ID: 1151356797

View in Genome Browser
Species Human (GRCh38)
Location 17:73563468-73563490
Sequence CTCAGAAGGCTGAATGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 15, 3: 73, 4: 581}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151356797 Original CRISPR CTCAGAAGGCTGAATGTGGG AGG Intronic
900298128 1:1962775-1962797 CTCAGGAGGCTGATTGAGGCAGG + Intronic
900426646 1:2583397-2583419 CTCAGTAGCATGAAGGTGGGAGG - Intergenic
901123586 1:6913717-6913739 CTCAGGAGGGAGATTGTGGGAGG + Intronic
901130989 1:6962555-6962577 GTGGGAAGGCTGGATGTGGGCGG - Intronic
901534253 1:9872190-9872212 CCCAGAAGGGAGACTGTGGGTGG - Intronic
901622707 1:10601545-10601567 CACAGAAGGCTGAATGGGGGAGG + Intronic
901846643 1:11987198-11987220 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
901907948 1:12430654-12430676 CTGAGAAGGCTTAGTGTGGTAGG - Intronic
902704640 1:18196159-18196181 ATCAGGGGGCTGAATGTGGTCGG + Intronic
902835379 1:19043754-19043776 CTCAGGAGGCTGAGACTGGGTGG + Intergenic
903417057 1:23190910-23190932 CTCAGAAGGCTGAGCCTGGGAGG + Intergenic
903534688 1:24059240-24059262 CTCAGGAGGCTGAGCGGGGGAGG - Intronic
904076433 1:27846245-27846267 CACTGAAGGTTGAATGTGAGTGG - Intronic
904169004 1:28578099-28578121 CCCAGAAGGTAGAATGTGGTGGG + Exonic
904876138 1:33655998-33656020 TGCAGAAGGCTGAATTTGGAAGG + Intronic
905050439 1:35046573-35046595 CTCAGGAGGCTGGGGGTGGGAGG - Intergenic
905079281 1:35302895-35302917 CTCTGGAGGCTGGAGGTGGGAGG + Intronic
905176789 1:36141353-36141375 TTCAGAAGGAAGAGTGTGGGTGG - Intronic
905760264 1:40550627-40550649 CTCAGAAGAATGAATGAGGAGGG - Intergenic
905801596 1:40847595-40847617 CTCTGAAGGGTGGATCTGGGTGG + Intergenic
905986476 1:42287854-42287876 CCCAGAAGGCTAAGAGTGGGAGG + Intronic
906116709 1:43361818-43361840 CAGTGAAGGCTGAATGTGGGGGG - Intronic
906344806 1:45008478-45008500 CACACAAGGCTCAATGTTGGGGG + Intronic
906478007 1:46182918-46182940 CTCAGGAGGCTGAGTGAGGTAGG - Intronic
906727590 1:48055231-48055253 CTCAGAAGGCTGAAGAAGGCAGG + Intergenic
907358752 1:53897742-53897764 CTCAGGAGGCTGAGTTGGGGGGG + Intronic
907942827 1:59105763-59105785 CTCAGAAATCTGAAGGTGGCTGG - Intergenic
908008011 1:59746597-59746619 CTCAGAAGGCTGACTGAGATAGG - Intronic
908315240 1:62925974-62925996 CTAAGAAGTCTGAAGGTAGGTGG - Intergenic
908896688 1:68909188-68909210 CTCAGGAGGCTGAAGGTGGGTGG + Intergenic
908981355 1:69963060-69963082 TTCGGGAGGCTGAAGGTGGGCGG + Intronic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909390821 1:75119542-75119564 CTCATCATGCTGAATGTGGCTGG - Intergenic
909947327 1:81678069-81678091 CTGAGAAGGCTACATATGGGAGG - Intronic
910048258 1:82943906-82943928 GGCAGAAGGCTGAATGTTGCAGG + Intergenic
910252066 1:85208296-85208318 CTTGGAAGGCTTAATGTGGCTGG + Intergenic
910718968 1:90264307-90264329 GACAGAAGGCTGAATGTGGGTGG + Intergenic
910755579 1:90686684-90686706 CTCAGAAGGTTGAACCCGGGAGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
911038213 1:93572006-93572028 CTTAGCAGGCTGACTGTGGAGGG + Intronic
911457800 1:98148912-98148934 CTCAGAAGGGGAAAGGTGGGAGG + Intergenic
912411513 1:109483772-109483794 CCCAGAAGGCTGTGAGTGGGTGG + Intronic
912936263 1:114005937-114005959 CTGGGATTGCTGAATGTGGGGGG + Intergenic
913250416 1:116908711-116908733 CTCAGAAGGCTGAGGTTGGGGGG - Intergenic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
916358765 1:163943585-163943607 CTGAGGAGGCTGAAGCTGGGAGG + Intergenic
916657667 1:166891463-166891485 TCCAGATGGGTGAATGTGGGAGG - Intergenic
916689849 1:167179863-167179885 CTCTGAAGGCTGTGTGAGGGAGG + Intergenic
916816978 1:168363676-168363698 CTCACATGGCAGAAGGTGGGAGG - Intergenic
917233760 1:172867068-172867090 CTGAGAAGGTTAAATGTGGGAGG - Intergenic
917338001 1:173945231-173945253 CTCAGGAGGCTGAAGGCAGGAGG - Intronic
917349075 1:174058145-174058167 CTCAGGAGGCTGGAGGTGGGAGG - Intergenic
917972143 1:180215419-180215441 CTCAGGGGGCTGAGGGTGGGAGG + Intergenic
918507634 1:185273894-185273916 CTCAGGAGGCTGGAGGTGGGAGG + Intronic
919070036 1:192742755-192742777 GGCAGAAAGCTGAATCTGGGTGG - Intergenic
919249295 1:195031293-195031315 CTCAGAAGGAGGGAAGTGGGAGG - Intergenic
919618638 1:199839188-199839210 GTCAGAGGGCTGAGGGTGGGAGG + Intergenic
920140932 1:203812270-203812292 ATCAGAAGGTAGAAGGTGGGAGG - Intronic
920919200 1:210284320-210284342 CTCAGGAGGCTGAGGTTGGGAGG + Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
923133432 1:231096913-231096935 CTCAGAGAGCTGCATGTGGTTGG + Intergenic
923760429 1:236837654-236837676 CTCAGGAGGCTGAGTGTGGAGGG + Intronic
924081881 1:240406710-240406732 CTCAAAAGGGTGAATGTGGTTGG + Intronic
924369974 1:243337305-243337327 ATCAGATGGCTGTATGTGTGTGG + Intronic
1062989553 10:1803144-1803166 CTCAGGAGGCTTGAGGTGGGAGG + Intergenic
1063552848 10:7049376-7049398 CTCAGAAGGCTTGAGGTGAGAGG + Intergenic
1063585283 10:7346876-7346898 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1063683454 10:8212653-8212675 CTCAGAAGGCTGAACCAGGGAGG - Intergenic
1064327945 10:14368068-14368090 CTCAGGAGGCTGAGGGTGAGAGG - Intronic
1065044123 10:21730184-21730206 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
1065812944 10:29459216-29459238 CTCAGGAGGCTTGAGGTGGGAGG - Intronic
1065854428 10:29818379-29818401 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1066121904 10:32297391-32297413 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
1066352664 10:34651115-34651137 CGCACAAGGCTGAGTGTGTGAGG + Intronic
1067023129 10:42819476-42819498 CTGATAAGGCTGGATATGGGAGG + Intronic
1067026062 10:42845261-42845283 CTCAGAAGGCTGGATATGCTCGG - Intergenic
1067840246 10:49670076-49670098 CTCAGAAGGGGGAGTGTGGGGGG - Intergenic
1068942080 10:62690219-62690241 CGGGGAAGGCTGGATGTGGGTGG - Intergenic
1069045747 10:63741499-63741521 ATCAGGAGGCTGCAGGTGGGAGG - Intergenic
1069110012 10:64435646-64435668 CTCAGAAGGGAGAAACTGGGAGG + Intergenic
1069432402 10:68349410-68349432 CTCAGGAGGCTGAGGGGGGGAGG + Intronic
1069972648 10:72186234-72186256 CTCAGGAGGCTGAGTCAGGGAGG - Intronic
1070610866 10:77931545-77931567 CTCAGAAGCCTGATTATAGGTGG - Intergenic
1070754943 10:78986086-78986108 CTCAGAATGGTGAAGGTGGAGGG + Intergenic
1070893665 10:79963233-79963255 CTTGGCAGGCTGAATCTGGGAGG + Intronic
1071545850 10:86528777-86528799 CTCAGGAGGCTGAGCCTGGGAGG - Intergenic
1072143561 10:92612763-92612785 CTCTGAAAGCTGGATGTGGGTGG - Intronic
1072619586 10:97070925-97070947 CTCAGAAGGCTGAGGTGGGGAGG - Intronic
1075500524 10:122969658-122969680 ATCAGAAGGTGGAAGGTGGGAGG + Intronic
1075732519 10:124644921-124644943 CTCAGAACTCTGGATGTGGAGGG - Intronic
1075762796 10:124869674-124869696 CACAGACTGGTGAATGTGGGTGG + Intergenic
1075814831 10:125256917-125256939 CTCGGGAGGCTAAAGGTGGGAGG - Intergenic
1076721503 10:132395385-132395407 CACAGGGGGCTGTATGTGGGTGG - Intergenic
1077276205 11:1710266-1710288 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1077511370 11:2965635-2965657 CTCGGGAGGCTGAATCCGGGAGG - Intronic
1077613030 11:3656290-3656312 CTCGGCAGGCTGAAGGTAGGAGG - Intronic
1077707362 11:4499840-4499862 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1077903001 11:6505125-6505147 CTCAGAACTCTGAATGGGGCCGG - Intronic
1079105208 11:17567311-17567333 CTCAGAAGGATGGTTGTGGCTGG + Intronic
1079250138 11:18781098-18781120 CTCAGAAGGCTGCCTGGAGGAGG - Intronic
1079739347 11:24037464-24037486 GTCAGTAGGCTGAATGAGGAAGG + Intergenic
1080284773 11:30597496-30597518 ATCAGAAGGCTTGATGTGGTGGG + Intergenic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1081008175 11:37774195-37774217 CTCAGAAGCCTGACAGTGTGTGG - Intergenic
1081467532 11:43336157-43336179 CCCAGAAGGGTGAATGAGAGAGG - Intronic
1081561289 11:44219404-44219426 CTCAGGAGGCTGAGTGAGGTGGG + Intronic
1081666447 11:44919701-44919723 ATCAGAAGACTGGGTGTGGGCGG - Intronic
1082015613 11:47484223-47484245 CTCAGGAGGCTGATCCTGGGAGG + Intronic
1082746933 11:56973830-56973852 ATCAGATGGTTGTATGTGGGTGG - Intergenic
1083376981 11:62231767-62231789 ATCAGATGGCTGAAGGTGGATGG - Intergenic
1084075030 11:66767897-66767919 CTCAGAAGGCTATAAATGGGAGG - Intronic
1084417875 11:69043922-69043944 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1084482939 11:69432536-69432558 CTGAGAAGCCAGAATGTGGGTGG + Intergenic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1085251692 11:75148166-75148188 CTCAGAAGACGGGGTGTGGGCGG - Intronic
1086217015 11:84395523-84395545 CTCAAGAGGCTGGAGGTGGGAGG - Intronic
1088408431 11:109506506-109506528 CTCAGGAGGCTGACTGAGGCAGG - Intergenic
1088429561 11:109743999-109744021 CACAGAAGTGTGGATGTGGGTGG + Intergenic
1088647851 11:111931225-111931247 CTCAGGAGGCTGAATGAGGTGGG + Intronic
1088919582 11:114251328-114251350 CTCAGAAGGCTGAGGGTAGGAGG - Intergenic
1089103399 11:115982785-115982807 CTCAGAAGTCTGAATGTAAGAGG - Intergenic
1089259117 11:117210825-117210847 CTCAGGAGGTTGAGGGTGGGAGG + Intronic
1089297442 11:117478523-117478545 CTTAGAAGAATGAATGTGAGTGG - Intronic
1089418133 11:118310272-118310294 CTCAGAAGGTGGAGGGTGGGAGG - Intronic
1090456967 11:126858370-126858392 CTGAGAAGGGTGTGTGTGGGAGG + Intronic
1090670180 11:128940507-128940529 CTCACATGGCTGAAGGTGGAAGG - Intronic
1090830557 11:130418070-130418092 CTCAGGAGGCTTGAGGTGGGTGG + Intronic
1091049592 11:132355371-132355393 CACAGGAGGCTGCATGTGGCTGG + Intergenic
1091079000 11:132648607-132648629 CTCAGGAGGCTGAAGCAGGGAGG - Intronic
1092680783 12:10978260-10978282 ATCAGATGGCTGTAGGTGGGTGG - Intronic
1093865531 12:24222508-24222530 TTGTGAAGACTGAATGTGGGTGG + Intergenic
1094552249 12:31463771-31463793 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
1095384303 12:41632297-41632319 ATCAGATAGCTGTATGTGGGTGG - Intergenic
1095389637 12:41690060-41690082 CTCAGAGGGGTGAAGATGGGCGG + Intergenic
1095846655 12:46753149-46753171 CTCAGGAGGTTGAATGAGGCTGG - Intergenic
1096091708 12:48906391-48906413 CTCAGGAGGCTGAACTCGGGAGG - Intronic
1096652834 12:53070327-53070349 CTCAGAGGGGTGGAAGTGGGGGG + Intronic
1096682411 12:53265212-53265234 CTCAGGAGGCTGAGGCTGGGAGG - Intergenic
1097620955 12:61938900-61938922 CTCAGAAGGAGGAGGGTGGGAGG + Intronic
1097858649 12:64494369-64494391 CTCAGGAGGCTTAAGGTGAGAGG + Intronic
1098321698 12:69251124-69251146 CTCAGGAAGCTGAATATGGTGGG + Exonic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1100347681 12:93748413-93748435 CTCAGGAGGCTGAAGCAGGGGGG - Intronic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1100912752 12:99383920-99383942 CTCAAGAGGCTGAAGCTGGGGGG + Intronic
1101633615 12:106519026-106519048 CTCAAGAGGCTGAGGGTGGGAGG + Intronic
1102428757 12:112865113-112865135 CTCAGAAGGCAGTTTCTGGGAGG + Intronic
1102511794 12:113421090-113421112 CACAGAAGGCTTTAGGTGGGGGG - Intronic
1103703840 12:122861071-122861093 CTCCCGAGGCTGAATGGGGGTGG + Intronic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1104469126 12:129014912-129014934 GTCTGAGGGCTTAATGTGGGTGG + Intergenic
1104483920 12:129132986-129133008 CTCTGATGTCTGAATGTGGCAGG + Intronic
1104748437 12:131223953-131223975 CTGGGCAGGCTGGATGTGGGCGG + Intergenic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1105521210 13:21132432-21132454 CTCAGGAAGCTGGAGGTGGGAGG - Intergenic
1106035759 13:26043598-26043620 CTCAGGAGGCTGAGTGAGGCAGG + Intergenic
1106295454 13:28409440-28409462 CTCGGAAGGCTGAAGTTGGAGGG - Intronic
1108287747 13:48925543-48925565 CGCAGACAGCTGAATGTGTGAGG + Intergenic
1108460952 13:50666857-50666879 CCCTGAAGGGCGAATGTGGGTGG - Intronic
1109985984 13:69985001-69985023 CTCAGGAGGCTGAAGCAGGGAGG + Intronic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1110468500 13:75830337-75830359 CACAGAAGGATTAAAGTGGGTGG - Intronic
1112297533 13:98201331-98201353 TTCAGGAGGCTGAACGGGGGAGG + Intronic
1112333366 13:98494300-98494322 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1112524166 13:100127986-100128008 CTAAGGAGTCTGAATGAGGGAGG - Intronic
1113834126 13:113317792-113317814 CTCAGAAGGCTGACTAGGGAGGG - Intronic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1114321796 14:21552993-21553015 CTCAGGAGGCTGAAGTTGAGAGG - Intergenic
1114479695 14:23025065-23025087 GTCAGAAGGCAGAAAGTGGTTGG - Intronic
1114772852 14:25448637-25448659 CTCAGGAGGCTGAGTGAGGCAGG + Intergenic
1115213641 14:30992931-30992953 CTCAGAAGGCTGAAGTTGGGAGG - Intronic
1115625286 14:35186088-35186110 CTCAGAAGGCTGAGGTTGGGGGG - Intronic
1116957206 14:50936699-50936721 CTCAGGAGGCTGAGGCTGGGAGG + Intronic
1118167410 14:63350763-63350785 CTCAGGAGGCTGAAGCAGGGGGG + Intergenic
1118202578 14:63690145-63690167 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1118391422 14:65298947-65298969 CTCAGAAGGCTGAGTGAGGCAGG + Intergenic
1119085128 14:71732405-71732427 CTCAGTAGGCAGAAGCTGGGTGG - Intronic
1119367748 14:74109374-74109396 CTCAGGAGGCTGAGCCTGGGAGG + Intronic
1119512875 14:75225506-75225528 CTCAGAAGGCTGAGGGTGAGAGG + Intergenic
1119724190 14:76912196-76912218 CTCAGAAGGCAGTATATGCGGGG - Intergenic
1119801056 14:77445529-77445551 CTCAGGAGGCTTGAGGTGGGAGG - Intronic
1120164866 14:81186840-81186862 CTCAGGAGGATGAGGGTGGGAGG + Intronic
1120738775 14:88084296-88084318 CCCTGAAGGCTGAATGCAGGTGG + Intergenic
1120904582 14:89609308-89609330 CTCGGGAGGCTTGATGTGGGAGG - Intronic
1121304716 14:92898888-92898910 CTGGGAAGGCTGGAGGTGGGTGG - Intergenic
1121712699 14:96051382-96051404 CCCAGAAGGATGAAAGTGAGGGG + Intronic
1122005717 14:98701915-98701937 CTCAGAAGGTGGCATGGGGGAGG - Intergenic
1122179944 14:99947506-99947528 CAGAGAAGGCTGCATGTGGAAGG - Intergenic
1122315174 14:100821781-100821803 CTCAGAAGGCTGAAGCGGGGAGG - Intergenic
1122375456 14:101254070-101254092 CTGAGAAGGCTGAATGTGATAGG - Intergenic
1122706614 14:103625917-103625939 CTCAGAAGGCTGAACTGAGGTGG - Intronic
1122907164 14:104807065-104807087 CTCAGGAGGCTGAGTGGGGAGGG - Intergenic
1122939852 14:104976401-104976423 CTCAGCAGGCTGGAGATGGGCGG - Intronic
1123424278 15:20156656-20156678 CTGATAAGGCTGGATATGGGAGG + Intergenic
1123533500 15:21163185-21163207 CTGATAAGGCTGGATATGGGAGG + Intergenic
1124423477 15:29542118-29542140 CTCTGGAGGCTGAATGAGGCAGG - Intronic
1125278690 15:38021449-38021471 CATAGAAGGGTGCATGTGGGGGG + Intergenic
1126646650 15:50881592-50881614 CTCGGGAGGCTGAGAGTGGGAGG + Intergenic
1127751294 15:62047324-62047346 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1127803915 15:62501134-62501156 CTCAGAAGGCTGAAGGAGCTTGG + Intronic
1127894423 15:63283335-63283357 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1128498292 15:68210569-68210591 CTCCGAAGGCTGCAGCTGGGAGG - Intronic
1129776914 15:78242929-78242951 CTCAGGAGGCTGAAGCGGGGAGG + Intronic
1129933405 15:79430989-79431011 CTCAGCTGTCTGGATGTGGGTGG - Intergenic
1130087188 15:80787463-80787485 CAAAGAAGGCTGAGTGTTGGTGG + Intronic
1130119842 15:81038403-81038425 CTCATAAGGCTGTATGTGTGAGG - Intronic
1130129078 15:81121861-81121883 TTCAGAAGGTGGAAGGTGGGAGG - Intronic
1131114734 15:89787721-89787743 CTCAGAAGGCTGAAGTGGGAGGG + Intronic
1131814633 15:96209423-96209445 CTCAGATGGCTGAAGGTGTTTGG - Intergenic
1131922980 15:97350678-97350700 CTCAGAAGACTGATTTGGGGTGG - Intergenic
1132593383 16:736606-736628 CCCAGGAGGCTGAACCTGGGAGG - Intronic
1133824707 16:9267672-9267694 ATCACAAGGGTGAATGTGTGAGG + Intergenic
1135007882 16:18843820-18843842 CTCAGAAAACTGGTTGTGGGTGG + Intronic
1135200130 16:20430037-20430059 CTCAGAAGGAAGAAGGTGAGAGG + Intronic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135267302 16:21038407-21038429 CTCGGAAGGCTAAGGGTGGGAGG + Intronic
1135826748 16:25735494-25735516 CTCAGGAGGCTGAGAGTGGAGGG - Intronic
1135973016 16:27086012-27086034 CTCAGAAGGTGGAGGGTGGGAGG + Intergenic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1136126554 16:28186778-28186800 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1136269655 16:29141142-29141164 CTCAGGAGGCTGAACCTGGGAGG + Intergenic
1136461925 16:30416840-30416862 CTCAGAAGGCTGAGTCAGGAGGG + Intronic
1136860586 16:33699231-33699253 CTGATAAGGCTGGATATGGGAGG - Intergenic
1136985178 16:35096446-35096468 CTCAGGAGGCTTGAGGTGGGAGG + Intergenic
1137243231 16:46677642-46677664 CTCAGGAGGCTTGAGGTGGGAGG - Intronic
1137724363 16:50646912-50646934 CACAGAGGGCTGAATGTGGTGGG - Intergenic
1137973660 16:53011568-53011590 CTCAGGAGGCTGAGGTTGGGAGG - Intergenic
1138582620 16:57951461-57951483 CTCAGAAGGCTGAGTGAGGTGGG - Intronic
1139134101 16:64180381-64180403 CTCAGAAGATAGAAGGTGGGAGG + Intergenic
1139137382 16:64221379-64221401 CTCATAAGGCACAATGTGGCAGG - Intergenic
1139137956 16:64227762-64227784 TTCAGAAGGCTGAATTTGGTGGG - Intergenic
1139920727 16:70458554-70458576 CTCGGGAGGCTGAACCTGGGAGG - Intronic
1140038900 16:71392285-71392307 CTCAGGAGGTTGAGGGTGGGAGG + Intergenic
1140185426 16:72765416-72765438 CTCAGAAGGCTGAAGCGGGAGGG + Intergenic
1140635502 16:76908269-76908291 CTCAGAAGGCTGAAAATGGGAGG + Intergenic
1141443727 16:84045212-84045234 CTCAGGAGGCTGGATTTGGGGGG - Intergenic
1141752928 16:85971388-85971410 CTCAGGAGGGTGAACCTGGGAGG - Intergenic
1142021387 16:87785030-87785052 CACAGCAGCCGGAATGTGGGTGG + Intergenic
1142073143 16:88102410-88102432 CTCAGGAGGCTGAACCTGGGAGG + Intronic
1142400987 16:89858698-89858720 CTCAGAAGGGTGACTGGGAGAGG + Intronic
1203065874 16_KI270728v1_random:1017115-1017137 TTCAGAAGAATGAATGTGGTGGG + Intergenic
1203122086 16_KI270728v1_random:1547414-1547436 CTGATAAGGCTGGATATGGGAGG - Intergenic
1142633121 17:1239013-1239035 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1143035125 17:3990697-3990719 ATGAGAAAGCTGAGTGTGGGCGG - Intergenic
1143658934 17:8312987-8313009 CTCAGATGGGTGCCTGTGGGGGG + Exonic
1144801062 17:17927770-17927792 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1145212511 17:21024858-21024880 CTCAGGAGGCTGAGGTTGGGAGG + Intronic
1145807456 17:27745082-27745104 CTCAGAGAGATGAAGGTGGGGGG + Intergenic
1145833946 17:27939647-27939669 CTGAGCATGCTGAATGAGGGTGG + Intergenic
1145873247 17:28294272-28294294 CTCAGGAGGCTTGAGGTGGGAGG - Intergenic
1146115395 17:30133049-30133071 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1146783389 17:35696495-35696517 CTCGGGAGGCTGAACCTGGGAGG - Intronic
1146949177 17:36893908-36893930 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1146976014 17:37112668-37112690 CATAGAAGGCTGAATCTGGGGGG + Intronic
1147933917 17:44000654-44000676 CTCGGGAGGCTGAACCTGGGAGG - Intronic
1148598723 17:48878004-48878026 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1148980257 17:51567433-51567455 ATCAGGAGGCTGAGGGTGGGAGG + Intergenic
1149480960 17:57002761-57002783 CTCAGGAGGCTGAGTGAGGTGGG + Intronic
1150658164 17:67054062-67054084 CTCAGAAGGGTGAGCCTGGGTGG + Exonic
1150906775 17:69346800-69346822 CTCAGGAGGCTGAGGTTGGGAGG + Intergenic
1151265481 17:72952091-72952113 TTCTGAAGGCTAAATGTTGGAGG - Intronic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1151356797 17:73563468-73563490 CTCAGAAGGCTGAATGTGGGAGG + Intronic
1151412425 17:73940140-73940162 CAGAGGAGGCTGAATCTGGGAGG - Intergenic
1151572549 17:74934224-74934246 CTCAGGAGGCTGAAGTGGGGGGG - Intergenic
1151652864 17:75480945-75480967 CTCAGAAGGCTGAGCCTGAGGGG + Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1151914016 17:77104229-77104251 CTCAGGAGGCTGACTGAGGCAGG - Intronic
1152235812 17:79137816-79137838 CTGAGAAGGCAGAGTGTGGCTGG - Intronic
1152299481 17:79486677-79486699 CCCAGAAGGCTGGCTATGGGTGG + Intronic
1152404367 17:80087997-80088019 CTCAGAGGCCTGCATGGGGGAGG - Exonic
1153468985 18:5421810-5421832 CTCAGAAGGCAGACAGTGGCGGG + Intronic
1153499600 18:5734658-5734680 CTCAGAAGGGTGGAGGTGAGGGG + Intergenic
1153622264 18:6990330-6990352 CTCAGAAGGGTAACGGTGGGAGG + Intronic
1155259784 18:24030760-24030782 CTCAGGAGGCTGAGTGAGGCTGG - Intronic
1155491252 18:26404133-26404155 CTTGGAAGGCTGAAGTTGGGGGG - Intergenic
1157508809 18:48252794-48252816 GCCAGAATGCTGAAAGTGGGAGG + Intronic
1157942557 18:51945245-51945267 CTAGGGAGGCTAAATGTGGGGGG - Intergenic
1158432087 18:57398547-57398569 CCCAGAAGGCTGAATAGAGGAGG + Intergenic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1158872982 18:61706852-61706874 CTCTGAAGACTGAAGGTGGAAGG - Intergenic
1161000992 19:1910954-1910976 CCCAGAAGGTTGAACCTGGGAGG - Intronic
1161155794 19:2731472-2731494 CCCACAAGGCTGACTGGGGGGGG - Intronic
1161927951 19:7315324-7315346 CTCAGGAGGCTGAGGTTGGGAGG + Intergenic
1162063980 19:8113589-8113611 CTCAGGAGGCTGAGGCTGGGAGG + Intronic
1162069844 19:8147172-8147194 CCCCGAAGGCCGAATGTGTGCGG - Exonic
1162371178 19:10280483-10280505 CTCAGGAGGCTAAGGGTGGGAGG - Intronic
1162515425 19:11144574-11144596 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
1162552770 19:11366951-11366973 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1162619609 19:11830991-11831013 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1162686974 19:12395247-12395269 CTCAGGAGGCTGAGGCTGGGTGG - Intronic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162935886 19:13981297-13981319 CTCAGAAGGCTCAAAGGGGCCGG + Intronic
1163098922 19:15081876-15081898 CTCAGATGCCTGAATCTGAGAGG - Intergenic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163277406 19:16294031-16294053 CTTAGGAGGCTGAGGGTGGGAGG - Intergenic
1163461724 19:17442364-17442386 CTCAGGAGGCTGAAGGCAGGAGG - Intronic
1164527036 19:29020231-29020253 CTCAGGAGGCTGACGGTGAGGGG - Intergenic
1166017243 19:39991554-39991576 CTCCGAAGGGTGCATGGGGGTGG - Intronic
1166504721 19:43363990-43364012 CTCAGAAGGCTGAGTCCAGGAGG + Intergenic
1166773005 19:45295665-45295687 CTCAGAAGGCTGAATGAGGCAGG + Intronic
1166966180 19:46530591-46530613 CTCAGCAGGATGAATTTTGGGGG - Intronic
1167214321 19:48154340-48154362 CTCAGAAGTCTGGAAGTGGCAGG + Intronic
1167282315 19:48576746-48576768 CTCAGGAGGCTGAGGTTGGGCGG - Intronic
1167367078 19:49060189-49060211 CCCAGAAGCCTGAATGGGGGAGG - Intronic
1167421582 19:49407128-49407150 CTCAGGAGGCTGAATACGTGGGG + Intronic
925035436 2:681720-681742 ATCCGAACGCTGAATGTGTGAGG - Intergenic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927280896 2:21305517-21305539 TGCAGAAGGTTGACTGTGGGAGG + Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
928563495 2:32517231-32517253 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
929909623 2:46078430-46078452 CTCAGAAGGCTGAAGTGGGAGGG + Intronic
930173093 2:48271721-48271743 CTCAGGAGGCTAAGGGTGGGAGG + Intergenic
931356440 2:61540906-61540928 CTCAGATGGCTGAGTCAGGGAGG - Intergenic
931774006 2:65524318-65524340 CTCAGGAGGCTGAGACTGGGAGG - Intergenic
932188554 2:69719368-69719390 CTCAGGAGGCTGAAAGCAGGAGG - Intronic
932780019 2:74554030-74554052 AGGAGAAGGCGGAATGTGGGAGG - Intronic
933520655 2:83368126-83368148 TTCAGAAGCCTGAATGTGATGGG + Intergenic
933711489 2:85329253-85329275 CTCAGAAGGCTGAGGATGGAAGG + Intergenic
934272616 2:91548249-91548271 CTCAGGAGGCCGCATGAGGGGGG + Intergenic
934458966 2:94200383-94200405 CTGATAAGGCTGGATATGGGAGG - Intergenic
935197677 2:100828693-100828715 CTCAGATGGCTGCAGGTGTGTGG + Intronic
935265505 2:101390214-101390236 CTCAGGAGGCTGAGGATGGGGGG - Intergenic
935536860 2:104304921-104304943 ATCAGAAGGTTGACTGTGGAAGG - Intergenic
935712420 2:105910952-105910974 CTGAGAAGGCTGAGTGGGGAGGG + Intergenic
935884092 2:107596963-107596985 CTCAGGAGGCTGAGTGAGGCAGG + Intergenic
936094893 2:109523983-109524005 CTCTGAAGGATGCAGGTGGGCGG - Intergenic
936268278 2:111028078-111028100 CCCAGAAGGCTGAGGTTGGGAGG + Intronic
936669287 2:114637782-114637804 ATCAGATGGCTGTATGTGTGCGG + Intronic
937105890 2:119312354-119312376 CTCAGGAGGCTGGAGATGGGAGG - Intronic
937127241 2:119482453-119482475 CACAGAAGGCAGTGTGTGGGCGG + Intronic
937184606 2:120028425-120028447 TTCAGAAGGCTGGAGGTGAGAGG + Intronic
937225499 2:120366505-120366527 CTCCAAGGGCTGAATGTGGGAGG + Intergenic
937231520 2:120400768-120400790 CTCAGGAGGCTGGATGGAGGGGG - Intergenic
937235916 2:120431918-120431940 CTCAGCAGGCTGAAAGTTCGGGG - Intergenic
937614166 2:123900961-123900983 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
938036048 2:128035834-128035856 CTCAGGAGGCTGAGGGTGGTGGG + Intergenic
938112617 2:128578972-128578994 CTCAGAAGGCAGAGGTTGGGCGG - Intergenic
938914123 2:135917582-135917604 CTCAGGAGGCTTCAGGTGGGAGG - Intronic
940224990 2:151391758-151391780 CTCAGAAGGCTGGGTCTAGGCGG + Intergenic
940383930 2:153048310-153048332 CTCAGATGGCTGTAGGTGTGAGG - Intergenic
940624484 2:156155483-156155505 CTCAGAAGGCTCGAGGTGGAAGG + Intergenic
941520166 2:166532261-166532283 CTCTGAAGGATGAATGAGAGAGG - Intergenic
942042630 2:172081114-172081136 CTTGGAGGGCTGGATGTGGGCGG - Exonic
942256151 2:174100510-174100532 CTCAGAAGGCTGAGCGTGGGAGG - Intronic
943432653 2:187824162-187824184 TTCAGAAGGCAGAGGGTGGGAGG - Intergenic
943597502 2:189875843-189875865 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
944706671 2:202296309-202296331 CTCAGAAGGCTGAGGCAGGGAGG - Intronic
944790280 2:203117788-203117810 CTCCGGAGACTGAAGGTGGGAGG - Intronic
945871600 2:215232394-215232416 CTCAGGAGGCTGAGTGAGGCAGG + Intergenic
946689626 2:222300455-222300477 CTCAGAAGGCAAGATGTAGGGGG + Intronic
948474961 2:238211464-238211486 CACAGAAGGCTGCATTTAGGAGG + Intergenic
948894020 2:240919919-240919941 GGCACAAGGCTGAGTGTGGGTGG + Intronic
1168952556 20:1812409-1812431 ATAAGAAGTCTGTATGTGGGAGG + Intergenic
1169908747 20:10629943-10629965 CCCAGAAGGCTGAGTGTGTGCGG + Intronic
1170058875 20:12238599-12238621 ATCAGAGGGCGGAAGGTGGGAGG + Intergenic
1170096254 20:12648896-12648918 CTCAGAGGGGGGAGTGTGGGAGG - Intergenic
1170956097 20:20980741-20980763 CTCAAAAGGGTGAGAGTGGGAGG - Intergenic
1171791799 20:29533317-29533339 CTCAGACGGCGGAAGGCGGGAGG - Intergenic
1172239490 20:33402919-33402941 CTCAGAAGGCTGAGGCAGGGAGG + Intergenic
1174234898 20:49081390-49081412 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1174341128 20:49896172-49896194 CTCAGAAGGCTGAACCCAGGAGG + Intergenic
1174396810 20:50251733-50251755 CTCGGGAGGCTAAGTGTGGGAGG - Intergenic
1174813082 20:53663916-53663938 CTCAGGAGGCTGAGTGAGGCAGG + Intergenic
1175383552 20:58579950-58579972 CTCAGAAGGCTCCATGGGGACGG - Intergenic
1176984774 21:15422986-15423008 CTCAGAAAGAGGAGTGTGGGAGG + Intergenic
1177592710 21:23192354-23192376 CTCAGAAGGCTGAGGTGGGGGGG + Intergenic
1178109171 21:29353581-29353603 CTCTGTAGGCTGGAGGTGGGTGG - Intronic
1178461835 21:32809479-32809501 CTCAGGAGGCTGAGGTTGGGAGG - Intronic
1178862401 21:36300303-36300325 CACAGGAGGCTGAACCTGGGAGG - Intergenic
1178929687 21:36806653-36806675 CCCAGAAGACTAAATGTGGGAGG + Intronic
1178997911 21:37423316-37423338 CTAAGAGGACTGAATGGGGGAGG - Intronic
1179168158 21:38951559-38951581 TTCAGCAGGCTGAGGGTGGGAGG + Intergenic
1180833090 22:18915963-18915985 CTGGGAAGGCGGAATCTGGGAGG + Intronic
1181066735 22:20310291-20310313 CTGGGAAGGCGGAATCTGGGAGG - Intergenic
1181357247 22:22306081-22306103 CTGATAAGGCTGGATATGGGAGG + Intergenic
1181415562 22:22756279-22756301 CTCAGAAGAGGGAATATGGGTGG - Intronic
1182387987 22:29963026-29963048 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1183419160 22:37700522-37700544 CTCAGGAGGCTGAAGTTGGGAGG - Intronic
1183478016 22:38046562-38046584 CTCTGAGGGCTGAGTGTGTGGGG + Intergenic
1183686625 22:39364703-39364725 CACAGAGGGCTGAGAGTGGGTGG - Intronic
1183881424 22:40834171-40834193 CTCAGAAGGCTGACTGAGGCAGG + Intronic
1185269180 22:49920823-49920845 GGCAGAAGGCTGATGGTGGGCGG - Intronic
1203283174 22_KI270734v1_random:141267-141289 CTGGGAAGGCGGAATCTGGGAGG + Intergenic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
949467121 3:4355246-4355268 CTCAGAAGGCTGAGGTGGGGGGG + Intronic
949484178 3:4521759-4521781 CTCAGGAGGCTGAGGTTGGGAGG + Intronic
949571929 3:5301863-5301885 TTTAGAAGGCTTAATGAGGGGGG + Intergenic
950207159 3:11089703-11089725 CTCAGTAGGCTAAGAGTGGGAGG + Intergenic
950754305 3:15160377-15160399 AGCAGAAGGCTGAAGGTGGCAGG + Intergenic
950815080 3:15692339-15692361 CTCAGAAGGCTGAGGGAGGGAGG + Intronic
951215307 3:20019150-20019172 CTCAGGAGGTTGAAAGTGGGAGG - Intergenic
951756828 3:26099970-26099992 CACAGCAGGATAAATGTGGGGGG - Intergenic
952069289 3:29614297-29614319 CGCAAAAGGCTGAAGGAGGGTGG + Intronic
952080335 3:29750697-29750719 TTCAGAAGGTGGAAGGTGGGAGG - Intronic
952282141 3:31934225-31934247 CTCAGGAGGCTGAGCGGGGGAGG + Intronic
952460289 3:33517768-33517790 CTCAGGAGGCTTAAGTTGGGAGG - Intronic
952798258 3:37262396-37262418 CTCGGGAGGCTGAATGAGGCAGG + Intronic
952843167 3:37665559-37665581 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
953170780 3:40505633-40505655 CTCAGAAGGCCGAATGTGTATGG - Intergenic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953263587 3:41364037-41364059 CTCAGGAGGCTGAAAGTGGGAGG - Intronic
953648165 3:44774292-44774314 CTGAGGAGGCTGAATGTAGCAGG + Intronic
953843916 3:46411800-46411822 CTCAAAATGCTGAATGAAGGAGG + Intronic
954061486 3:48071438-48071460 CCCATAAGGCTGAAGTTGGGAGG + Intronic
954216745 3:49128979-49129001 AGCAGAGGGCTGGATGTGGGTGG - Intronic
954802728 3:53196462-53196484 CTCGGGAGGCTGAGGGTGGGAGG - Intergenic
955849525 3:63204793-63204815 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
956715339 3:72074927-72074949 CTCAGGAGGCTGAATTGGGAAGG - Intergenic
956797777 3:72731972-72731994 CTCCGAAGCCTGAATGGGGGTGG - Intergenic
956940247 3:74152205-74152227 CTCAGAAGGCTGGGAGGGGGAGG - Intergenic
957657773 3:83103718-83103740 CTCGGGAGGCTGAACCTGGGAGG + Intergenic
958694955 3:97515198-97515220 CTCAGTAGCCTGATTGTGGGAGG + Intronic
958715176 3:97772248-97772270 CTCAGTAGGTTGAATGTGTCCGG + Intronic
959653088 3:108770915-108770937 TTCAGAAGCCTCACTGTGGGAGG - Intergenic
960230731 3:115223612-115223634 CTCAGTAGGCTGAAGTGGGGGGG - Intergenic
961156848 3:124686921-124686943 TTCAGGAGGCTGAGGGTGGGAGG - Intronic
961760818 3:129166150-129166172 CTATGGAGGCTGAAAGTGGGAGG + Intergenic
961955580 3:130799615-130799637 CTCAGAAGGAGGATGGTGGGAGG + Intergenic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962262508 3:133922545-133922567 CCCAGAAGGCTTAATGTGAGAGG - Intergenic
962641316 3:137389645-137389667 CTGAGAAGACTAAATGTGGTTGG - Intergenic
962787225 3:138779497-138779519 CTCGGGAGGCTTGATGTGGGAGG - Intronic
962812060 3:138967869-138967891 CTCAGGAGGCTGACTGAGGCAGG - Intergenic
964192614 3:154021973-154021995 CTCAGGAGGCTTTAAGTGGGAGG - Intergenic
964742337 3:159979901-159979923 ATCAGGAGGCTAAAGGTGGGAGG + Intergenic
964818461 3:160742779-160742801 ATCAGGAGGCTGAGTGAGGGAGG + Intergenic
965923069 3:173943116-173943138 CTCAGGAGGCTGAAGTTGGAGGG + Intronic
966192515 3:177284309-177284331 TACAGAAGGCTGAAAGTGGATGG + Intergenic
966407418 3:179612238-179612260 CTCCGCAAGCTGAAGGTGGGAGG + Intronic
966932648 3:184685804-184685826 CTCTCACGGCTGAGTGTGGGGGG + Intergenic
969071521 4:4543022-4543044 CTCAGGAGGCTGAGTCCGGGAGG - Intergenic
969700793 4:8766492-8766514 CTCAGAACACTGCCTGTGGGTGG - Intergenic
970009824 4:11446886-11446908 CTCAGGAGGCTGGACCTGGGAGG + Intergenic
970741407 4:19242123-19242145 CTCTGTAGGCTGAATGTTCGAGG + Intergenic
971582131 4:28355252-28355274 CCCAGAAGGTTGAATGGAGGAGG + Intergenic
971814609 4:31471041-31471063 CTCAGAAGGGTGAGAGTGGAAGG + Intergenic
972207354 4:36792045-36792067 TTCAGAAGGTGGAAGGTGGGAGG - Intergenic
972260581 4:37404471-37404493 ATCAGAAGGTTGACTGTGGATGG - Intronic
972490218 4:39580285-39580307 CTCAGGAGGCTTGAGGTGGGAGG - Intronic
972556675 4:40188634-40188656 CTCAGGAGGCTGAGGTTGGGAGG + Intergenic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
973327694 4:48880035-48880057 CTCGGAAGTATGTATGTGGGGGG + Intergenic
973603158 4:52561597-52561619 GTCAGAAGGCTGCTTGAGGGTGG - Intergenic
973937580 4:55863501-55863523 CTCAGGAGGCTGAGGTTGGGAGG + Intronic
974080021 4:57202546-57202568 CTCAGGAGGCTGAAGATGGGAGG + Intergenic
974236120 4:59183483-59183505 CTCAGGAGCCTGAATGCAGGAGG + Intergenic
974377080 4:61092675-61092697 CTCAGAAGCCAGAAGGAGGGTGG + Intergenic
974556325 4:63453530-63453552 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
975569525 4:75800053-75800075 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
978017922 4:103770733-103770755 CTTAGAAGGCTGCATGTGAAAGG + Intergenic
978772489 4:112471414-112471436 CTCAGAAGGCAGAAGGCAGGGGG + Intergenic
978942433 4:114452856-114452878 ATCAGATGGCTGTAGGTGGGTGG - Intergenic
979450916 4:120870212-120870234 CTCAGAAACCTTAATGTGGTTGG - Intronic
979533724 4:121796189-121796211 CTCAGAAGGCTGCATTTGCTTGG - Intergenic
980768947 4:137346386-137346408 TTCAGGAGGCTGAACGCGGGAGG + Intergenic
980848139 4:138348781-138348803 CACAGAAGGAGGAAGGTGGGAGG + Intergenic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981535385 4:145794577-145794599 CTCAGAAAGCTGAGGCTGGGCGG + Intronic
981907130 4:149934187-149934209 CTCAGAAGGTGGGAAGTGGGGGG + Intergenic
982027333 4:151263912-151263934 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
982109387 4:152040068-152040090 CTGAGAAGTCTGAATGTTAGGGG - Intergenic
982126411 4:152187750-152187772 CCCAGAAGGGTGAATGTGTTCGG + Intergenic
982404966 4:155009237-155009259 CTAACAAGGCTGAGGGTGGGTGG + Intergenic
982561844 4:156937589-156937611 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
982980849 4:162133052-162133074 CTCAGGAGGCTGAGTGAGGTAGG - Intronic
983088208 4:163473236-163473258 CTCAGAAGGCTCTGTGTGGGAGG - Exonic
983569302 4:169187299-169187321 CTCAGAAGGCTTGAGATGGGAGG - Intronic
984995908 4:185429776-185429798 CTCAGGAGGCTGAAGATGGGAGG - Intronic
985099095 4:186440207-186440229 CTCAGAAATCTGAATGCAGGGGG + Intronic
985368337 4:189258203-189258225 ATGTGAAGGCTGAATTTGGGTGG - Intergenic
985612194 5:896203-896225 CTCAGAAGGCTGGAGGTGGGAGG + Intronic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
987633822 5:20512595-20512617 CTCAGCTGGCTGAGTGTGGTGGG + Intronic
987790463 5:22559996-22560018 CTCAGAAAGCTGAATCTGAAAGG + Intronic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
989062960 5:37427777-37427799 CTCAGGAGACTGAACCTGGGAGG + Intronic
990259465 5:54005929-54005951 CTCAGGAGGCTGTAGCTGGGAGG + Intronic
991351828 5:65727273-65727295 CTCAGAAGGCTGAGGCAGGGAGG - Intronic
991408781 5:66326864-66326886 CTCAGGAGGCTGAGCCTGGGAGG + Intergenic
991907804 5:71529581-71529603 CTCAGAAGGCTGAGTGGGGAGGG + Intronic
993031533 5:82712293-82712315 CTCAGATGGCTTAATGTGTTTGG + Intergenic
993400974 5:87450789-87450811 CACAGGAGGCTGAGTGTGGTGGG - Intergenic
994570617 5:101508554-101508576 TTGAGTAGGCTGAAGGTGGGGGG - Intergenic
994775329 5:104031702-104031724 CTCAGAAGCCTGACAGTGAGTGG - Intergenic
995032182 5:107493374-107493396 CCCAGACTGCTGAATGTGTGCGG + Intronic
995223525 5:109677906-109677928 CTCAGGAGGCTGATAGTGGGAGG - Intergenic
995647195 5:114326321-114326343 GGCAGAAGGCTGAAAGTGGGAGG + Intergenic
996465443 5:123796579-123796601 CTCGGGAGGCTGAACCTGGGAGG + Intergenic
996739332 5:126784765-126784787 CTCAGGAGGCTGAGTGAGGCAGG - Intronic
997017224 5:129950054-129950076 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
998128172 5:139637988-139638010 CTCAGGAGGGTGAGGGTGGGGGG - Intergenic
998234845 5:140389731-140389753 ATCAGAAGGCTGATTGTGCATGG - Intergenic
998386116 5:141758027-141758049 CCCTGAAGGCTGAATGAAGGGGG + Intergenic
999575411 5:152971234-152971256 CTCAGAAGGAGGAGGGTGGGAGG + Intergenic
999636118 5:153624426-153624448 CTCTGATGGCTGCAGGTGGGTGG - Intronic
1000063241 5:157674375-157674397 TTCAGAAGGATGAATCTGGGAGG - Intronic
1000512326 5:162198752-162198774 CACAGATGGCTCAATATGGGGGG + Intergenic
1000856303 5:166402846-166402868 CTCAGAAGGCTGAAGCAGGAGGG - Intergenic
1000928511 5:167223339-167223361 CTGAGAAGGGTGTATGGGGGTGG - Intergenic
1001346887 5:170910734-170910756 ATCAGAACTCTGAATGTTGGAGG - Intronic
1003536999 6:6983948-6983970 CTCGGGAGGCTGAGGGTGGGAGG + Intergenic
1004126607 6:12880333-12880355 CTCAGGAGGCTAGAAGTGGGAGG - Intronic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1004955609 6:20724607-20724629 CTCAGGAGGCTGAGCCTGGGGGG + Intronic
1004973938 6:20943851-20943873 CTCAGAAGGCTTAAGGCAGGAGG + Intronic
1005757344 6:28936936-28936958 CTCAGGAGGCTTGAGGTGGGAGG - Intergenic
1006324567 6:33343777-33343799 CTCAGGAGGCTGACTGAGGCAGG + Intergenic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006536224 6:34701138-34701160 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1006698587 6:35953179-35953201 CTCTGAAGGCTGAAAGTGAAAGG + Intronic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1007678690 6:43619254-43619276 CTCAGGAGGCTGAGGTTGGGAGG + Intronic
1008091510 6:47298335-47298357 CTCAGGAGGCTGAGTGAGGTAGG + Intronic
1008534739 6:52499244-52499266 CTCGGAAGGCAGAGTGAGGGAGG + Exonic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1009898578 6:69783480-69783502 CTTGGAAGCCTGAAGGTGGGAGG - Intronic
1011846209 6:91566023-91566045 ATCAGAGGGCTGTAGGTGGGTGG - Intergenic
1012166167 6:95955211-95955233 CTCAGAGGGTGGAAGGTGGGAGG + Intergenic
1012643305 6:101649856-101649878 TGCAGAAGGGTGAAAGTGGGTGG + Intronic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1013136738 6:107289585-107289607 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
1013468391 6:110438013-110438035 ATCAGAAACCTGAATGAGGGAGG - Intronic
1014166190 6:118227787-118227809 TTGAGAAGGCTTCATGTGGGAGG + Intronic
1014791812 6:125681103-125681125 GCCAGATGGCTGAATGTGGATGG + Intergenic
1015004229 6:128258859-128258881 ATCAGAAAGCTGAATGAGGGAGG + Intronic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016975824 6:149806696-149806718 CTCAGAAGGCTGAGGCAGGGGGG - Intronic
1016983285 6:149873336-149873358 CTCAGGAGGCTAAAAATGGGAGG - Intergenic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1019337018 7:490222-490244 CTCAGAAGGCTGAGGCTGGAAGG + Intergenic
1020226705 7:6285987-6286009 CTCGGGAGGCTGGAGGTGGGAGG - Intergenic
1020446579 7:8275306-8275328 AGGAGGAGGCTGAATGTGGGGGG - Intergenic
1020746655 7:12087916-12087938 CTCAGAATGGTGAGTGTGGATGG - Intergenic
1021588475 7:22235769-22235791 CTCCCAGGGCTGAATGTGGTTGG - Intronic
1021748434 7:23768548-23768570 CTCAGAAGGGTGATTAGGGGTGG + Intronic
1023154594 7:37235828-37235850 CTCAGAAGGCTGAACCCAGGAGG + Intronic
1023247157 7:38217313-38217335 CTCAGGAGGCTGACTTTGAGAGG - Intronic
1023385124 7:39648949-39648971 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026265038 7:68788792-68788814 CTCAGAAGTCTGGAGGTGGGAGG + Intergenic
1026989814 7:74578291-74578313 CTCGGAAGGCTGAGTGAGGCAGG - Intronic
1027380048 7:77598117-77598139 CTCAGAAGGCTGAGCCCGGGAGG + Intronic
1027515099 7:79132294-79132316 CTCAGAAGGGGGAGAGTGGGAGG - Intronic
1027609712 7:80345466-80345488 CTCAGAAGGTGGAGGGTGGGAGG + Intergenic
1029062208 7:97810308-97810330 CTGAGAAGGGTGTATGGGGGAGG + Intergenic
1029497372 7:100903291-100903313 CTCAGGAGGCTGAAGGCAGGAGG - Intergenic
1029532919 7:101137333-101137355 CTCATCAGGCTGGATGTGGGTGG - Intronic
1029895279 7:103976942-103976964 CTCAGGAGGCTGAGGTTGGGAGG + Intronic
1031601242 7:123713258-123713280 CTCAGAAGGCTGAGTGAGGTAGG - Intronic
1032142859 7:129349538-129349560 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1032873745 7:136014469-136014491 CTCAGGAGGCTGAGATTGGGAGG - Intergenic
1033038869 7:137900200-137900222 CTCTGGAGCCTGGATGTGGGAGG - Intronic
1033723798 7:144090678-144090700 ATCAGAAGGCAGAAGGTGAGAGG - Intergenic
1033943001 7:146679155-146679177 ATCAGAAGGCTGAGGGTGGGAGG - Intronic
1035130411 7:156647345-156647367 CTCAGGAGGCGGAGGGTGGGAGG - Intronic
1035433647 7:158841317-158841339 CTCAGGAGGCTGAGTGAGGTGGG - Intergenic
1035830127 8:2686697-2686719 CTCAGGAGGCTGAACCTGGGAGG + Intergenic
1036560212 8:9895474-9895496 CTCAGGAGGCTAAGTGTGGGAGG - Intergenic
1036674084 8:10815046-10815068 CTCAGGAGGCTGGAGATGGGAGG - Intronic
1037322798 8:17659584-17659606 CTCAGCAGGCTGAGTGAGGCAGG + Intronic
1037871440 8:22501048-22501070 CTCAGGAGGCTGATTGAGGTGGG + Intronic
1038401338 8:27287089-27287111 GTCAGAAGGCGGAAGGAGGGAGG - Exonic
1038977792 8:32720347-32720369 CTCACCAGGCTAAATGTGGAAGG - Intronic
1039214473 8:35254076-35254098 AGCACAAGGCTGAATGTGAGAGG - Intronic
1039828654 8:41195474-41195496 CTCAGAAGGATGAGCCTGGGTGG - Intergenic
1039859816 8:41447479-41447501 GTCACAAGGCTGGATGTGGAAGG - Intergenic
1039982629 8:42421271-42421293 CTCAGGAGGCTGAAGGTACGAGG - Intronic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1041112067 8:54492785-54492807 CTCAGGAGGCTGAGCTTGGGAGG - Intergenic
1041245384 8:55884206-55884228 CTCAGAAGGCTGAGGCAGGGAGG - Intronic
1041254619 8:55969162-55969184 CACAGGAGGCTGAAAGTGGGAGG + Intronic
1042690514 8:71492909-71492931 ATCAGAAGGTGGAATGTGGAAGG - Intronic
1042958897 8:74281737-74281759 CACAGAAGTATGAATGTGAGGGG - Intronic
1043293370 8:78632622-78632644 CTCAGAAGGGAGATTTTGGGGGG + Intergenic
1044205552 8:89488855-89488877 GTCAGAAGGTAGACTGTGGGAGG - Intergenic
1044533701 8:93336856-93336878 CTCACAAGGGTGGATCTGGGTGG - Intergenic
1044555626 8:93559092-93559114 CTCATAGGGCTGAATATGGTTGG - Intergenic
1044858577 8:96499337-96499359 ATCAGAAACCTGAATGGGGGTGG + Intronic
1045075714 8:98564958-98564980 CAGGGAAGACTGAATGTGGGTGG + Intronic
1045403523 8:101842458-101842480 CTAACAAGTCTGAATATGGGTGG + Intronic
1046302037 8:112307387-112307409 CTCAGGAGGCTGAAGGTAGGAGG - Intronic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047115876 8:121841504-121841526 CTCAGAAGACAGAAAGAGGGGGG + Intergenic
1047363695 8:124193044-124193066 CCCAGAAGACTGAATGTAAGAGG - Intergenic
1047954673 8:129964774-129964796 CTCAGGAGGCTGAGCCTGGGAGG + Intronic
1048786961 8:138060841-138060863 GACAAAAGGCTGAATGTGGGGGG + Intergenic
1049562179 8:143317350-143317372 CTCAGACAGCTGAGGGTGGGAGG + Intronic
1049977822 9:876637-876659 CTCAGGAGGCTGAGTGGGGAAGG - Intronic
1050732854 9:8729063-8729085 TTCAGAAAGCTGAAGGTAGGGGG - Intronic
1051284690 9:15484018-15484040 CTCAGGAGGCTGAGTGAGGCAGG + Intronic
1051308494 9:15742880-15742902 CTCAAGAGGGTGAAGGTGGGAGG - Intronic
1052484172 9:29074773-29074795 CTCGGGAGGCTGAACCTGGGAGG - Intergenic
1052735746 9:32340706-32340728 CACAGAAAGGTGAATGTGGAGGG - Intergenic
1053099761 9:35361855-35361877 CCCAGTAGGCTGGGTGTGGGAGG + Intronic
1053103573 9:35391484-35391506 CTCAGATGCTTGAATGTGTGAGG + Intronic
1053482552 9:38426565-38426587 CTCAGGAGGCTGAGTGGGGGAGG - Intergenic
1053689459 9:40576172-40576194 CTGATAAGGCTGGATATGGGAGG - Intergenic
1054274572 9:63054885-63054907 CTGATAAGGCTGGATATGGGAGG + Intergenic
1054300704 9:63377111-63377133 CTGATAAGGCTGGATATGGGAGG - Intergenic
1054400252 9:64710044-64710066 CTGATAAGGCTGGATATGGGAGG - Intergenic
1054433843 9:65194302-65194324 CTGATAAGGCTGGATATGGGAGG - Intergenic
1054496543 9:65827368-65827390 CTGATAAGGCTGGATATGGGAGG + Intergenic
1054912666 9:70468136-70468158 CTCAGGAAGCTGAATGAGGCAGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055411529 9:76034996-76035018 CCCAGAAGGCTGACTTTGAGGGG + Intronic
1055748850 9:79481718-79481740 CTCAGAAGACTTAAGCTGGGAGG + Intergenic
1056405644 9:86271822-86271844 TACACAATGCTGAATGTGGGTGG - Intronic
1056428031 9:86497997-86498019 CTCGGGAGGCTGAACCTGGGAGG + Intergenic
1056580861 9:87887368-87887390 CCCACAAGGCTGCATGTTGGGGG - Exonic
1057514747 9:95711681-95711703 CTCAGAAGCCTGAAGGAGCGAGG + Intergenic
1058136715 9:101315886-101315908 CCCATGAGGCGGAATGTGGGAGG + Intronic
1058845723 9:108957227-108957249 CTCAGGAGGTGGAAGGTGGGAGG - Intronic
1060316486 9:122516259-122516281 ATCAAGAGGCTGAATGTGGTGGG + Intergenic
1061162304 9:128902395-128902417 CTCAGAAGGAGGAGTCTGGGTGG + Intronic
1061221210 9:129253319-129253341 CACAGAAGGCTGCTTGTGGCCGG + Intergenic
1061394739 9:130337789-130337811 CTCAGAAGGCTTCCTGGGGGAGG + Intronic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1061979815 9:134095527-134095549 CTCAGGAGGCTGAGGTTGGGAGG + Intergenic
1062306564 9:135910515-135910537 CTCAGGAGGCTTGAGGTGGGAGG - Intergenic
1185643883 X:1603394-1603416 CTCAGAAGTCTGCATCTGGCCGG + Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186117085 X:6316033-6316055 CTCAGAAAACTGAATGAGGGGGG - Intergenic
1186273498 X:7915893-7915915 TTCACAAGGCTAAATGTGAGAGG + Intronic
1186627894 X:11314782-11314804 CTCAGAAGGTAGAGGGTGGGAGG + Intronic
1186881602 X:13872276-13872298 CGTGGAAGGCTGAAGGTGGGAGG - Intronic
1186976979 X:14917914-14917936 CTGAGAAGGCTGAAAGTGCGGGG + Intronic
1187376565 X:18760717-18760739 CTCAGGAGGCTGACTGAGGTGGG - Intronic
1187771288 X:22699723-22699745 CTCAGAAGGAAGAATGTGGTGGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189464428 X:41267633-41267655 CTCAGGAGGCTGGAAATGGGAGG + Intergenic
1189767894 X:44390890-44390912 CTCAGGAGGCTGAGTTAGGGAGG - Intergenic
1190052882 X:47164430-47164452 CTCGGGAGGCTGAACCTGGGAGG + Intronic
1190737296 X:53264068-53264090 ATCACAAGGCTGGGTGTGGGTGG - Intronic
1190913329 X:54791272-54791294 TTTAGGAGGCTGAATGAGGGAGG - Intronic
1191146422 X:57170585-57170607 CTCAGAAGGCAGAGTGTAGAAGG - Intergenic
1191902049 X:66051687-66051709 CTCTGGAGGCTGAACCTGGGAGG + Intergenic
1192314891 X:70043818-70043840 CTCAAGAGGCTCAATGTGGATGG + Intronic
1193964368 X:87966578-87966600 CTCATAAGGGAGAAGGTGGGAGG + Intergenic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1194597339 X:95874665-95874687 CTCAGAAGGGAGAGGGTGGGAGG + Intergenic
1194752163 X:97697238-97697260 ACTAGAAGGATGAATGTGGGGGG - Intergenic
1194839087 X:98716113-98716135 AGCAGAAGGCAGAATGGGGGAGG - Intergenic
1195335423 X:103848799-103848821 CTCGGAAGGCTGAGTGAGGCAGG - Intergenic
1196849385 X:119923268-119923290 GTCAGAAGAGTGAATGGGGGAGG - Intergenic
1196979835 X:121200049-121200071 CTCAGAAGGGGAAATGTAGGAGG - Intergenic
1198012237 X:132569116-132569138 ATCTGAAGGCTGAATCTGGAAGG + Intergenic
1198780489 X:140229908-140229930 CTCAGGAGGCTGAGGGTGGGAGG - Intergenic
1199369746 X:147033647-147033669 CTCAAGAGGCTGAAGGGGGGAGG + Intergenic
1199711172 X:150470642-150470664 CTCTGGGGGCTGAATGGGGGTGG - Exonic
1199881792 X:151979313-151979335 CTCTGAGGGGTGAATGTGTGAGG + Intergenic
1200205244 X:154310872-154310894 CTCAGAAGGCTCTGTCTGGGAGG + Exonic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1201247637 Y:12021571-12021593 CTCAGGAGGCTGAGTGAGGCAGG - Intergenic
1201362231 Y:13164877-13164899 CTCAGAGGCCTGACAGTGGGAGG + Intergenic
1201513659 Y:14792680-14792702 CTCAGGAGGCTTGAGGTGGGAGG + Intronic
1201579112 Y:15492569-15492591 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1201940672 Y:19455782-19455804 CTCCAGAGGCTGATTGTGGGAGG + Intergenic
1202340863 Y:23865364-23865386 CTCAGAAGTCAGAAGGTGGTGGG - Intergenic
1202529903 Y:25804722-25804744 CTCAGAAGTCAGAAGGTGGTGGG + Intergenic