ID: 1151358196

View in Genome Browser
Species Human (GRCh38)
Location 17:73572490-73572512
Sequence CTGGGTGATAAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151358196 Original CRISPR CTGGGTGATAAGAGGGAGGC TGG (reversed) Intronic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901919823 1:12528069-12528091 CTGGATGACAGGAGGGAGCCAGG + Intergenic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902411272 1:16212762-16212784 CTGGGGTACAAGAGGGGGGCTGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903626118 1:24731303-24731325 ATGGGTGATAGGAGTGGGGCAGG + Intergenic
904471940 1:30741548-30741570 CTGGGTGCTGAGAGGGTGGGAGG - Intronic
904828250 1:33289457-33289479 CTGGGAGTCAAGGGGGAGGCCGG + Intronic
904847660 1:33432286-33432308 CTGGGTGACAAGAGCGAGATCGG - Intergenic
905101830 1:35531007-35531029 GTGGGAGACAAGAGGGAGGCAGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
905939576 1:41852474-41852496 CCTGGTCATAAGAGGGAAGCTGG - Intronic
905974481 1:42164865-42164887 CTAGGAGATAAGAGCCAGGCAGG + Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906692969 1:47804900-47804922 CTGGTTGATGTAAGGGAGGCAGG + Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
907581586 1:55577197-55577219 CTGGGTGATAAGCGGCAGGATGG - Intergenic
909662114 1:78095745-78095767 CTGGGTGGTAAGAGAGAAGCTGG - Intronic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
915512373 1:156393155-156393177 GTGGGGGTTGAGAGGGAGGCTGG - Intergenic
917044096 1:170837654-170837676 TTGGGGGATAAGGGGGAGGCGGG - Intergenic
917639389 1:176968475-176968497 CTGGGTGGGAAGTGGGAGGTGGG - Intronic
919973286 1:202594464-202594486 ATGGGTGAGAAGAGTGAGTCTGG + Exonic
920004768 1:202825063-202825085 GTGGGAAATAAGAGGGAGGAAGG + Intronic
920243174 1:204568634-204568656 CTGGTTGATGAAAGGGAGACAGG + Intergenic
920495924 1:206454855-206454877 CTGGGGGAGAAGGGGCAGGCAGG - Intronic
921655183 1:217726446-217726468 CTTGGGGATAAAAGGGATGCAGG - Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923047668 1:230367399-230367421 CTGAGTGATAAAAAGGATGCTGG + Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
1063365049 10:5485632-5485654 CTCGGTGACAAGACGGAGCCAGG + Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1065417629 10:25505679-25505701 GAGGGTGCTAACAGGGAGGCTGG - Intronic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068564266 10:58554123-58554145 TTGGGTGATAGGTGGAAGGCAGG + Intronic
1069303021 10:66932106-66932128 CTGGCTGAAAAGGGGGAGGGAGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073626359 10:105101819-105101841 CTGGCTGGTAAGAAGGAAGCAGG + Intronic
1074542139 10:114373846-114373868 CTGGGGGATAAGGGGTTGGCAGG - Intronic
1074724756 10:116296654-116296676 CTGGGTAATAAGAGGATGGCCGG - Intergenic
1074974575 10:118569694-118569716 CTTGCTGGTAAGAAGGAGGCTGG + Intergenic
1075196370 10:120362776-120362798 CTGGGTGATCAGAGAGTGACTGG - Intergenic
1075634340 10:124020048-124020070 CGGGGAGAGAAGATGGAGGCTGG - Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075904400 10:126068386-126068408 CTGGGTGATTTGAGAGAGGGGGG - Intronic
1076727947 10:132422022-132422044 CTGAGAGATGAGAGGGCGGCGGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077404855 11:2378280-2378302 CTGGGTGAGGAGAGGGAGATCGG - Intronic
1077464763 11:2728451-2728473 CTTGGTGACAAGAGCTAGGCTGG + Intronic
1077717991 11:4600533-4600555 CTGGGTGATAAGGCTGAGGAAGG - Exonic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1080484479 11:32691067-32691089 CTGGGGGACAAGAGTGAGACTGG - Intronic
1080575725 11:33597568-33597590 GTGGGAGACAAGCGGGAGGCAGG - Intronic
1081671990 11:44947563-44947585 CTGGGTGAGTTGGGGGAGGCAGG + Intronic
1082079438 11:48000707-48000729 CTGAGTGATAAGAAGGAGCGAGG - Intronic
1082700575 11:56424837-56424859 CTCAGTGATAAGTGGGAAGCTGG - Intergenic
1083633227 11:64106321-64106343 GTGGTAGAGAAGAGGGAGGCTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084375728 11:68776101-68776123 CTGAGTGAAAAGAAGCAGGCAGG + Intronic
1084748948 11:71191267-71191289 CTGTGTGTTATGAGGGAGACAGG + Intronic
1084898926 11:72295257-72295279 TTGGGTGATAAGAGGGCTCCAGG - Intronic
1085135919 11:74087973-74087995 CTGGCAGGTAAGATGGAGGCTGG + Intronic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1088223116 11:107590768-107590790 CTCGGTGAGACGAGGGAGGTTGG + Intergenic
1088912987 11:114206059-114206081 CTGGATGTCAAGAGGGAGCCTGG + Intronic
1088927355 11:114315865-114315887 CAGGGTGCTAAGGGGGAGGATGG + Intergenic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090415908 11:126540421-126540443 CTGGGAGAGAAGTGCGAGGCTGG - Intronic
1090636586 11:128693749-128693771 CTGGGAGATAAGAGCTAGCCGGG - Exonic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1092194581 12:6541523-6541545 CTGGGTGATGAGCCGGCGGCAGG + Exonic
1095864226 12:46954183-46954205 CTGGGTAATAAGAGGGATTTTGG - Intergenic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096795854 12:54077163-54077185 CTGGGAGATAACATGGCGGCTGG - Intergenic
1096879656 12:54657548-54657570 CTGGCTGATACTAGGGAGACGGG + Intergenic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1101292673 12:103387563-103387585 CTGGTTGACAAGAGGGATGTTGG - Intronic
1101758187 12:107637956-107637978 ATAGGTGAGCAGAGGGAGGCAGG + Intronic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1101931176 12:109015471-109015493 CTGGGTGTTAAGTTGAAGGCAGG + Intronic
1102262992 12:111456386-111456408 CAGGGTGGTAAGAGCAAGGCTGG + Intronic
1102783094 12:115582664-115582686 ATGAATTATAAGAGGGAGGCTGG + Intergenic
1102880377 12:116480651-116480673 CAGGGTGGCAAGAGGAAGGCAGG - Intergenic
1103344772 12:120241866-120241888 AGGGGAGATCAGAGGGAGGCAGG + Intronic
1103741661 12:123095515-123095537 CTGGGTGACAGGTCGGAGGCGGG - Intronic
1103910813 12:124351089-124351111 CTGGCTAATAAGGGGCAGGCGGG + Intronic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1108094377 13:46885291-46885313 CTGGGTAATACGAGGCAGGATGG + Intronic
1108811682 13:54232664-54232686 CTCGGTTATAGGAGGGAAGCCGG - Intergenic
1113119128 13:106907568-106907590 CTGGGAGATAAAAGACAGGCTGG + Intergenic
1113605296 13:111600454-111600476 GTGGGAGACATGAGGGAGGCAGG - Intronic
1114482298 14:23043342-23043364 CTTGGTGCCAAGAAGGAGGCTGG - Exonic
1114696442 14:24631412-24631434 CTGGGGGACATGACGGAGGCTGG - Intronic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1122080380 14:99263007-99263029 AATGGAGATAAGAGGGAGGCTGG + Intronic
1122396426 14:101435965-101435987 CTGGGTGGCAACAGCGAGGCAGG - Intergenic
1122546206 14:102524212-102524234 CTGAGTGATGAAAGGGGGGCTGG + Intergenic
1122705301 14:103617117-103617139 CTGGGTGATTAGAGAGGGCCGGG - Intronic
1123465591 15:20512549-20512571 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1123652525 15:22488488-22488510 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1123742947 15:23297347-23297369 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1124276313 15:28328528-28328550 ATGGGTGAATAGAGGGAGCCAGG + Intergenic
1124306385 15:28583079-28583101 ATGGGTGAATAGAGGGAGCCAGG - Intergenic
1125420031 15:39496185-39496207 CTGGGTGAGAAATAGGAGGCTGG - Intergenic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1126683680 15:51228303-51228325 CTGGATGATACCTGGGAGGCTGG - Intronic
1126817310 15:52466537-52466559 CTGGGGTGTAAGAGGGAAGCAGG + Intronic
1127124884 15:55802277-55802299 CTGGCTGACAAGTGGGAGGAGGG - Intergenic
1127728926 15:61780219-61780241 CTGGGTGGTAGGGAGGAGGCTGG + Intergenic
1128498221 15:68210302-68210324 GTGGGTGAGAAGAGGCAGGCGGG - Intronic
1129426458 15:75467040-75467062 CTGGGAGGGATGAGGGAGGCAGG - Exonic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1130193956 15:81761627-81761649 CTGAGTGAGAAGTGGAAGGCGGG - Intergenic
1131636363 15:94236945-94236967 GTGGGTGATGAGAGAGAGGGAGG + Intronic
1132676771 16:1124294-1124316 AGGGGAGAGAAGAGGGAGGCTGG + Intergenic
1133063175 16:3188557-3188579 GTGAGTGAGAGGAGGGAGGCGGG + Intergenic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1136071790 16:27791832-27791854 CTGGGTGGTAGGAGGATGGCTGG - Intronic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136547904 16:30965769-30965791 CTGGGTGGGAGGAGGTAGGCAGG - Exonic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1137652664 16:50133885-50133907 CTGGCTGATGAGGGGGTGGCTGG + Intergenic
1138310159 16:56016736-56016758 GTAGGTGATTAGAGGGAGACAGG - Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1141713928 16:85716327-85716349 TTGGGGGAGAAGAGGGAGGGAGG + Intronic
1141988373 16:87594565-87594587 TGGGGTGACAACAGGGAGGCAGG + Intergenic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142116248 16:88357564-88357586 CTGGGTGCTAGCAGGCAGGCGGG + Intergenic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1144206126 17:12980638-12980660 CAGGGTGACAGGAGGGAGTCAGG + Intronic
1144805683 17:17965380-17965402 CTGGATGTTAAGAGGTAGGCGGG - Intronic
1145973073 17:28968307-28968329 CTGGGAGCTGAGAAGGAGGCAGG + Intronic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1147452351 17:40513581-40513603 CTGGGTGATAAAAGTCAGGAAGG - Intergenic
1147758480 17:42782948-42782970 GTGGGTGGGGAGAGGGAGGCTGG + Intronic
1148193696 17:45698275-45698297 CGAGGTGATTAGAGGGAGGTGGG - Intergenic
1148237343 17:45977694-45977716 CTACTTGGTAAGAGGGAGGCTGG - Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151325759 17:73379091-73379113 GTGAGTGATATGTGGGAGGCAGG - Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1152115351 17:78383193-78383215 CTGAGTTATAAGAGGGAAACAGG + Intronic
1152498913 17:80695153-80695175 CATGGTGGTAAGAGTGAGGCGGG + Intronic
1152623901 17:81379706-81379728 CCTGCTGGTAAGAGGGAGGCAGG - Intergenic
1152729256 17:81961636-81961658 CTGGGGGATGAGAGGGACACTGG - Intronic
1152757248 17:82092162-82092184 TTGGGTGGGAAGAGCGAGGCAGG - Intronic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1154485014 18:14866360-14866382 CTGAGTGGTAGGAGGGGGGCTGG + Intergenic
1154491072 18:14922745-14922767 CTGGTGGATAAGAGGGACACAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156511721 18:37642358-37642380 CTGGTTGCTAAGATAGAGGCTGG + Intergenic
1156998678 18:43498521-43498543 TTGAGTGATGAGAGGGTGGCTGG - Intergenic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1158680289 18:59560723-59560745 CTGGCTCATAAGAGTGTGGCAGG + Intronic
1158828518 18:61251887-61251909 CTGGGAGACAGCAGGGAGGCTGG - Intergenic
1158930411 18:62319672-62319694 CTGGGAGATAAGTGTGAGACTGG + Intergenic
1160266713 18:77344766-77344788 TGGTGTGATAGGAGGGAGGCTGG - Intergenic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160341592 18:78094054-78094076 GTGAGTGATAAGAGTGATGCAGG + Intergenic
1160883576 19:1334137-1334159 CTGGGGGGCAAGAGAGAGGCTGG + Intergenic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1162854894 19:13460686-13460708 TTGGGGAATAAAAGGGAGGCCGG - Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1163370691 19:16899696-16899718 CTGGGTGCTGAGAGGCTGGCAGG - Intronic
1163554317 19:17983694-17983716 CTGGGGGACATGCGGGAGGCGGG - Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166977142 19:46611297-46611319 CCGGGTGAAGAGAGGAAGGCAGG + Intergenic
1167103210 19:47416703-47416725 CTGGGAGGGAAGAGAGAGGCCGG + Intronic
1167201519 19:48068678-48068700 CTGAGTGATACAAGTGAGGCTGG - Intronic
1167288859 19:48613857-48613879 TTGGGTGATTAGAGACAGGCAGG - Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168104963 19:54160937-54160959 CTGGGTGGTCTCAGGGAGGCTGG + Exonic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
925421485 2:3716315-3716337 CTGGGTGATGAGAGACAGGGTGG + Intronic
925462681 2:4077313-4077335 GTGGGTGATAAGAGGGGAGGTGG - Intergenic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
930418699 2:51121770-51121792 TTGGGTGATGACAGGGTGGCTGG - Intergenic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
934116943 2:88807616-88807638 CTGGGACAGATGAGGGAGGCAGG - Intergenic
935567199 2:104621297-104621319 CTGGGGGAGAACAGGGAAGCCGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
937098513 2:119250990-119251012 GTGGGTGGTCGGAGGGAGGCAGG + Intronic
937273351 2:120669317-120669339 CTGGGGGAGAAGCAGGAGGCGGG + Intergenic
937679899 2:124632897-124632919 CTGGGGGAAGAGAGGCAGGCAGG + Intronic
937685116 2:124687264-124687286 CTGCATTATAAGAGGGAGTCTGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
940887455 2:159001921-159001943 CTGGGTGAAAAGAGGAGGGTTGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943661396 2:190563198-190563220 GTGGGTGATGAGTGGGTGGCAGG - Intergenic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945957260 2:216098034-216098056 GTAGGAGATAAGAGGGAGGATGG + Intronic
946001995 2:216490093-216490115 CTTGGTGAGAAGTGGGAGGATGG - Intergenic
946127046 2:217572152-217572174 CTGGGGAATAAAAGGGGGGCAGG - Intronic
946209757 2:218137989-218138011 CTAGGGGAAAACAGGGAGGCAGG + Intergenic
946775538 2:223136342-223136364 CTTTGTGAGAAGATGGAGGCTGG + Intronic
947110171 2:226709789-226709811 TTGGGTGATAGAAGGCAGGCTGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948133833 2:235621044-235621066 CTGGGAGACAAGAGCGAGACTGG - Intronic
949028532 2:241777424-241777446 CTGGGTGGTGACGGGGAGGCTGG + Intronic
1169213259 20:3779096-3779118 CTGGGTGATAAGTGTGGGGGAGG - Intronic
1169260736 20:4136244-4136266 CGGAGCGATAAGTGGGAGGCAGG + Intronic
1169313840 20:4571515-4571537 TTGGCTGAAAAGTGGGAGGCGGG + Intergenic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1173396743 20:42687431-42687453 TTGGGGGATAAGGGGGAGCCGGG - Intronic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1173938718 20:46891819-46891841 CTGAGAGATAAGCAGGAGGCAGG - Intergenic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1174765486 20:53249728-53249750 GTGGGTGATGAGAGAGGGGCAGG + Intronic
1175239018 20:57533084-57533106 AGGGTTGATAAAAGGGAGGCAGG + Intergenic
1175304861 20:57969021-57969043 CTGGAGGATAAAAGGGAGGGTGG + Intergenic
1175369998 20:58481764-58481786 CTGGGTGGAACGAGGGAGGCTGG - Intronic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175703341 20:61156616-61156638 GGGACTGATAAGAGGGAGGCAGG + Intergenic
1175734069 20:61373169-61373191 CTGGGTGTTGAGACGGGGGCGGG - Intronic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1176723788 21:10413788-10413810 CTGAGTGGTAGGAGGGTGGCTGG + Intergenic
1177403234 21:20633557-20633579 CTGAGAGGTAAGAGAGAGGCAGG - Intergenic
1178286470 21:31329432-31329454 AAGGGTGATAAGACTGAGGCAGG + Intronic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179883948 21:44305529-44305551 ATGGGTGCTGGGAGGGAGGCAGG + Intronic
1181063201 22:20291832-20291854 GTGTGTGTGAAGAGGGAGGCAGG - Intergenic
1181530595 22:23514900-23514922 CTGGGTTAAAACAGGAAGGCTGG + Intergenic
1181624537 22:24114304-24114326 CTGGGAGATCACAGGCAGGCTGG + Intronic
1181637658 22:24181803-24181825 CTGGTAGCTAGGAGGGAGGCGGG + Intronic
1183057346 22:35315117-35315139 ATGGGTGGGAGGAGGGAGGCAGG + Intronic
1183432153 22:37772419-37772441 CTGGGTGGTACCAGGGAGGTGGG + Intronic
1183781302 22:40000752-40000774 ATGGGAGAAAAGAGGGAGGCAGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
1185116506 22:48941207-48941229 CTGTGGGATATGAGGCAGGCAGG - Intergenic
1185221088 22:49629612-49629634 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221098 22:49629644-49629666 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221109 22:49629676-49629698 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221119 22:49629708-49629730 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221140 22:49629772-49629794 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221151 22:49629804-49629826 CTGGGTTGGAACAGGGAGGCTGG + Intronic
950040061 3:9914615-9914637 GGGGGAGGTAAGAGGGAGGCTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951206813 3:19934166-19934188 CTAGGTGTTAAGAGGCAGGCAGG - Exonic
954377956 3:50204841-50204863 CTGGTTGGGAAGGGGGAGGCAGG + Intergenic
954642796 3:52111832-52111854 CAGGGTGAGAAGTGGGAGACAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955605339 3:60695710-60695732 CTGGGTAAGAACAGGGACGCTGG + Intronic
956821951 3:72961981-72962003 GTGTGTGATACTAGGGAGGCAGG + Intronic
956994752 3:74812398-74812420 CTGAGGGATAAGAAGGAAGCTGG - Intergenic
958797284 3:98719171-98719193 CTGGGTGACAAGAGTGAAACTGG - Intergenic
959817951 3:110698093-110698115 ATTGTTGCTAAGAGGGAGGCGGG - Intergenic
960561062 3:119084552-119084574 CTGGGAGATTAGAGGGAGATGGG - Intronic
960875639 3:122292574-122292596 CTTGGTGCTAAGTGGAAGGCAGG - Intergenic
961539635 3:127590749-127590771 CTGAGTGATAACAGGGACTCTGG - Exonic
961570620 3:127795858-127795880 CTGGGTGATAAGATTGTGGATGG - Intronic
961604440 3:128083227-128083249 CTGAGTGATAAGGGGCAGCCAGG + Intronic
962247299 3:133806172-133806194 CTGGGCGTTAAGGGGGATGCCGG + Intronic
962316833 3:134364357-134364379 GTGGGTGAGAAGAGGGGGGCCGG - Intronic
964300955 3:155284462-155284484 CTGGGTGCTAAGTGAGAAGCTGG + Intergenic
965520896 3:169667426-169667448 CTGGGTGACCAGAGCTAGGCAGG + Intergenic
965946987 3:174255085-174255107 CTGGGTGTTTAGAGGAAGGTAGG + Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
969036929 4:4261922-4261944 CTGGGTGAAAATAGAGTGGCAGG + Intergenic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969462675 4:7337032-7337054 GTGGCTGAGAAGAGAGAGGCTGG + Intronic
969695206 4:8730329-8730351 CTCTGTGATCAGAGAGAGGCCGG + Intergenic
970488124 4:16544643-16544665 CTGGGAGATAAGAGGGAGTGAGG + Intronic
971136616 4:23875642-23875664 CTGGGTGATAAAAGAGAAGAAGG - Intronic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
974478952 4:62420099-62420121 CTGGGTGATGATGGGGTGGCTGG + Intergenic
976126454 4:81838276-81838298 CTGGATGATAGCAGGGAGGAGGG + Intronic
976612963 4:87048701-87048723 CTGGTTTAGAAGAGGGAGGTTGG + Intronic
978231115 4:106401140-106401162 CTGGGTGGTAAGTTGGAGCCAGG + Intergenic
978682797 4:111402669-111402691 CTGGATGACAAGAGGGTGACTGG + Intergenic
986165869 5:5271138-5271160 CTGGGTGCTGAGGAGGAGGCTGG - Intronic
986517687 5:8581073-8581095 GTGAATGTTAAGAGGGAGGCAGG - Intergenic
987008733 5:13738170-13738192 ATGGGTGATTAAAGGGATGCTGG - Intronic
987065763 5:14288328-14288350 CTGGGTGGGGAGAGAGAGGCTGG - Intronic
989455946 5:41644509-41644531 GTGGGTGAAAAGTGGGAGGAGGG + Intergenic
989531251 5:42510621-42510643 TTGGGAGATAACAGGAAGGCAGG + Intronic
991705489 5:69354067-69354089 TTGGGTGGTGAGGGGGAGGCAGG - Intronic
992775398 5:80084532-80084554 CTGGGCAATGAGAGTGAGGCTGG + Intergenic
993044630 5:82853474-82853496 ATGGGTGATTGGAAGGAGGCAGG - Intergenic
994722297 5:103394080-103394102 CTGGGTGAAAAGAGATGGGCAGG + Intergenic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
999837449 5:155389811-155389833 CACTGTGATAAGTGGGAGGCTGG - Intergenic
1000686760 5:164259379-164259401 CTGGTTGAGAAGATAGAGGCTGG - Intergenic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1002061537 5:176628644-176628666 CTGAGTAATAAGAGGGGGGCAGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1005441624 6:25875381-25875403 CTGGCTGAGAAGTGGGAGCCTGG + Intronic
1005875097 6:30005300-30005322 CTGAGTGATAAGAGGGACGGAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006024762 6:31139734-31139756 CTGGGTGGGAAGAGGGAACCAGG - Exonic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006101671 6:31689555-31689577 GTGGGGGATGGGAGGGAGGCTGG + Intronic
1006682629 6:35808088-35808110 CTGTATGATAAGAGAGAGGCCGG + Intronic
1006991783 6:38221354-38221376 CTGGGTGATTACAGGAAAGCAGG - Intronic
1007688130 6:43679623-43679645 GTGGGTTATGAGAGTGAGGCTGG + Intronic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1008435085 6:51466615-51466637 CGGAGGGATAAGAGGGAGGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1016144399 6:140650198-140650220 TTGGGTGATGACAGGGTGGCTGG - Intergenic
1017122809 6:151040029-151040051 CTTAGGGATAAGAGGGCGGCTGG + Intronic
1018910472 6:168098510-168098532 CTGGGTGATAAGTGTGGGGCTGG + Intergenic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019478628 7:1255956-1255978 CTGGCAGATCAGAGGCAGGCGGG + Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1026342770 7:69448253-69448275 CTGCGTGATCAGAGCGAGCCAGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026941655 7:74290619-74290641 CTGGGTGAGAAGTGGGGGTCTGG + Intronic
1028842103 7:95439811-95439833 CTGGGAGAAAAGAGGGGAGCAGG + Intergenic
1030174130 7:106632801-106632823 GGGCCTGATAAGAGGGAGGCCGG - Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032715236 7:134503520-134503542 CTGAGGGTGAAGAGGGAGGCAGG + Intergenic
1033110161 7:138566172-138566194 CTGGTTGATTACAGGAAGGCTGG - Intronic
1033134175 7:138771093-138771115 TTTGGAGATAAGAGGAAGGCAGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034334443 7:150311574-150311596 CTGGGTGCTAAGTGAGAAGCTGG - Intronic
1034556377 7:151852841-151852863 CTGTGAGATAGGAGAGAGGCGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1035519425 8:265559-265581 CTGTATGACATGAGGGAGGCTGG + Intergenic
1035756470 8:2036485-2036507 CTGGGGGATAAGTGGGAGTGGGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036407163 8:8465291-8465313 CTGGGGGATAAGAAGGGGACTGG - Intergenic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1038015196 8:23508937-23508959 CTGGTTGATTAGAGAGAGGGCGG - Intergenic
1038226641 8:25663997-25664019 CTGGGAGATTAGAGCCAGGCTGG + Intergenic
1039598370 8:38811366-38811388 CTGGGTGATAAGCTGGATACAGG - Intronic
1041374883 8:57203356-57203378 CTGGGGCGTAAGAGGAAGGCAGG + Intergenic
1041754364 8:61297439-61297461 GTGGGCGATAAGAGGGAGAGTGG + Intronic
1042346640 8:67734166-67734188 TTTCTTGATAAGAGGGAGGCTGG - Intronic
1042480638 8:69298236-69298258 CTGGCTTTTAAGAGGGAGGAAGG - Intergenic
1044480809 8:92685735-92685757 TGGGGTGAAAAGGGGGAGGCAGG - Intergenic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048546308 8:135390731-135390753 CTAGGAGATAAGAGGGAAACTGG - Intergenic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1050186538 9:2981080-2981102 CCTGGTGACAAGAAGGAGGCAGG - Intergenic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1053139655 9:35674592-35674614 ATGGGAGAGAAGGGGGAGGCTGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053684186 9:40506161-40506183 CTTAGGGATAAGAGGGTGGCTGG + Intergenic
1053934156 9:43134447-43134469 CTTAGGGATAAGAGGGTGGCTGG + Intergenic
1054146827 9:61568352-61568374 CTGGGTGACAAGAGTGAAACTGG + Intergenic
1054159554 9:61664339-61664361 CTGGGAGATAACATGGCGGCTGG + Intergenic
1054279537 9:63118792-63118814 CTTAGGGATAAGAGGGTGGCTGG - Intergenic
1054297280 9:63341625-63341647 CTTAGGGATAAGAGGGTGGCTGG + Intergenic
1054395300 9:64646133-64646155 CTTAGGGATAAGAGGGTGGCTGG + Intergenic
1054429947 9:65151333-65151355 CTTAGGGATAAGAGGGTGGCTGG + Intergenic
1054500437 9:65870199-65870221 CTTAGGGATAAGAGGGTGGCTGG - Intergenic
1054709016 9:68492363-68492385 CTAGGTGATGAGAGGGCTGCTGG - Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1056508574 9:87281118-87281140 GTGCCTTATAAGAGGGAGGCAGG + Intergenic
1056853439 9:90103840-90103862 ATTGCTTATAAGAGGGAGGCAGG + Intergenic
1057171279 9:92964793-92964815 CTGGGTGACATGAGAGGGGCTGG - Intronic
1058248363 9:102659495-102659517 GTGGGGGATAAGGGGGAGGTGGG + Intergenic
1058980780 9:110168252-110168274 CTGGGAGATAGGAGAGACGCTGG - Intronic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061249763 9:129419926-129419948 CTGGGTTAAAACAGGAAGGCTGG - Intergenic
1061571745 9:131482048-131482070 CTGGGTGGGAAGAGGGATTCAGG + Intronic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1061885194 9:133587758-133587780 TTGGGTGGTCTGAGGGAGGCGGG + Intergenic
1061971747 9:134048932-134048954 TTGCGGGACAAGAGGGAGGCAGG + Intronic
1185545085 X:936946-936968 TTGGCTGGTAAGAAGGAGGCTGG + Intergenic
1185764557 X:2715133-2715155 CTGGGTGAGGAGCGGGAGACAGG - Intronic
1185775540 X:2800179-2800201 CCAGGTGATGAGAGGGAGACAGG + Intronic
1186673668 X:11793482-11793504 TTGGGGGACAAGAGGGAGGCAGG - Intergenic
1187415842 X:19092651-19092673 CTGGGTGAGGAGGGTGAGGCTGG - Intronic
1188061583 X:25607188-25607210 CTGGGCCTGAAGAGGGAGGCAGG - Intergenic
1190753153 X:53379822-53379844 ATGGGTGATGAGGGGGAGGAAGG + Exonic
1191223610 X:58016810-58016832 TTTGGTGATCAGATGGAGGCAGG - Intergenic
1192312822 X:70030575-70030597 CTGGGTGATTATTTGGAGGCTGG - Intronic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196667205 X:118329370-118329392 GTGGGTGATGAGAGGTAGTCAGG - Intergenic
1196894410 X:120320861-120320883 CTGGGTGAGAGGAGGCAGACAGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199720983 X:150542602-150542624 CTGGGTGATAAAGGGCAGGTTGG + Intergenic
1199997661 X:153036404-153036426 CTGGGAGATTTGAGAGAGGCTGG + Intergenic
1201294378 Y:12451178-12451200 CCAGGTGATGAGAGGGAGACAGG - Intergenic
1201850624 Y:18476000-18476022 CTGGCTGATGAGAGGGAGCCAGG - Intergenic
1201882694 Y:18844377-18844399 CTGGCTGATGAGAGGGAGCCAGG + Intergenic