ID: 1151360405

View in Genome Browser
Species Human (GRCh38)
Location 17:73585227-73585249
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360405_1151360412 15 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360412 17:73585265-73585287 CATGCGCTTCTCGTAGTGGGTGG 0: 1
1: 0
2: 0
3: 0
4: 31
1151360405_1151360410 12 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360410 17:73585262-73585284 TGCCATGCGCTTCTCGTAGTGGG 0: 1
1: 0
2: 1
3: 0
4: 29
1151360405_1151360409 11 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1151360405_1151360413 26 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360413 17:73585276-73585298 CGTAGTGGGTGGCAGAGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 163
1151360405_1151360414 27 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360405 Original CRISPR AGTGCATTCTGAGACAGTTC TGG (reversed) Intronic