ID: 1151360417

View in Genome Browser
Species Human (GRCh38)
Location 17:73585310-73585332
Sequence TCTGGAGCCTGTGCAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151360407_1151360417 30 Left 1151360407 17:73585257-73585279 CCCTATGCCATGCGCTTCTCGTA 0: 1
1: 0
2: 1
3: 2
4: 28
Right 1151360417 17:73585310-73585332 TCTGGAGCCTGTGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 32
4: 353
1151360408_1151360417 29 Left 1151360408 17:73585258-73585280 CCTATGCCATGCGCTTCTCGTAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1151360417 17:73585310-73585332 TCTGGAGCCTGTGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 32
4: 353
1151360411_1151360417 23 Left 1151360411 17:73585264-73585286 CCATGCGCTTCTCGTAGTGGGTG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1151360417 17:73585310-73585332 TCTGGAGCCTGTGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 32
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151360417 Original CRISPR TCTGGAGCCTGTGCAAGGCC AGG Intronic