ID: 1151360404

View in Genome Browser
Species Human (GRCh38)
Location 17:73585226-73585248
Sequence GTGCATTCTGAGACAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360404_1151360413 27 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360413 17:73585276-73585298 CGTAGTGGGTGGCAGAGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 163
1151360404_1151360414 28 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360404_1151360412 16 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360412 17:73585265-73585287 CATGCGCTTCTCGTAGTGGGTGG 0: 1
1: 0
2: 0
3: 0
4: 31
1151360404_1151360410 13 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360410 17:73585262-73585284 TGCCATGCGCTTCTCGTAGTGGG 0: 1
1: 0
2: 1
3: 0
4: 29
1151360404_1151360409 12 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360404 Original CRISPR GTGCATTCTGAGACAGTTCT GGG (reversed) Intronic