ID: 1151360416

View in Genome Browser
Species Human (GRCh38)
Location 17:73585305-73585327
Sequence AGAAGTCTGGAGCCTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360408_1151360416 24 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284
1151360407_1151360416 25 Left 1151360407 17:73585257-73585279 CCCTATGCCATGCGCTTCTCGTA 0: 1
1: 0
2: 1
3: 2
4: 28
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284
1151360406_1151360416 26 Left 1151360406 17:73585256-73585278 CCCCTATGCCATGCGCTTCTCGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284
1151360411_1151360416 18 Left 1151360411 17:73585264-73585286 CCATGCGCTTCTCGTAGTGGGTG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1151360416 17:73585305-73585327 AGAAGTCTGGAGCCTGTGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360416 Original CRISPR AGAAGTCTGGAGCCTGTGCA AGG Intronic