
1105940304 13:25141824-25141846 TCTCCTCTCCCCTGTCCTTGGGG + Intergenic
1109188324 13:59296144-59296166 TCTCTTATTTCCTGTACCAGTGG - Intergenic
1109620754 13:64901378-64901400 TCTCCCCTCTCCTGTCCCTAGGG - Intergenic
1110177851 13:72578946-72578968 TTTCTTCTTTCCTTTACCTGTGG - Intergenic
1110666713 13:78125591-78125613 TCTGCTCCTTACTGTACATGTGG + Intergenic
1111288115 13:86122121-86122143 TCTCCTCTTTCCTGAATTTCTGG - Intergenic
1112334629 13:98503984-98504006 TCTCCTCATTACTGTCCCAGAGG + Intronic
1112673673 13:101672494-101672516 TCTGCTCCTTACTGTACGTGTGG - Intronic
1113031140 13:105994806-105994828 TCTCCTGGTTCCTGGAGCTGTGG - Intergenic
1113191854 13:107758102-107758124 TCTCCTCTATTCTGTTACTGAGG + Intronic
1114403258 14:22429686-22429708 TCTCCTTTGTACTGTCCCTGGGG - Intergenic
1114706377 14:24730977-24730999 TCTCCTATTTCCTTGAGCTGTGG - Intergenic
1114797203 14:25729662-25729684 TCTCCTCTTTGTTGTACCCGTGG + Intergenic
1115466057 14:33715528-33715550 CCTGCTCTTGCCTGTACATGGGG + Intronic
1117491851 14:56255833-56255855 TCTGCTCCTTACTGTACATGTGG + Intronic
1117771334 14:59137082-59137104 TCTCTTCTCTCCTGTTCCAGTGG - Intergenic
1117868565 14:60174515-60174537 TCTCCTCCTTACTGTACACGTGG - Intergenic
1119205051 14:72787973-72787995 TCTCTTCTCTCCAGCACCTGTGG - Intronic
1119872034 14:78026294-78026316 TCTCCTCGTTCCTGGGCCTTTGG + Intergenic
1121349497 14:93162108-93162130 TCACCTCCTTCCTATACTTGAGG - Intergenic
1122055478 14:99095229-99095251 TCTCCTCTCTCCTGTGAGTGAGG - Intergenic
1123486507 15:20744858-20744880 TCTCCAGTTTCCTGTACATATGG - Intergenic
1123540549 15:21285416-21285438 TCTACTCTTTACTGTACACGTGG + Intergenic
1123542995 15:21313908-21313930 TCTCCAGTTTCCTGTACATATGG - Intergenic
1125827295 15:42687299-42687321 TCTCCTCTTTCGTGAATCTGAGG + Exonic
1126245323 15:46498350-46498372 TCTCCTCTTCCCTCTATCTCTGG + Intergenic
1126541605 15:49830446-49830468 TCTCCTCTTTCCCCTAACTTTGG + Intergenic
1126979477 15:54226380-54226402 CCACCTCTTTTCTGTACCTCTGG + Intronic
1128435360 15:67642593-67642615 CCTGCTGTTTCCTGTACTTGGGG - Intronic
1130019773 15:80218809-80218831 TCTCCACTTTCCTTCACCAGAGG + Intergenic
1131507706 15:93031633-93031655 TCACCTCTCACCTGCACCTGTGG - Intergenic
1132352779 15:101150217-101150239 TCTCTTCTTTCCTTTAACTGAGG + Intergenic
1202948863 15_KI270727v1_random:12558-12580 TCTACTCTTTACTGTACACGTGG + Intergenic
1202951314 15_KI270727v1_random:41038-41060 TCTCCAGTTTCCTGTACATATGG - Intergenic
1132569532 16:638017-638039 GCTCCTCTTTCCTGTGCCTAGGG - Intronic
1132943274 16:2518996-2519018 ACTCCTCCTTCCTCTACGTGAGG - Intronic
1133466012 16:6027788-6027810 TTTCCTCTTGACTGTAACTGAGG + Intronic
1134092973 16:11401377-11401399 TCTCCTCCTCCCTGTGGCTGGGG - Exonic
1134113881 16:11533714-11533736 TTTCCTCTTTCTTTTCCCTGAGG - Intergenic
1134339138 16:13329074-13329096 TCTTCTCCTTCCTGTACATGAGG - Intergenic
1134511113 16:14847449-14847471 TTTCATCTTTCCAGTACCTTAGG - Intronic
1134698755 16:16245945-16245967 TTTCATCTTTCCAGTACCTTAGG - Intronic
1134877711 16:17716783-17716805 TCTCCTCTTTCATCTGTCTGGGG + Intergenic
1134973079 16:18548728-18548750 TTTCATCTTTCCAGTACCTTAGG + Intronic
1136423333 16:30151422-30151444 TCTGCTCTTTACTGTACACGTGG + Intergenic
1136576293 16:31127311-31127333 TCTCATATTTCATGTACTTGAGG - Exonic
1136578889 16:31140407-31140429 TCTCCTCTCCCCAGTCCCTGTGG - Exonic
1137000136 16:35222126-35222148 CCTCCCCTTTCCTGCCCCTGGGG + Intergenic
1137357743 16:47782825-47782847 TCTCCTGTCTCCTGTCCCAGGGG + Intergenic
1137833673 16:51569757-51569779 TTTCTTCTTTCCTGTACCCCAGG + Intergenic
1138930415 16:61648065-61648087 TCTCCTCCTTCCTTTATGTGTGG - Exonic
1138963029 16:62050562-62050584 TCTCCTTTTTCCTTTTTCTGTGG + Intergenic
1139489340 16:67278361-67278383 GCACCTCTTTCATGAACCTGGGG - Exonic
1141210017 16:81969961-81969983 TATCCTCTGTTCTGTTCCTGTGG + Intergenic
1141383497 16:83597487-83597509 TCTCCTTTTTCCTATACAAGTGG - Intronic
1142803865 17:2361555-2361577 GCTCCTCTTCCCCATACCTGTGG - Intronic
1143045875 17:4079020-4079042 TCTTCTCTTTCACTTACCTGTGG - Intronic
1143083139 17:4396281-4396303 TCTTGTCTGTCCTGTGCCTGGGG - Intergenic
1144022244 17:11247691-11247713 TCCCCTCTTTTCTTTACCTTGGG + Intronic
1144413401 17:15022750-15022772 TCTCTGCTTCCCTGTTCCTGTGG - Intergenic
1144505738 17:15829001-15829023 ATTCCTCTTTCCTGCAGCTGGGG - Intergenic
1145254929 17:21317259-21317281 TCCCCTGTTCCCTGTCCCTGAGG + Intergenic
1145321673 17:21770706-21770728 TCCCCTGTTCCCTGTCCCTGAGG - Intergenic
1145786277 17:27595822-27595844 TCTCCTCTGTGCTGTGGCTGGGG + Intronic
1146631191 17:34470786-34470808 TCTCCTCATCCTTGTATCTGTGG - Intergenic
1147559502 17:41500230-41500252 TTTCCTCTTCACTGTCCCTGTGG - Intergenic
1148778953 17:50111027-50111049 TCTCCTCTTTACTGTGGGTGTGG - Exonic
1148875506 17:50684628-50684650 TCTCTTCTTCCCTGGACCTGGGG + Intronic
1150473741 17:65458737-65458759 TCTTCTCTTTCCTTTTCCTTGGG - Intergenic
1150865880 17:68849574-68849596 TCTCCTGTTACCTGTACCAGTGG - Intergenic
1151356379 17:73561035-73561057 TCTCCTCTTTCCTGTACCTGTGG - Intronic
1151651843 17:75475089-75475111 TCCCCTCTCTCCTGTCCCTGAGG - Intronic
1152313371 17:79564670-79564692 TTTCCTCTTTCCTGTACTGTCGG - Intergenic
1153983098 18:10329247-10329269 TCTTCTCTCTCCTGAACTTGAGG - Intergenic
1154976161 18:21459826-21459848 TCTCGTGTTTCCTCTACCTCAGG - Intronic
1155903485 18:31420102-31420124 ATTTCTCTTTCCTGTATCTGTGG + Intergenic
1156187195 18:34676986-34677008 TCTACTCTTTCTTTCACCTGAGG - Intronic
1157357600 18:46949698-46949720 TCTCCTCTGTCCTCTACAAGAGG + Intronic
1158602160 18:58864211-58864233 TCTCTTCTTTCAAGCACCTGGGG - Intronic
1158668629 18:59455115-59455137 TCCCCTCTTCCCTGACCCTGGGG - Intronic
1162787812 19:13046542-13046564 TCTTCCCTTTCCCGTTCCTGGGG + Intronic
1165914977 19:39252929-39252951 CCTCCTCTCCCCTCTACCTGGGG + Intergenic
1166383526 19:42368312-42368334 TGTCCACTTTGCTCTACCTGTGG + Intronic
1167428268 19:49440784-49440806 TCTCCTCTTCCCTGGATCTCTGG - Intronic
1168073188 19:53963738-53963760 TTCCCTCTCTCCAGTACCTGGGG + Intronic
1168294328 19:55371244-55371266 TCTCCCCTTTTCTGTCCCTGGGG - Intergenic
930030956 2:47057695-47057717 TCTCCTCTCTCGTGACCCTGGGG + Intronic
930040266 2:47117101-47117123 TCTTCTCCTTCCTCTACCTAGGG + Intronic
930395496 2:50818641-50818663 TTTCCTCTTTTCTGTACTTTTGG - Intronic
931465622 2:62484242-62484264 TCTGCGCTTTCCTGTTCCAGGGG + Intergenic
931609281 2:64081270-64081292 TCTGCTCCTTACTGTACATGTGG + Intergenic
931907967 2:66863077-66863099 TCTCCTCTTTCCTTACCCTTGGG - Intergenic
934056713 2:88257423-88257445 TCGCCCCTTTCCTCTACGTGAGG + Intergenic
934726489 2:96623635-96623657 TCTCCTGGATCCTGTAACTGTGG - Intronic
935877724 2:107529502-107529524 TCTGCTCCTTACTGTACATGTGG + Intergenic
936899927 2:117470943-117470965 TCTACTCCTTACTGTACATGTGG + Intergenic
937258999 2:120573449-120573471 TCCCCTCTTCCTTGGACCTGGGG - Intergenic
937276872 2:120690610-120690632 TCTCATCCTTCCTGTTCCTCAGG - Intergenic
937313595 2:120917001-120917023 TCTGCTCTCTCCTATTCCTGTGG - Intronic
937434080 2:121866100-121866122 TGTCCTCAATCCTGTACCTCTGG + Intergenic
938225748 2:129614710-129614732 CCTCCTCCTTCCTGTTCTTGTGG - Intergenic
939278844 2:140036988-140037010 TTTACTGTTTCCTGTAGCTGTGG - Intergenic
939601867 2:144202275-144202297 TCTCTGATTTCCTGTACATGGGG - Intronic
941397751 2:164993868-164993890 TCTACTCCTTACTGTACATGTGG + Intergenic
941461240 2:165774196-165774218 TCACCTCCTTTCTGTTCCTGAGG + Intronic
942065884 2:172270953-172270975 TCTGCTCCTTACTGTACATGTGG + Intergenic
943876866 2:193077567-193077589 TCTCCTCTTTCATGTAACGTAGG - Intergenic
943985314 2:194611106-194611128 TCTGCTCCTTACTGTACATGTGG - Intergenic
944544994 2:200790384-200790406 TCTCTTCTTAGCTGTCCCTGTGG - Intergenic
945172170 2:207008254-207008276 TCCCCTCCTTCATGTGCCTGGGG + Intergenic
945705286 2:213223023-213223045 ACTCCTATTTCTTGTACCAGAGG + Intergenic
945817574 2:214624498-214624520 TCTCCTGTTGCCTGTTCCTTTGG - Intergenic
946085560 2:217167928-217167950 TCTCCTCTGTCCTGCAGCTTAGG - Intergenic
946351138 2:219153840-219153862 TCTCCTCTTTCCTGTACAGCTGG + Intronic
946431672 2:219629762-219629784 TCACCTCCTTCCTGACCCTGGGG + Intronic
947282743 2:228473626-228473648 TCTTCTCCTTACTGTACATGTGG + Intergenic
947446029 2:230163250-230163272 TCTGCTCCTTACTGTACATGTGG + Intergenic
947983583 2:234429833-234429855 TCACTTCTCTCCTGTAGCTGGGG - Intergenic
948197310 2:236105511-236105533 TCTCCTCTCTCCTCCACATGAGG - Intronic
948383096 2:237564464-237564486 CCTCCTCCTTCCTCCACCTGTGG - Intergenic
948646931 2:239411211-239411233 TCCCTTTTTTCCTGTAGCTGGGG - Intergenic
948863884 2:240765788-240765810 TCCCACCTTTCCTGTAGCTGTGG - Exonic
1169202162 20:3716772-3716794 TCTCCTCTCTCCTCCACCCGAGG + Intergenic
1169970758 20:11267363-11267385 TGTCTTCTTTCCTGCAGCTGGGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171057853 20:21925077-21925099 TCACCACTTTCCTGTGCCAGAGG - Intergenic
1171277582 20:23870954-23870976 CTTCCTCTTGCCTGTTCCTGAGG - Intergenic
1172109088 20:32535019-32535041 CCTCCTCCTTCCTTTCCCTGTGG - Intronic
1172234017 20:33357480-33357502 CATCTTCTTTCCTGTAGCTGTGG - Intergenic
1172303340 20:33864923-33864945 TCCCCTTCTCCCTGTACCTGCGG + Intergenic
1173227772 20:41171979-41172001 TTTCCTCTTTTCTGTCCCAGAGG - Intronic
1173783710 20:45776969-45776991 TCTCATCCTTCCTGTCCCTCTGG - Intronic
1174311123 20:49655468-49655490 TCGCCTCATTTCTGTAACTGAGG - Intronic
1174322215 20:49750842-49750864 TCTCCTCCTTTCTGTCCGTGGGG - Intergenic
1175137178 20:56832982-56833004 CCTCCTCCTTCCTGGAGCTGGGG - Intergenic
1175789973 20:61735036-61735058 TGTCGTTTTTCCTGTCCCTGGGG - Intronic
1176666801 21:9695323-9695345 TCTGCTCCTTCCTGTACACGTGG - Intergenic
1176669078 21:9715260-9715282 TCTGCTCCTTCCTGTACACGTGG + Intergenic
1177586124 21:23097929-23097951 TCTATTTTTGCCTGTACCTGTGG + Intergenic
1178181048 21:30162048-30162070 CCTCCTATTGCCTGTACCTGGGG + Intergenic
1178267909 21:31161378-31161400 CCTCCTCTCTCCTGTGACTGTGG - Intronic
1179246069 21:39635265-39635287 CCTCCTATTTCCTCTAGCTGTGG - Intronic
1179298901 21:40089323-40089345 GCAGCTCTTTCCTGTACTTGGGG + Intronic
1179377712 21:40865921-40865943 TCTTCTGTTTTCTGTACCTCAGG - Intergenic
1181330843 22:22089465-22089487 CCTGCCCTTCCCTGTACCTGAGG + Intergenic
1181336189 22:22131649-22131671 TCTGTTCCTTACTGTACCTGTGG + Intergenic
1181492665 22:23270191-23270213 TCCACTCCTTCCTGTACTTGAGG - Intronic
1182054948 22:27345232-27345254 TCTCCCCTCTCCGGTACTTGGGG + Intergenic
1182374174 22:29834338-29834360 TCTGCTGTTTCCTCTGCCTGGGG - Intronic
1182855313 22:33511929-33511951 TCATCTCTTTATTGTACCTGAGG + Intronic
1183157800 22:36088614-36088636 TCTCCTCACTCCTGCTCCTGTGG - Intergenic
1184872716 22:47251208-47251230 TCTCCTGTTTTCTCTGCCTGTGG - Intergenic
949115492 3:316127-316149 TCTGCTCCTTACTGTACATGTGG + Intronic
949203857 3:1414506-1414528 TATTCTCTTTCCTTTGCCTGGGG + Intergenic
950246497 3:11424146-11424168 CCTCCTCATTCCTGCCCCTGGGG + Intronic
951578312 3:24135706-24135728 TCTTCTCATTCCTGAAACTGAGG + Intronic
952287370 3:31981492-31981514 TCTCTTCCTTCGTGTCCCTGCGG + Intronic
953789155 3:45933502-45933524 TTTCCTCATTCCTTTACTTGAGG + Intronic
954129408 3:48552430-48552452 TCTCCTCCTTCCCGCCCCTGAGG - Intronic
956247324 3:67198338-67198360 TCTCCTCTTTCATCTACTTTTGG + Intergenic
957196675 3:77077752-77077774 TCTGCTCTTTGCTGTAACAGAGG + Intronic
959097653 3:101973074-101973096 TTTTCTCTTTTCTGTACCTTTGG - Intergenic
959734533 3:109642887-109642909 TCTCCTCTCTCCAGTTCCTGAGG - Intergenic
959849489 3:111071130-111071152 TCTCCTCCTTCCTGTTCCCCGGG - Intronic
960026715 3:113019143-113019165 CCTTCTTTTTCCTGTACCCGAGG - Intronic
960980361 3:123218427-123218449 TCTCCTCTTTTCTCTATCTTGGG - Intronic
961007850 3:123416744-123416766 TCTCCTCATTCCTCTTCCTGGGG - Intronic
961032899 3:123622080-123622102 CCACCTCTTACCTGTTCCTGAGG - Intronic
961436356 3:126921087-126921109 TTTACTGTTTCCTTTACCTGGGG - Intronic
963174980 3:142288860-142288882 TCTGCTCCTTACTGTACATGTGG - Intergenic
963599637 3:147367129-147367151 CCTTTTCTTCCCTGTACCTGGGG - Intergenic
963817840 3:149853690-149853712 TCTTCTTTTTCCTCTACCTCTGG + Intronic
964830379 3:160877852-160877874 TCTGCTCCTTACTGTACATGTGG + Intronic
966493244 3:180551932-180551954 TCTCCTTCTCCCTCTACCTGGGG - Intergenic
966521748 3:180881220-180881242 TCTGCTCTTTACTGTACACGTGG - Intronic
966992441 3:185247470-185247492 TCTCTTCTTACCTGTAAATGAGG + Intronic
967381216 3:188860475-188860497 TCTCTCCTGTCCTGTTCCTGAGG + Intronic
967987322 3:195105177-195105199 TCACCTCTTTCCTATCCATGGGG - Intronic
969210625 4:5684557-5684579 TCTCCTCCAGCCTGTACCCGGGG + Intronic
970002123 4:11374709-11374731 TCTCTTCTAGCCTGCACCTGTGG + Intergenic
971365954 4:25977358-25977380 TCTCCTGTTTCCTGTTCTCGTGG - Intergenic
971481064 4:27115475-27115497 TCACCTCTTTCTTGTCCCTTTGG - Intergenic
971971434 4:33625845-33625867 TCTCATCTATTCTGTGCCTGAGG + Intergenic
972053570 4:34771679-34771701 TCTGCTCCTTACTGTACATGTGG - Intergenic
973706889 4:53589833-53589855 TCTTTTCTTTCTTCTACCTGGGG + Intronic
975264262 4:72343214-72343236 TCTCATCCTTACTGTACATGTGG + Intronic
975365131 4:73520491-73520513 TCTCCTCCTTCCTGTAGCAATGG + Intergenic
977635403 4:99292629-99292651 TCTCTTCTTTTCTGTCCCTCTGG + Intergenic
977638008 4:99322955-99322977 TCTCTTCTTTTCTGTCCCTCTGG + Intergenic
978625112 4:110676629-110676651 TCTCCTCTCTCCTGTTTCTATGG + Intergenic
980210818 4:129784976-129784998 TCTTCTCTTTTCTGTCCCTGAGG + Intergenic
980859860 4:138486252-138486274 ACTCCTCTTTCCTCTCCCTCAGG + Intergenic
983270622 4:165557451-165557473 TCTGCTCTTTACTGTACAGGTGG + Intergenic
983427230 4:167601193-167601215 GCTCCCCTTTCCTGTACATGTGG + Intergenic
983516040 4:168657758-168657780 TCTGCTCCTTACTGTACATGTGG - Intronic
983559776 4:169089098-169089120 TCTCCTCTTTACTTTACATGTGG - Intergenic
983914530 4:173277978-173278000 CCTCTTCTCTCCAGTACCTGAGG - Intronic
984284531 4:177712319-177712341 TCTACTCTTTGGAGTACCTGAGG + Intergenic
984585187 4:181555738-181555760 TCCCCTATATCCTGTACCTCTGG + Intergenic
985405705 4:189636259-189636281 TCTGCTCCTTCCTGTACACGTGG - Intergenic
985408212 4:189657019-189657041 TCTGCTCCTTCCTGTACACGTGG + Intergenic
986595159 5:9413700-9413722 TCTTCCCTATCCTGTAACTGTGG - Intronic
987224599 5:15826898-15826920 TCTCCTCTGGGCTGTACCTGTGG + Intronic
987452482 5:18103511-18103533 TCTTCTCAGTCCTGTACCTCTGG - Intergenic
988336819 5:29918775-29918797 TCTGCTTTTTACTGTACATGTGG + Intergenic
988934664 5:36070131-36070153 TCTCCATTCTCCTGTACATGTGG + Intronic
991312756 5:65262669-65262691 CCTCCACTTTCCTGTGCCTATGG + Intronic
992127044 5:73652881-73652903 TCTCCTCATTCCTGGACCATTGG + Intronic
993320047 5:86460178-86460200 GCTCCTCTTTTCTTTATCTGAGG - Intergenic
993931285 5:93944572-93944594 TCTCCTCTTTTCTTTTCATGAGG - Intronic
994722154 5:103392784-103392806 TCTCCTCTTTCATGTTCTTTGGG + Intergenic
995006173 5:107198478-107198500 GCTCCAGTTTCCTGAACCTGGGG + Intergenic
996759910 5:126976656-126976678 TCTCCTATCTCCTGTTTCTGAGG + Intronic
997854489 5:137361102-137361124 TCTCCTCTCTTCTCTACGTGAGG + Intronic
998875498 5:146594895-146594917 TCTCTTTTTTCCTGCAACTGCGG + Intronic
998910805 5:146958120-146958142 TCTGCTCGTTGCTGTATCTGAGG - Intronic
1000173848 5:158730356-158730378 TATCCCCATCCCTGTACCTGAGG - Intronic
1001966105 5:175911020-175911042 TCTCCTCTCCCCTCTCCCTGTGG - Intergenic
1002250840 5:177928182-177928204 TCTCCTCTCCCCTCTCCCTGTGG + Intergenic
1003508034 6:6756033-6756055 TCACCACTGTCCTGTACCTGGGG + Intergenic
1004097958 6:12577962-12577984 CCTCCTCTTTCCTTTTTCTGGGG - Intergenic
1004121669 6:12829404-12829426 ACTCCTTTGTCTTGTACCTGAGG - Intronic
1004826410 6:19426000-19426022 TCTGCTCCTTACTGTACATGTGG + Intergenic
1006559665 6:34899718-34899740 TTAACTCTTTGCTGTACCTGGGG + Intronic
1008323421 6:50146884-50146906 TCTGCCTTTTCCTGTGCCTGGGG - Intergenic
1008700879 6:54098092-54098114 CCTCCTCTTTCCATTGCCTGAGG - Intronic
1009648549 6:66442722-66442744 ACTCCTCTGTCATTTACCTGTGG - Intergenic
1010391713 6:75345519-75345541 TCTGCTCCTTACTGTACGTGAGG - Intronic
1013315699 6:108940559-108940581 CCTGCTCTTTACTGTACATGTGG + Intronic
1013630294 6:111979943-111979965 TCTTCTCCATCCTGTCCCTGAGG + Intergenic
1013666512 6:112354929-112354951 TCCACTCTTTACTGAACCTGTGG + Intergenic
1013794173 6:113866755-113866777 TCTCATTTTTCCTTTACCAGTGG - Intergenic
1015133985 6:129847432-129847454 TCTCCTCTTGCCTCTAGCTGTGG - Intronic
1015419316 6:132987822-132987844 TCTCTTCTTTCCTTCACCCGAGG - Intergenic
1016213166 6:141565163-141565185 TCTCCTCTTTCCCTTTCCTGTGG - Intergenic
1016286081 6:142474566-142474588 TCTCCCCTTCCCTCTAGCTGAGG + Intergenic
1018457966 6:163969749-163969771 TCTCATCTCTCCTGTGCCTCGGG + Intergenic
1019078698 6:169412496-169412518 TCTCCTCTTCCCCCCACCTGGGG + Intergenic
1019093761 6:169562638-169562660 TCTCCCCTATCCTGTGCCCGGGG - Intronic
1019126833 6:169846269-169846291 TCTCCTGCTCCCTGTGCCTGGGG + Intergenic
1019263955 7:101865-101887 ATGCCTCTTTCCTGTGCCTGGGG + Intergenic
1020782236 7:12532058-12532080 TCTGCTCCTTACTGTACATGTGG + Intergenic
1021777555 7:24068400-24068422 TCCTCTGATTCCTGTACCTGTGG - Intergenic
1022031465 7:26495042-26495064 TCTCCTGTTTCCTCTTCCTTGGG + Intergenic
1022174273 7:27858209-27858231 TCTCCTATTTCCTTGACCAGTGG - Intronic
1022604892 7:31802998-31803020 CCTCCTCTCTCCTCTACCTGGGG + Intronic
1023079499 7:36514116-36514138 TCTTCCCTTTCCAGTCCCTGTGG - Intronic
1023255650 7:38309869-38309891 TCCCATTTATCCTGTACCTGAGG + Intergenic
1023257181 7:38323607-38323629 TCTCCTGTTTACTGTCCATGTGG - Intergenic
1023802019 7:43843409-43843431 TCTGCTCCTTACTGTACATGTGG - Intergenic
1024085109 7:45886146-45886168 TCACCACTTTCCTGTTTCTGTGG - Intergenic
1024183213 7:46918666-46918688 TCTCCTATTACTTGTCCCTGGGG + Intergenic
1026319525 7:69256751-69256773 TTTCCTCCTTCCTGTAGCTGTGG - Intergenic
1026732179 7:72921521-72921543 TCACCTAGTTCCTCTACCTGGGG - Intronic
1027111789 7:75445828-75445850 TCACCTAGTTCCTCTACCTGGGG + Intronic
1027284019 7:76630359-76630381 TCACCTAGTTCCTCTACCTGGGG + Intergenic
1027360144 7:77399991-77400013 TTTCCTCTTTCCAGTTCCTTTGG - Intronic
1028620081 7:92815614-92815636 GTTCCTCCTTCCTGTACCTGTGG - Intronic
1029896751 7:103990767-103990789 TCTACTCATTTCTGTACGTGCGG - Intergenic
1030438857 7:109559850-109559872 TCTCCTCTCTCCTATTCTTGAGG + Intergenic
1030684568 7:112471453-112471475 TCTCCTTTCTCCTCTCCCTGTGG + Intronic
1031416584 7:121503167-121503189 TCTGCTCTTTCCTGTACACATGG - Intergenic
1031757201 7:125660110-125660132 TCTGTTCCTTACTGTACCTGTGG - Intergenic
1031913276 7:127539751-127539773 TCTGCTCCTTACTGTACATGTGG - Intergenic
1032718686 7:134532504-134532526 TCTGCTCTTACCTGCTCCTGAGG + Intronic
1032723634 7:134571095-134571117 TCTGCTCTTACCTGCTCCTGAGG + Intronic
1032865527 7:135920540-135920562 CCTTCTCAGTCCTGTACCTGGGG + Intergenic
1032943491 7:136823268-136823290 TCCCCTCTTCTCTGTATCTGAGG + Intergenic
1034118950 7:148609821-148609843 TCTCCTTCTTCCTGTAACAGAGG - Intronic
1035266323 7:157692019-157692041 TCTCCTTGTTCCTGCAGCTGTGG - Intronic
1038370072 8:26980138-26980160 TCTCCTCCTTACTGTACACGTGG - Intergenic
1038381095 8:27095291-27095313 CTGCCTCTTTACTGTACCTGTGG - Intergenic
1038701411 8:29852870-29852892 TATCCTCCTTCCTGTTTCTGAGG - Intergenic
1039091807 8:33838039-33838061 TATTATCTTTCCTGTATCTGTGG - Intergenic
1039646089 8:39284939-39284961 TCTTCTCTTTCCTTTACCCCCGG + Intergenic
1039650119 8:39332470-39332492 TCTGCTCCTTACTGTACGTGTGG + Intergenic
1040710144 8:50177875-50177897 TCTCCTCATTCCTGAACCCCTGG + Intronic
1040957568 8:52995393-52995415 TCTGCTCTTTACTGTACACGTGG - Intergenic
1041601080 8:59717925-59717947 TCTGCTCTTTACTGTACATGTGG - Intergenic
1042850680 8:73213226-73213248 TCTACTCTTTCCTAAAGCTGTGG + Intergenic
1044234511 8:89814964-89814986 CCTCCTCTTTCATGTACCTGAGG + Intergenic
1045681676 8:104667313-104667335 TCTGCTCCTTACTGTACATGTGG - Intronic
1045792181 8:105996356-105996378 TCTGCTCCTTACTGTACATGTGG + Intergenic
1045794817 8:106030198-106030220 TCTGCTCCTTACTGTACATGTGG + Intergenic
1046570563 8:115960344-115960366 GCTTCTATTTCCTGTACCTGTGG + Intergenic
1046629780 8:116612002-116612024 TCCCCTCTCTCCTTCACCTGTGG + Intergenic
1046824811 8:118676232-118676254 TCTCATCTGTTCTGTCCCTGTGG + Intergenic
1046953411 8:120039403-120039425 TCCTCTCTGTCCTATACCTGAGG - Intronic
1047693003 8:127375497-127375519 GCTGTTCTTTCCTGTCCCTGTGG + Intergenic
1047884806 8:129237692-129237714 CTTCCTCTTTCCTCTACCTAAGG + Intergenic
1048394037 8:133996326-133996348 TCTGCTGTTTGTTGTACCTGTGG + Intergenic
1048799659 8:138184256-138184278 GCTCCTCTCACCTGTCCCTGAGG - Intronic
1050090744 9:2015428-2015450 TCTCCTCTTTCCCCTCCCTTCGG + Intronic
1050333246 9:4566468-4566490 TCTCCTCTTTGCTTTTCCTCTGG + Intronic
1051249100 9:15141170-15141192 CCTCCTCTTTCCTAAACTTGGGG - Intergenic
1051463356 9:17348943-17348965 CCTCACCTTTCCTGTACCTTTGG + Intronic
1051864886 9:21668654-21668676 TCTTCTCTTTCCTGACCCAGTGG - Intergenic
1052945791 9:34167168-34167190 TCCAGTCTTTCCTGTACCTCTGG - Intergenic
1053082328 9:35186812-35186834 TCTGCTCCTTACTGTACATGTGG + Intronic
1053504544 9:38630250-38630272 TTTCCTTTTTACTGAACCTGTGG + Intergenic
1054872639 9:70062682-70062704 TTTCTTCTTTCCTGTAAATGTGG + Intronic
1054943790 9:70772757-70772779 TCTCTTCTTTCCTTTGCCTTTGG + Intronic
1055972158 9:81922107-81922129 TCTGCTCCTTACTGTACATGTGG + Intergenic
1055973911 9:81937179-81937201 TCTGCTCCTTACTGTACATGTGG + Intergenic
1056557842 9:87704623-87704645 TTTCGTCTTTCCTGAGCCTGAGG + Intronic
1057151877 9:92803431-92803453 TTTCCTTTTTACTGAACCTGTGG - Intergenic
1057243678 9:93435490-93435512 TCTCCTCTCACCTGTGTCTGGGG + Intergenic
1059426663 9:114225444-114225466 TGTCCTCTCTCCTGTAACTGGGG + Intronic
1060975481 9:127762506-127762528 TTTCCTCTTTCCTGCAGCTTTGG + Intronic
1061315676 9:129794389-129794411 ACTGTGCTTTCCTGTACCTGGGG + Intergenic
1203656788 Un_KI270753v1:5675-5697 TCTGCTCCTTCCTGTACACGTGG - Intergenic
1203659296 Un_KI270753v1:26438-26460 TCTGCTCCTTCCTGTACACGTGG + Intergenic
1186574191 X:10748156-10748178 TCTCCTGTTTATTGTCCCTGGGG + Intronic
1189197932 X:39167403-39167425 TCTCCTCCTTCCAGTAAATGGGG - Intergenic
1189211402 X:39287052-39287074 TCTCCTCTTTCTTATTCATGTGG - Intergenic
1190049937 X:47142043-47142065 TCTTCTCTTTCATGGCCCTGTGG - Intergenic
1190266790 X:48831662-48831684 TCTCCCCTTCCCAGGACCTGGGG + Intronic
1191017067 X:55819959-55819981 TCTGCTCTTTACTGTACACGTGG + Intergenic
1191957803 X:66665137-66665159 TGTCCTCCTTCCTTTACCTGAGG - Intergenic
1195853554 X:109307918-109307940 GCTCCTCTTTCCGGTTCCAGTGG - Intergenic
1197240895 X:124122126-124122148 TCTGCTCTTTACTGTACACGTGG - Intronic
1197706401 X:129637583-129637605 TCTCCTCTTTCCTGTTCTGCAGG - Intergenic
1198088401 X:133303532-133303554 TCTAATCTTTCTTGTTCCTGTGG + Intronic
1200907325 Y:8497383-8497405 TTTCTTCTTTCCTGTCCATGTGG + Intergenic
1201556201 Y:15266785-15266807 TCTCCCCTTTCTAGTTCCTGTGG + Intergenic