ID: 1151358264

View in Genome Browser
Species Human (GRCh38)
Location 17:73573008-73573030
Sequence AGTGCAGGTGTGCCACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151358259_1151358264 26 Left 1151358259 17:73572959-73572981 CCAGGAAGCAGAGCACAGGTGTC 0: 1
1: 0
2: 4
3: 38
4: 250
Right 1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151358264 Original CRISPR AGTGCAGGTGTGCCACATGA AGG Intronic
900910438 1:5593598-5593620 AGTGCAGCTGTTAAACATGAAGG + Intergenic
902128470 1:14237846-14237868 AATTCAGCTGTGCCACATGCAGG + Intergenic
904604281 1:31690433-31690455 AGGGCTGGTGTGCCAACTGAGGG + Intronic
907450066 1:54540682-54540704 AGTGCAAGTGAGGCACATGTGGG - Intergenic
907616237 1:55929865-55929887 AGAGCAGGTGTGCCACCACAAGG + Intergenic
908414949 1:63904101-63904123 AGTTCAGGGGAGCCCCATGATGG + Intronic
909846665 1:80402422-80402444 AGTCCAGGGTTGCCACAGGAGGG - Intergenic
910681475 1:89869967-89869989 ACTGCAGGTGTGCACCATCATGG - Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
914224607 1:145709769-145709791 TGCTCAGGTGTGCCACATGTAGG - Intergenic
915754495 1:158246845-158246867 ATTCCAGGTGTGCCACCTGGTGG - Intergenic
917864877 1:179184773-179184795 AGGGCAAGTGAGCCACAAGAGGG - Intronic
918793777 1:188865367-188865389 AGTGCAGGTTTGTTACATAAAGG + Intergenic
921817071 1:219576269-219576291 AGCTCAGATGGGCCACATGAAGG + Intergenic
923474819 1:234322472-234322494 AGTGGAAGTGGGCCACATAAAGG + Intronic
1063294000 10:4783013-4783035 AGTGCATATGTGCCACATTTTGG + Intergenic
1063566554 10:7176399-7176421 AATGAAGGTGTGCTACATGTGGG - Intronic
1067055323 10:43046498-43046520 CATGCAGGTGTCCCACCTGAGGG + Intergenic
1070097742 10:73354862-73354884 TGTGCAGCTGTGGTACATGAGGG - Intronic
1072935301 10:99706384-99706406 AGTGCAGTTGTGCAACATCATGG + Intronic
1074415634 10:113264629-113264651 AGTTCTGATTTGCCACATGAAGG + Intergenic
1076211149 10:128645995-128646017 ACTGCCTGTGTGCCACATGCTGG - Intergenic
1078012846 11:7586792-7586814 AGTTCAGCTGGGCCAAATGAGGG + Intronic
1078416952 11:11173752-11173774 AGTGTACATGTGCTACATGATGG - Intergenic
1079848837 11:25503546-25503568 ATTGTAGGTGTGGGACATGATGG + Intergenic
1080841460 11:35987290-35987312 TGTGCAGGTTTGTAACATGAGGG + Intronic
1081034638 11:38127993-38128015 AGTGCAGGCGCCTCACATGACGG + Intergenic
1082809627 11:57471589-57471611 GGTGCAGGTGTGACCCAAGATGG + Intronic
1084856859 11:71994960-71994982 AGTGTAGGAGAGCCACAAGAGGG + Intronic
1085548316 11:77342162-77342184 AGTGAAGGTGTTGCAAATGAGGG - Intronic
1085776403 11:79370409-79370431 AGTGCAGGTTTCCCCCAGGAGGG - Intronic
1087628430 11:100622814-100622836 AGAGCAGGTGTCTCAGATGATGG + Intergenic
1090330199 11:125925379-125925401 AATGCAGCTGTGACACAGGATGG - Intergenic
1091141669 11:133240470-133240492 AGACCAGGTGAGCCAGATGAGGG - Intronic
1095483755 12:42662758-42662780 AGAGCTGGAGAGCCACATGAAGG + Intergenic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1097976556 12:65692694-65692716 AGAGCAGGTGTCTCGCATGATGG + Intergenic
1102137029 12:110583580-110583602 ATTGCAGGTGGGCCACGTGAGGG + Intergenic
1103520702 12:121535863-121535885 AGTCCAGGCCTGGCACATGACGG + Intronic
1106625991 13:31421529-31421551 AGTGGAGGGGAGCCACATTAAGG + Intergenic
1107005129 13:35601036-35601058 ATTACAGGTGTGCGCCATGATGG - Intronic
1117130779 14:52684517-52684539 AATGCAGCTGTGCCTCAGGAAGG - Intronic
1119388868 14:74276630-74276652 CCTGCAGGGGTGCCACAGGAGGG + Intergenic
1119921980 14:78455145-78455167 AGTGCAGTTGCGACACTTGATGG - Intronic
1121198105 14:92093488-92093510 AGTGATGCTGTGCCACAAGATGG + Intronic
1122175583 14:99916002-99916024 AGAGCAGGTGTGGCCCGTGATGG + Intronic
1122179853 14:99947046-99947068 ACTGCAGGTGCGCCACCTGGTGG + Intergenic
1122596660 14:102898495-102898517 GGTGCAGGCGGGCCACAGGATGG - Intronic
1122744201 14:103888416-103888438 GGTGCAGGTGAGTCACCTGAGGG + Intergenic
1123038274 14:105480102-105480124 ACAGCAGGTGAGCCACGTGAGGG - Intronic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1128564313 15:68690310-68690332 AATGCAGGGGTGTCACAAGACGG - Intronic
1129084599 15:73075500-73075522 AGTGCATGTCTGCCTCGTGATGG - Intronic
1129566964 15:76633452-76633474 AGAGCAGGTGTGCTACATTAGGG + Intronic
1131413750 15:92233199-92233221 AGGGGAAGTGTACCACATGAAGG + Intergenic
1132086269 15:98910824-98910846 ACTACAGGTGTGCCACAGAAAGG - Intronic
1132471221 16:104454-104476 AGGGCAGGAGGGTCACATGAAGG + Intronic
1140211201 16:72972028-72972050 GGTGCAGGTGTGCACCATCACGG + Intronic
1142177523 16:88651838-88651860 AGTCCAGGTGTGCCCCATGAGGG - Intergenic
1142750678 17:1985685-1985707 AGTACAGGTGTGACAGATGTAGG + Intronic
1142906155 17:3043596-3043618 GATGCATCTGTGCCACATGAAGG + Intergenic
1144649362 17:16997727-16997749 AGGTCAGGGGTGCCACATGCTGG - Intergenic
1146409179 17:32567395-32567417 AGCACAGGTGTGGCACATGTAGG - Intronic
1149256518 17:54833616-54833638 AGTGCAGGTCTGGCAAAAGAGGG + Intergenic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1151521456 17:74633361-74633383 AGCCCAGGTGTGCAACATGGGGG - Intergenic
1152275916 17:79357049-79357071 AGAGCAGGAATGCCACATGGAGG - Intronic
1153877462 18:9386715-9386737 TGTGAAGATGTGCCACATGTAGG - Intronic
1156385359 18:36599746-36599768 AGTGCAGGTGGTCCACCTGGGGG + Intronic
1162146563 19:8615891-8615913 ACTGCAGCTCTGCCACAGGAGGG + Intergenic
1163101241 19:15098225-15098247 AGTGCAGATGTGCCAAACAAAGG - Intergenic
1164868789 19:31626223-31626245 GGTGCAGTGGTGCCAGATGAAGG - Intergenic
1165663845 19:37608698-37608720 GGTGCACCTGTGCCACCTGATGG + Intronic
1166683205 19:44780822-44780844 CCTGCAGGTGTTCCCCATGAGGG + Intronic
925162109 2:1692782-1692804 AGAGCAAGTGACCCACATGAAGG + Intronic
925480871 2:4272670-4272692 AGTGCAGGGGGGCCACAAGGGGG - Intergenic
930243019 2:48955634-48955656 AGTGCATGTGTCCCAAGTGAAGG + Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932391892 2:71399309-71399331 AATGTTGGTCTGCCACATGAAGG + Intronic
935529130 2:104211446-104211468 AGAGCAGGTGTGTCACATGGTGG + Intergenic
938993953 2:136657991-136658013 AGTGGAGGTGTGCTAATTGAAGG + Intergenic
939180092 2:138794398-138794420 AGAGCAGGTGTGCTGCATTAGGG + Intergenic
940186857 2:150995200-150995222 AAAGCAGGTGTTCCACATCATGG - Intergenic
941587873 2:167382194-167382216 AATGAAGTTTTGCCACATGAGGG - Intergenic
943363426 2:186947275-186947297 AGCACAGGTGTGCCTCATAAAGG + Intergenic
943537980 2:189176209-189176231 AGTGTAGGATTGCAACATGATGG + Intronic
946704546 2:222445431-222445453 ACTGCAGGTGTGGGACAAGAGGG - Intronic
947518006 2:230823766-230823788 AGTGCAGCTGTCCCAGCTGAGGG - Intergenic
948353797 2:237361250-237361272 AGTGCTGCTCTGCCAAATGAAGG - Intronic
948847864 2:240691672-240691694 GGTCCGGGTGTGTCACATGACGG + Intergenic
1169299813 20:4432182-4432204 GGTGCAGTTTTGGCACATGAAGG + Intergenic
1174994116 20:55546184-55546206 AGTGCAGGGGTGACACCTTAAGG + Intergenic
1175221032 20:57416565-57416587 GGTGGAGGTGTGGCCCATGAAGG + Intergenic
1175787411 20:61720595-61720617 AGTGCAGGGGTGCAGCATGCAGG + Intronic
1175951362 20:62585091-62585113 GGTGTGGGTGTGTCACATGAGGG - Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177638422 21:23815640-23815662 AGTACAGGTGACCCACATGGAGG + Intergenic
1180235995 21:46459458-46459480 CGTGCTGGGGTCCCACATGAGGG - Intronic
1183998829 22:41656979-41657001 AGAGCAGGTGGGCAAGATGAAGG + Exonic
949562865 3:5219048-5219070 AGTGCAGTTGTGCAATCTGAGGG + Exonic
949840032 3:8310485-8310507 AATTAAGGTGTACCACATGATGG - Intergenic
954008206 3:47610189-47610211 AGTGCTGGTGTGCCTGTTGAGGG + Exonic
954604143 3:51895569-51895591 AGGGCAGGTGTGCCCCAAGATGG - Intronic
955232906 3:57114618-57114640 AGTGCAAAGGTCCCACATGATGG - Intronic
956704927 3:71991508-71991530 GGAGCAGGTGTGTCACATGGTGG + Intergenic
957152730 3:76506522-76506544 AGTGCTGCTTTGCCTCATGAAGG + Intronic
960632853 3:119750698-119750720 AGTGCAGGCATTCCAGATGAGGG + Intronic
961369244 3:126419487-126419509 GGTGCAGGAATGCCACATGCTGG - Intronic
962211018 3:133477617-133477639 AGTGCAGGTGTGCTCACTGAAGG + Intergenic
962949907 3:140208779-140208801 AATGCAGTTCTGCCACATAAAGG + Intronic
967910709 3:194540402-194540424 GGTGCAGATGTGGCACAGGAGGG - Intergenic
968599110 4:1500830-1500852 AGTGCGGGTGTGCACCGTGAGGG - Intergenic
968956909 4:3724157-3724179 GGTGCAGCTGTGCCCCAAGAAGG + Intergenic
972041687 4:34608818-34608840 CATGCAGGTGTGCAATATGAGGG + Intergenic
972869841 4:43284069-43284091 AGTGCAGGTGGCACTCATGACGG - Intergenic
973942415 4:55924180-55924202 AGTGCAGGTGAGGCAGGTGAAGG + Intergenic
975330024 4:73101981-73102003 AGTGCAGTGGTGCCAGATCATGG + Intronic
976334307 4:83868008-83868030 TGTGCAGTTGTTCCACATCAAGG - Intergenic
976895786 4:90109186-90109208 AGAGCAGGTAAGTCACATGATGG - Intergenic
978497847 4:109379048-109379070 AGTGCAGGTGTGGGACAGTAAGG + Intergenic
978660934 4:111125386-111125408 ATTGGTGGTATGCCACATGATGG + Intergenic
982857184 4:160398392-160398414 ATTGCAGGTTTGCCACTTGGAGG + Intergenic
983357032 4:166675732-166675754 AGTGCAGGTGTGGCACTTCAGGG + Intergenic
985201795 4:187491608-187491630 ACTGGAGGTGTGCCACCTTACGG + Intergenic
986737168 5:10676323-10676345 AGTGCAGAGGTGCCAGGTGAGGG - Intergenic
991163954 5:63539914-63539936 AGTACTGGTCTGCAACATGAGGG - Intergenic
993375888 5:87149295-87149317 AGAGCAGGTGTGCTGCATCAGGG + Intergenic
996294065 5:121890655-121890677 AGGGCAGCTGCTCCACATGATGG - Intergenic
999281499 5:150369393-150369415 AGTGCATGTGAGGCACACGAGGG + Intronic
1000610145 5:163365116-163365138 AGGGCAGCTGCCCCACATGATGG + Intergenic
1000678743 5:164157175-164157197 AGGGCAGGTGTGCCACATGGTGG + Intergenic
1001972802 5:175969945-175969967 AGTGCAGATGTGCACAATGAAGG - Intronic
1003190982 6:3874293-3874315 AGTGCAGATGGGCAAAATGAAGG + Intergenic
1004537963 6:16521215-16521237 AGTGCAGTTGTGCAATAAGATGG - Intronic
1004745191 6:18502270-18502292 GGTGCAGGTGTGGGACATCAGGG + Intergenic
1007690098 6:43695341-43695363 AGTGCAGATGTGAGCCATGAAGG + Intergenic
1007965627 6:46001389-46001411 AGTTCAAGTGTGCAACATGAGGG - Intronic
1010001742 6:70956093-70956115 AGTGCAGCTGCGCCACCTGGCGG + Exonic
1013719611 6:113007807-113007829 AATGCCGGTGTGCCACTTTAAGG - Intergenic
1014136578 6:117896507-117896529 AGAGCAGGTATGTCACATGGAGG - Intergenic
1014561964 6:122901616-122901638 AGTGCAGGTGGGCCACAGGAGGG + Intergenic
1016701392 6:147058224-147058246 AGGCCAGGAGTGCCCCATGAGGG - Intergenic
1018981724 6:168606820-168606842 ACTGCACCTGTGCCCCATGATGG + Intronic
1019041470 6:169109391-169109413 AGTGGAGGTGAGGGACATGAGGG - Intergenic
1019147313 6:169983670-169983692 ATTGCACGTGTGCTGCATGACGG - Intergenic
1021464906 7:20931380-20931402 AGAGCAGGAGTGCCAGATGTAGG - Intergenic
1023668738 7:42554191-42554213 TTTGCATGTGAGCCACATGAAGG - Intergenic
1024878804 7:54060695-54060717 AGTGCAGGGGTGACACAGCATGG + Intergenic
1025925424 7:65955701-65955723 AGTGCAGGTTTTCTACCTGACGG - Intronic
1026864626 7:73815740-73815762 AGTGCAGGTGTGCCAGCCCAGGG - Intronic
1029385214 7:100239080-100239102 AGTGCAGTGGTGCCACATCTTGG + Intronic
1032813242 7:135444086-135444108 AGTGCAGCAGTGCCACATCACGG - Intronic
1035868101 8:3106693-3106715 TGTGAAGGTGTGACACATGTAGG + Intronic
1040006349 8:42624209-42624231 AGTTCAGATGTGCCTCAAGAGGG - Intergenic
1040639999 8:49321936-49321958 AGTGCAGGTTTGTCCCAGGATGG - Intergenic
1040834877 8:51721137-51721159 AGTGCTGGTGTGCCCTTTGAAGG - Intronic
1050722423 9:8605899-8605921 AGCACAGGTGTGCCACAGCATGG + Intronic
1057530282 9:95839060-95839082 AGTGCTGGCCTGCCACTTGATGG + Intergenic
1060992671 9:127857761-127857783 AGTGGATGTGTCCCACAAGAGGG - Intergenic
1061442637 9:130616722-130616744 AGGGCAGGTGTGCCCTATCAGGG + Intronic
1061842583 9:133368011-133368033 AGTGCAGCGGTGCCTCAGGAGGG - Intronic
1062246044 9:135566683-135566705 GGTGCAGGTGTGCAGCAGGAAGG - Exonic
1062401388 9:136374222-136374244 AGAGCAGGGATGCCTCATGATGG - Intergenic
1062570742 9:137184066-137184088 AGGGCAGGTGTGGCAGATGCTGG - Intronic
1188312703 X:28637173-28637195 AGTGTGGCTGTGGCACATGAAGG - Intronic
1188448592 X:30284621-30284643 AGTGAATGTGTTCCATATGAGGG - Intergenic
1188451523 X:30312031-30312053 AGTGCCTGTGTGGCACTTGAGGG - Intergenic
1193013146 X:76700330-76700352 ACTGCAGTGGAGCCACATGATGG - Intergenic
1193140235 X:78019258-78019280 AGTCCAGGTTTTCCACATCAGGG + Intronic
1193141275 X:78029673-78029695 AGTCCAGGTTTTCCACATTAGGG - Intronic
1194917046 X:99719779-99719801 AGAGCAGGTGGACAACATGAAGG - Intergenic
1198423714 X:136494959-136494981 AGTGTAGATGGGCCACATAAAGG - Intergenic
1200109811 X:153734650-153734672 AGTTCAGATGTGCCCCAGGAGGG + Intronic
1200964979 Y:9027557-9027579 TGAGCAGGTGTTTCACATGAAGG - Intergenic