ID: 1151360414

View in Genome Browser
Species Human (GRCh38)
Location 17:73585277-73585299
Sequence GTAGTGGGTGGCAGAGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360408_1151360414 -4 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360411_1151360414 -10 Left 1151360411 17:73585264-73585286 CCATGCGCTTCTCGTAGTGGGTG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360405_1151360414 27 Left 1151360405 17:73585227-73585249 CCAGAACTGTCTCAGAATGCACT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360407_1151360414 -3 Left 1151360407 17:73585257-73585279 CCCTATGCCATGCGCTTCTCGTA 0: 1
1: 0
2: 1
3: 2
4: 28
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360404_1151360414 28 Left 1151360404 17:73585226-73585248 CCCAGAACTGTCTCAGAATGCAC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
1151360406_1151360414 -2 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360414 17:73585277-73585299 GTAGTGGGTGGCAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360414 Original CRISPR GTAGTGGGTGGCAGAGTCTA GGG Intronic