ID: 1151360408

View in Genome Browser
Species Human (GRCh38)
Location 17:73585258-73585280
Sequence CTACGAGAAGCGCATGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360408_1151360416 24 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284
1151360408_1151360415 11 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360415 17:73585292-73585314 GTCTAGGGCGATGAGAAGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 55
1151360408_1151360413 -5 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360413 17:73585276-73585298 CGTAGTGGGTGGCAGAGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 163
1151360408_1151360417 29 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360417 17:73585310-73585332 TCTGGAGCCTGTGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 32
4: 353
1151360408_1151360414 -4 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360408 Original CRISPR CTACGAGAAGCGCATGGCAT AGG (reversed) Intronic