ID: 1151360409

View in Genome Browser
Species Human (GRCh38)
Location 17:73585261-73585283
Sequence ATGCCATGCGCTTCTCGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360404_1151360409 12 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1151360405_1151360409 11 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360409 17:73585261-73585283 ATGCCATGCGCTTCTCGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360409 Original CRISPR ATGCCATGCGCTTCTCGTAG TGG Intronic