ID: 1151360409

View in Genome Browser
Species Human (GRCh38)
Location 17:73585261-73585283
Sequence ATGCCATGCGCTTCTCGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360404_1151360409 12 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1151360405_1151360409 11 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360409 Original CRISPR ATGCCATGCGCTTCTCGTAG TGG Intronic
902061640 1:13648807-13648829 ATGACATGCGCTTGTCGAAGAGG - Intergenic
912456164 1:109798954-109798976 ATGCAATACACTTCTCCTAGGGG + Intergenic
917687598 1:177433253-177433275 GTGCCATTTGCTTCTCGGAGTGG - Intergenic
1072087728 10:92097009-92097031 ATGCCATGTCCTTATGGTAGGGG + Intronic
1081008612 11:37779725-37779747 ATCCCATGAGCTTCTCAAAGAGG - Intergenic
1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG + Intronic
1091311064 11:134575655-134575677 CTGCCATGGGCTTGTCTTAGAGG + Intergenic
1091544567 12:1492872-1492894 ATTCCATGCCCCTCTCCTAGTGG + Exonic
1091878498 12:3957437-3957459 ATGCCATGCCCTTCTCCCAAAGG + Intergenic
1100743887 12:97624467-97624489 AAGCCATGCGCTTTTCCAAGAGG + Intergenic
1101503121 12:105322298-105322320 AGGGCATGTGCTTCTCATAGTGG - Intronic
1111808253 13:93065374-93065396 ATGCCATGTGCTTCCCGCTGGGG - Intergenic
1114538328 14:23436894-23436916 ATGCCATGCTCTTCTAGCAACGG + Intergenic
1126247851 15:46530333-46530355 ATGCCATGGGCTACTGGTCGAGG - Intergenic
1131185835 15:90273515-90273537 ATGCCATACCCTTTTCGCAGTGG + Exonic
1141886389 16:86895256-86895278 ATGCCACCAGCTTCTTGTAGCGG - Intergenic
1144803614 17:17949123-17949145 ATGCCATGCGTTTCTCACACAGG + Intronic
1148291511 17:46455243-46455265 AAGCCTTGAGCTTCTCCTAGAGG - Intergenic
1148313699 17:46672945-46672967 AAGCCTTGAGCTTCTCCTAGAGG - Intronic
1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1164661833 19:29980274-29980296 ATGCCATAGGCTTGTTGTAGAGG + Intronic
926511641 2:13788071-13788093 ATGCCATGCTCATTTCGCAGCGG - Intergenic
937675396 2:124584477-124584499 ATGCCATGAGCTACACTTAGAGG - Intronic
937808870 2:126177759-126177781 GTGCCATGGGCTTATGGTAGTGG - Intergenic
940022615 2:149171292-149171314 ATTCCATGCCCTTCTCCTTGAGG + Intronic
947911392 2:233803183-233803205 AGGCCATGCGCATTTTGTAGTGG - Intronic
948821872 2:240554044-240554066 CTGCCATGCCCTTCACGTCGGGG - Intronic
949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG + Intronic
951374307 3:21894894-21894916 TTGCCATGAGCTCCTGGTAGAGG - Intronic
964518603 3:157540166-157540188 ATACCATGTGCTTTTCTTAGTGG + Intergenic
1009337638 6:62512711-62512733 ATGCTGTGCCCTTCTGGTAGTGG + Intergenic
1015834535 6:137405884-137405906 ATGCTATTTGCTTCTCTTAGGGG - Intergenic
1016684843 6:146869452-146869474 ATGCCATCGGCTTCTCCTTGAGG + Intergenic
1018770810 6:166970347-166970369 GTGCCATCTGCTTCTCCTAGGGG - Intergenic
1021613707 7:22481466-22481488 ATACCATTCTCTTCTTGTAGAGG - Intronic
1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG + Intronic
1187970296 X:24652106-24652128 AAGGCATGCTCTTCTTGTAGAGG - Intronic
1191257839 X:58287479-58287501 AAGGCATGGGCTTCTGGTAGAGG - Intergenic
1196011131 X:110889107-110889129 GTGCCATGCCCTACTGGTAGTGG - Intergenic