ID: 1151360406

View in Genome Browser
Species Human (GRCh38)
Location 17:73585256-73585278
Sequence ACGAGAAGCGCATGGCATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360406_1151360414 -2 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360406_1151360413 -3 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360413 17:73585276-73585298 CGTAGTGGGTGGCAGAGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 163
1151360406_1151360415 13 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360415 17:73585292-73585314 GTCTAGGGCGATGAGAAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 55
1151360406_1151360416 26 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360406 Original CRISPR ACGAGAAGCGCATGGCATAG GGG (reversed) Intronic