ID: 1151361492

View in Genome Browser
Species Human (GRCh38)
Location 17:73591961-73591983
Sequence CCCACGTCCCCAGAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151361492_1151361501 24 Left 1151361492 17:73591961-73591983 CCCAGCCTCTCTGGGGACGTGGG 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1151361501 17:73592008-73592030 AGTTTCTCACCCACATGAGGGGG 0: 1
1: 0
2: 0
3: 13
4: 148
1151361492_1151361500 23 Left 1151361492 17:73591961-73591983 CCCAGCCTCTCTGGGGACGTGGG 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1151361500 17:73592007-73592029 CAGTTTCTCACCCACATGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 156
1151361492_1151361502 25 Left 1151361492 17:73591961-73591983 CCCAGCCTCTCTGGGGACGTGGG 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1151361502 17:73592009-73592031 GTTTCTCACCCACATGAGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1151361492_1151361498 21 Left 1151361492 17:73591961-73591983 CCCAGCCTCTCTGGGGACGTGGG 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1151361498 17:73592005-73592027 TGCAGTTTCTCACCCACATGAGG 0: 1
1: 0
2: 4
3: 80
4: 1070
1151361492_1151361499 22 Left 1151361492 17:73591961-73591983 CCCAGCCTCTCTGGGGACGTGGG 0: 1
1: 0
2: 1
3: 14
4: 224
Right 1151361499 17:73592006-73592028 GCAGTTTCTCACCCACATGAGGG 0: 1
1: 0
2: 1
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151361492 Original CRISPR CCCACGTCCCCAGAGAGGCT GGG (reversed) Intronic
900659212 1:3774485-3774507 CCCAAGTGCCCAGAGGGGCGAGG - Intronic
901334948 1:8441165-8441187 CCCACGCCCCCATAGGAGCTGGG - Intronic
901436274 1:9249083-9249105 GCCCCATCCCCAGCGAGGCTGGG + Intronic
902987891 1:20166481-20166503 CCCTCGTCCCCTGAGAGAGTGGG - Intronic
904471029 1:30736317-30736339 CCCACCACCACAGAAAGGCTGGG + Intronic
904804020 1:33118392-33118414 CCCACTTCCTCAGGGAGGCCTGG - Intronic
905865880 1:41376428-41376450 CCCTGCTCCCCAGAGAGACTTGG - Intronic
906495453 1:46301938-46301960 CCCCTGTCCCCAGCGCGGCTAGG + Intronic
907321034 1:53602499-53602521 CCCAAGGCCCCAGAGGGGCCTGG - Intronic
907380693 1:54085079-54085101 CCCAGGTCCATAGAAAGGCTAGG + Intronic
908417904 1:63931400-63931422 CCCACTGCCACAGAGAAGCTGGG - Intronic
909959206 1:81818056-81818078 CCCACTTCTCCTGAGTGGCTGGG - Intronic
910766030 1:90783141-90783163 TCTCCTTCCCCAGAGAGGCTTGG - Intergenic
915194954 1:154182632-154182654 CCCACTTCCCCATGGAGGGTGGG - Intronic
919990542 1:202706024-202706046 CCCCCTCCCCTAGAGAGGCTGGG - Intronic
920183559 1:204147154-204147176 TTCACGTCCCCTGAGAGGATGGG - Intronic
924295609 1:242584615-242584637 GCCACGTCTCCACAGAGGATAGG + Intergenic
1063082914 10:2785325-2785347 CCCACACTCTCAGAGAGGCTTGG + Intergenic
1066411990 10:35180808-35180830 CCCCCGTCCCCAGAGGGGCTGGG + Intronic
1067031006 10:42878886-42878908 CTCACTCCCCCAGAGAGACTGGG + Intergenic
1067411530 10:46069037-46069059 TCCAAGTCCCCTGAGAGGCAGGG + Intergenic
1069568080 10:69477031-69477053 CCCACATCCCCAGGGCAGCTGGG - Intronic
1070794387 10:79208230-79208252 ACCTCCTCCCCAGTGAGGCTGGG + Intronic
1071790986 10:88953682-88953704 CCCATGTCCAGAGAAAGGCTAGG + Intronic
1072302529 10:94075226-94075248 CCCATGTCCCCAGCTAGACTGGG + Intronic
1072727138 10:97821727-97821749 CCCAGCTTCCCACAGAGGCTGGG - Intergenic
1073139248 10:101236791-101236813 CCCACGTTCCCTGTGCGGCTGGG - Intergenic
1075933869 10:126323043-126323065 CCCAGGAACCCAGAGAGTCTGGG + Intronic
1077014508 11:393750-393772 CCCACCTCACCAGGAAGGCTGGG + Intronic
1077420792 11:2448986-2449008 CCCCTGTCCCCACACAGGCTGGG - Intronic
1077789142 11:5418716-5418738 CCCCCATCCCCCGATAGGCTCGG - Intronic
1078729885 11:13964370-13964392 CCCAGTTCCCCAGAGAGCCTTGG + Intronic
1081852724 11:46285015-46285037 TCCAAGTCCCCAGAAGGGCTGGG - Intronic
1084805712 11:71577312-71577334 ACCCCGTCCCCAGACAGCCTTGG + Intergenic
1085050826 11:73379335-73379357 CCCAAGTTCCCAGAAAGGTTTGG - Intronic
1085698872 11:78728828-78728850 CCCAAGGGCCAAGAGAGGCTAGG + Intronic
1087891755 11:103544097-103544119 CCCTCATTCCCAGAGAGGCCTGG - Intergenic
1091174252 11:133545654-133545676 CCCTCCTCCCCATAGAGGCCAGG + Intergenic
1095261534 12:40105066-40105088 CCCACCTCCCGGGAGAGCCTTGG + Intronic
1095965499 12:47864505-47864527 CTCAAGGCGCCAGAGAGGCTGGG + Intronic
1096591053 12:52659488-52659510 ATCTCGTCCCCAGGGAGGCTGGG - Intergenic
1097152362 12:56988360-56988382 ACCACATCTACAGAGAGGCTGGG + Intergenic
1099322113 12:81162961-81162983 CCCCTGTCCCCACACAGGCTTGG - Intronic
1102111948 12:110371558-110371580 CCCAGCTCCCCAGGGAGGCCTGG + Intergenic
1102499810 12:113344175-113344197 CCCAAGCCTCCCGAGAGGCTGGG - Intronic
1103895124 12:124268030-124268052 CCCTGGTGCCCAGAGGGGCTGGG - Intronic
1108321546 13:49295416-49295438 CACCCGTACCCAGAGAGGCCCGG + Intergenic
1112262818 13:97893066-97893088 TCCACTTCTCCAGAGAGGATAGG + Intergenic
1113413041 13:110107076-110107098 CTCAGGGCCCCACAGAGGCTCGG - Intergenic
1115010109 14:28536116-28536138 TCAACCTCCCCAGTGAGGCTGGG + Intergenic
1119608986 14:76045821-76045843 CCCTCAGCCCCAGAGAGGCTAGG + Intronic
1119747244 14:77053055-77053077 CCCACCACCCCAAAGAGGCGAGG + Intergenic
1119902917 14:78276631-78276653 TCCAAGGCCACAGAGAGGCTGGG + Intronic
1121320538 14:92989262-92989284 CCCCCATCCCCAGGGAGGCCTGG + Intronic
1122627694 14:103092581-103092603 CACAGGTGCCCAGAGAGGCCAGG - Intergenic
1122968217 14:105141654-105141676 GCCACGCCGGCAGAGAGGCTTGG - Exonic
1123717042 15:23040631-23040653 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123717205 15:23041155-23041177 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123717281 15:23041417-23041439 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123717678 15:23042748-23042770 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123717777 15:23043081-23043103 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123717843 15:23043306-23043328 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718224 15:23044610-23044632 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718362 15:23045114-23045136 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718460 15:23045448-23045470 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718525 15:23045674-23045696 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718732 15:23046409-23046431 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718828 15:23046743-23046765 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123718895 15:23046969-23046991 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123719033 15:23047449-23047471 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123719108 15:23047712-23047734 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123719247 15:23048192-23048214 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1123719488 15:23049017-23049039 CCCACCTGGCCAGAGATGCTGGG + Intergenic
1124590580 15:31049901-31049923 CACACGTCACCACAGAGGCCTGG + Intronic
1125503127 15:40251954-40251976 CCCGCACCCCCAGAGCGGCTAGG - Exonic
1125538360 15:40455732-40455754 CCCAAGTTACCAGAGGGGCTAGG - Intronic
1125579812 15:40777079-40777101 GCCAGGTCCACAGTGAGGCTTGG - Intronic
1125921550 15:43528437-43528459 CCCATGTCTCCAGGCAGGCTTGG - Exonic
1128682486 15:69662015-69662037 CCCACGCCCCCACAGACCCTGGG - Intergenic
1129433946 15:75522517-75522539 CCCACCTCCCCCAAGAAGCTGGG + Intronic
1131052647 15:89358913-89358935 CCTACGTCCTCTAAGAGGCTTGG + Intergenic
1131090858 15:89624116-89624138 CCCATGTCCTCAGAGCTGCTCGG + Exonic
1132645223 16:996388-996410 GCCAGGTCTCCAGAGCGGCTGGG + Intergenic
1136426494 16:30171179-30171201 CACCCGCCCCCAGAGTGGCTGGG + Intergenic
1136488009 16:30585561-30585583 CCCACGTACCCGGGGAGGCCGGG - Exonic
1138071992 16:54001838-54001860 CCCAGGTCCCAAGGGATGCTGGG - Intronic
1139186571 16:64812697-64812719 CCCCAATCCCCAGACAGGCTTGG - Intergenic
1140133268 16:72183001-72183023 GCCAGGTCCCCAGAGGGTCTTGG + Intergenic
1141748309 16:85941112-85941134 CCCACGTCCACAGTGAAGCTCGG + Intergenic
1142248192 16:88979275-88979297 CCCTCCTGCCCCGAGAGGCTGGG - Intergenic
1142606930 17:1087286-1087308 CCCAAGGACCCAGAGAGGCTGGG + Intronic
1144698878 17:17323732-17323754 CCAACGTCCCCAGGGAGGGCCGG - Intronic
1144727981 17:17511353-17511375 CCCACAGTCCCAGAGAGGCCTGG + Intronic
1145085599 17:19936593-19936615 CCCACTTCCCCAGAGATAGTTGG + Intronic
1147400625 17:40178193-40178215 CCCCCCTCCCCCGAGAGGCCCGG - Intronic
1147880575 17:43650954-43650976 TCCCTGGCCCCAGAGAGGCTGGG - Intronic
1148909712 17:50934878-50934900 CCCACCTCCGCAAAGAGGCAGGG - Intergenic
1151361492 17:73591961-73591983 CCCACGTCCCCAGAGAGGCTGGG - Intronic
1151577556 17:74960304-74960326 CCCACGTGGCCAGAGAGGTGTGG - Intronic
1152169894 17:78738461-78738483 CCCAGCTCCCCAGTGAGACTTGG - Intronic
1152262496 17:79274660-79274682 CCCTCATCCCCCAAGAGGCTGGG + Intronic
1152780470 17:82225575-82225597 CCCAGGACCCCAGGGAGGCGGGG + Intergenic
1153791617 18:8584470-8584492 CCCACTTCCTCATAAAGGCTGGG + Intergenic
1155438264 18:25835024-25835046 GCCATTTCTCCAGAGAGGCTTGG - Intergenic
1158224807 18:55189913-55189935 CCCACCTCCCCACAGAAACTGGG + Intergenic
1158542160 18:58366879-58366901 CCCACGTCCCCTTAGAGCCCAGG - Intronic
1159253041 18:65906777-65906799 CCTACCTTCCCACAGAGGCTGGG + Intergenic
1159947761 18:74456971-74456993 CCCAAGTCCCCGGGAAGGCTGGG + Intronic
1160386199 18:78498334-78498356 CCCACGTCCCAAGAGGAGCTGGG - Intergenic
1160754375 19:750040-750062 CCGACTTCCCCACAGATGCTGGG + Intergenic
1160803450 19:980703-980725 GCCACGTCCCCAGGGAGGGGAGG + Intergenic
1160859156 19:1230446-1230468 CCCACGTCCACTGGGAGGCTGGG - Exonic
1161115250 19:2493127-2493149 CCCACCTCCTCAGACAGGCACGG + Intergenic
1161404268 19:4082955-4082977 CCCGCGCCCCCAGCCAGGCTGGG + Intergenic
1161462006 19:4403060-4403082 CCCACCGCCCCAGAGAGTCCTGG - Intronic
1162404388 19:10464830-10464852 CCCCCGCCTCCAGAGTGGCTGGG + Intronic
1162809615 19:13155972-13155994 CCCACGTCCCCTGGGAGAGTTGG - Intergenic
1162940198 19:14004950-14004972 CCCACGTGGCCCTAGAGGCTGGG + Intronic
1163933980 19:20424749-20424771 CCAACATCCCCAGAGAGGGGAGG - Intergenic
1163993398 19:21020819-21020841 CCGACATCCCCAGAGAGGGGAGG + Intronic
1164229236 19:23273590-23273612 CCCCCGGCCCCCGAGAAGCTGGG - Intergenic
1164985375 19:32644552-32644574 CCCTCCTCCCCAGAGGGCCTAGG - Intronic
1165109038 19:33490482-33490504 CACACCTCCCCAGAAGGGCTGGG - Intronic
1167485665 19:49761629-49761651 CAAATGTCCCCAGTGAGGCTGGG - Intronic
1167696885 19:51019992-51020014 TTCACGTCCCCAGCAAGGCTAGG + Exonic
1168059538 19:53883280-53883302 CTCTGGTCCCCAGAGAGGCGCGG + Intronic
1168299335 19:55394685-55394707 CCTCAGTCTCCAGAGAGGCTGGG + Intronic
926267882 2:11343692-11343714 CCCACCTCCCCAGAGTGGGCAGG + Intronic
926686743 2:15704091-15704113 CCAGCTTCCCCAGGGAGGCTGGG + Intronic
926716626 2:15929244-15929266 TCAAGATCCCCAGAGAGGCTGGG + Intergenic
928450865 2:31377621-31377643 CCTCAGTCCCCAGAGAGGCTGGG - Intronic
930800403 2:55437852-55437874 CCCAAGACCACAGAGATGCTGGG - Intergenic
931459614 2:62439290-62439312 CCCACGTCAATAGAGAGGATAGG + Intergenic
935469062 2:103434858-103434880 CCCATGTCCCCTGAGAGGAAAGG + Intergenic
936158969 2:110069949-110069971 CCCACATCTCCAAGGAGGCTGGG - Intergenic
936185691 2:110301383-110301405 CCCACATCTCCAAGGAGGCTGGG + Intergenic
937317564 2:120941649-120941671 CCCACTTCCTCAGAAATGCTGGG - Intronic
938727216 2:134119836-134119858 CCGACGGCCCCTGAGAAGCTGGG + Intergenic
946161026 2:217836155-217836177 CCCGCCTCCGCAGAGGGGCTGGG + Exonic
946895523 2:224319592-224319614 CCCACCTCCCGAGAGAGGCCTGG + Intergenic
947708040 2:232292484-232292506 CCCATGTTCCCACAGAGTCTGGG + Intronic
949027743 2:241774318-241774340 CCCACGTCCACAGAGGGCCGAGG - Intergenic
1169017709 20:2305196-2305218 CCCACGTCCACAGAGGGGAGAGG - Intronic
1170389087 20:15852468-15852490 CCCATGTTCCCAGAGATGTTTGG - Intronic
1170556485 20:17518995-17519017 ACCACACCCTCAGAGAGGCTTGG + Intronic
1171093238 20:22306110-22306132 ACGACGTCCCCAGAGGGGATAGG - Intergenic
1172225422 20:33302252-33302274 CCCAGGACCCCAGAAAAGCTGGG - Intronic
1172992598 20:39047612-39047634 ACCACGGCACCAGGGAGGCTGGG - Intergenic
1174907857 20:54571616-54571638 CCCCCTTCCCCAGAGATACTTGG - Intronic
1175229072 20:57461972-57461994 CTCCCGTCCCCAGGGAGGCCAGG - Intergenic
1177304757 21:19299226-19299248 GCCACTTCCCCAGAGAGCCCTGG - Intergenic
1179317970 21:40262230-40262252 CCCACCTCCCAAAAGAGGGTGGG + Intronic
1179452718 21:41476484-41476506 CCCACGCCCCCAGAGACACAGGG + Intronic
1179639028 21:42735082-42735104 CCCAGATCCCCAGGAAGGCTTGG + Intronic
1180675124 22:17581422-17581444 CTCAGGTCCCCTGGGAGGCTGGG + Intronic
1182257824 22:29050770-29050792 CCCACGGCCCCACAGGGGCCTGG + Exonic
1182347089 22:29673929-29673951 CCCATGTGCCAAGAAAGGCTGGG - Intronic
1182347253 22:29674930-29674952 CCCACGTACCCGGTGAGCCTGGG + Exonic
1182422581 22:30255873-30255895 CCCAGGTCCCCAGGAAAGCTGGG + Intergenic
1182735971 22:32532562-32532584 CTCTCCTCCCCAGAGAGGCCAGG - Intronic
1183281427 22:36934767-36934789 CCCAAGTCCCCAGCCAGGCTTGG + Intronic
1184399930 22:44267855-44267877 CCCAGCTGCCCAGAGAGGCAGGG + Intronic
1184715332 22:46278773-46278795 CTCACTTCCTCAGAGAGACTGGG + Intronic
1185334660 22:50266157-50266179 CCCTCTCCCCCAGAGAGCCTGGG + Intronic
949786832 3:7751147-7751169 CCCACGCCCCCAGAGCTTCTGGG - Intergenic
950583680 3:13878948-13878970 CCCACCTCCACAGAAACGCTAGG + Intronic
952292156 3:32027742-32027764 CCCAAGTCCCCAGAGTAACTGGG + Intronic
953385088 3:42501862-42501884 GGCACCTCCCCAGGGAGGCTGGG - Intronic
953667962 3:44939724-44939746 GCCTTGTCTCCAGAGAGGCTGGG - Intronic
953966644 3:47312715-47312737 CCTCCGCCCCCTGAGAGGCTAGG + Intronic
960951887 3:123004631-123004653 CCCAGCTCTCCAGAGAAGCTGGG - Intronic
961559852 3:127721123-127721145 CTCACGGCCGCAGAGAGGCCGGG - Exonic
961743296 3:129047021-129047043 CCCACCTCTCCAGTGAGGCCAGG + Intergenic
962468222 3:135680315-135680337 CGCACGTAAGCAGAGAGGCTGGG - Intergenic
967867863 3:194204632-194204654 CCCAGGTTCCCACAGGGGCTTGG - Intergenic
968557039 4:1250687-1250709 CCCACTTCCCCAGGGGAGCTGGG + Intergenic
968659129 4:1792020-1792042 CCCATGTCCCCAGACCGTCTTGG - Intergenic
973039906 4:45457204-45457226 CCCACGGCGGCAGGGAGGCTCGG + Intergenic
973774802 4:54233194-54233216 CGCAGGTCCCCGGAGCGGCTGGG + Intronic
983219941 4:165034267-165034289 CCCAGCTCCTCAGAAAGGCTGGG - Intronic
985445403 4:190018825-190018847 CCCACGCTCCCAGAGAAGCCAGG - Intergenic
985544318 5:501480-501502 CCCTCGTCCCCCGGGAGGGTGGG - Intronic
986164992 5:5265460-5265482 CCCACCTTCCCACAGAGCCTGGG + Intronic
992546839 5:77821639-77821661 GCAACATCCCCAGATAGGCTGGG - Intronic
994790945 5:104224451-104224473 CCCAGGAGCACAGAGAGGCTTGG + Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999179412 5:149658533-149658555 CCCAGGGCCCAAGAGAGGCAAGG - Intergenic
1000124207 5:158227415-158227437 ACCAAGGCCCCAGAGAGGTTAGG + Intergenic
1001648110 5:173297191-173297213 CCCACTGCCCAAGAGAGGCTCGG - Intergenic
1001952622 5:175826730-175826752 CCCAGGTTCCCAGGGAAGCTTGG + Intronic
1002305718 5:178281501-178281523 CCCTCGACTCCAGAGGGGCTTGG + Intronic
1012264567 6:97125797-97125819 CCTACATTCCCATAGAGGCTGGG + Intronic
1013765232 6:113566494-113566516 CCCACGTCCACAGGCAGACTTGG - Intergenic
1015525958 6:134175487-134175509 CTCACTTCCCCAGAGCGGCTTGG - Intronic
1017764202 6:157593506-157593528 CCCAGCTCCTCAGAGGGGCTGGG + Intronic
1019556680 7:1635039-1635061 CACACATCCCCAGAGTGGGTTGG + Intergenic
1020046799 7:5046349-5046371 CCCACGGCTCCCGAGAGGCCGGG - Exonic
1021484841 7:21156562-21156584 CCCAGGTCCTCAGAAAGGGTTGG - Intergenic
1022622353 7:31997746-31997768 CCCACCTACACAGAGAGGGTTGG + Intronic
1025004463 7:55343695-55343717 CCCACGTCCCCAAACCCGCTTGG + Intergenic
1026727349 7:72879838-72879860 CCCACGGCTCCCGAGAGGCCGGG - Exonic
1026962591 7:74418012-74418034 CCCACTCCCCAAGAGAGGCTGGG + Intergenic
1027116507 7:75485889-75485911 CCCACGGCTCCCGAGAGGCCGGG + Exonic
1027275319 7:76549814-76549836 CCCACGGCTCCTGAGAGGCCGGG - Intergenic
1028834362 7:95357971-95357993 CCCACGTGCCCAGAGGGGTATGG - Intergenic
1029721030 7:102364364-102364386 CCCACGGCTCCCGAGAGGCCGGG - Exonic
1030077779 7:105751359-105751381 CCCAGCACCCCAGAAAGGCTGGG + Intronic
1030262331 7:107579253-107579275 CCCCAGTCTCCAGAGTGGCTGGG - Intergenic
1032525331 7:132575559-132575581 CCCATGTGCCCAGGGAGGGTAGG + Intronic
1033480040 7:141730524-141730546 CCCACTTCCTCAAAGAAGCTGGG - Exonic
1035218438 7:157389585-157389607 CCCACGTCCCTAGAACAGCTAGG - Intronic
1038002391 8:23403287-23403309 CCCTGGTCCCCGGAGAGGCAGGG + Intronic
1041333790 8:56757334-56757356 CCCTCTTCCCCTGAAAGGCTTGG - Intergenic
1041369213 8:57142325-57142347 CCAATGTCCCCAGCGATGCTTGG + Intergenic
1044681891 8:94787387-94787409 CCCACGTCCACTGACATGCTAGG - Intronic
1047442375 8:124889363-124889385 CCCTCATGCCCAGAGATGCTGGG - Intergenic
1047506773 8:125486351-125486373 CCCACATCCCGAGAGGGGCAGGG + Intergenic
1049208219 8:141373171-141373193 GCCACGTCCCCAGCAGGGCTCGG + Intergenic
1050207229 9:3210008-3210030 CCCACGTCCCCAGTCATGCATGG + Intergenic
1052609205 9:30748643-30748665 CCCTTTTCCCCAGAGAGGCAAGG - Intergenic
1056790750 9:89623923-89623945 CCTGCGTCTCCAGAGTGGCTTGG + Intergenic
1057280939 9:93711148-93711170 CCAACCTCCCCAGTGAGGCAGGG + Intergenic
1057954518 9:99396895-99396917 GCCATTTCCCCAGAGAGGCAGGG + Intergenic
1060516700 9:124270400-124270422 CCCAGGTCCCCAGAGTGGGAGGG + Intronic
1060559741 9:124533168-124533190 TCCAGGCACCCAGAGAGGCTGGG + Intronic
1061237836 9:129352475-129352497 CACAGGCCCCCAGAGCGGCTGGG + Intergenic
1061291274 9:129651524-129651546 CCCTCGTCCCCAGACAGCCAGGG + Intergenic
1061807935 9:133146949-133146971 CCCAGGTCTCAAGGGAGGCTGGG - Intronic
1062295309 9:135822095-135822117 TCCACGTCGTCAGAGGGGCTGGG + Exonic
1062435837 9:136546198-136546220 CCCTCCTCCCCGGAGAGGCTGGG - Intergenic
1062566750 9:137167062-137167084 CCCTGGTGCCCAGAGAGGCTCGG - Intronic
1062570031 9:137180717-137180739 GCCCTGTCCCGAGAGAGGCTGGG + Intronic
1062594949 9:137295407-137295429 CCCTCGGCCCCAGGGAGGCGGGG - Intergenic
1062615826 9:137395259-137395281 CCCACAGCCCCAGGGAGACTCGG + Intronic
1189737846 X:44089625-44089647 TTCAAGTCCCTAGAGAGGCTGGG - Intergenic
1190008197 X:46759385-46759407 CCCACGACCCCAGACTGCCTGGG - Intergenic
1195854446 X:109315022-109315044 CCCACATCCCCTGACAGGCCCGG + Intergenic
1196284487 X:113863710-113863732 CACTCCTCCCCACAGAGGCTCGG + Intergenic
1197146884 X:123181723-123181745 GCCACGTCCCCAGCCATGCTTGG - Intergenic
1199675904 X:150189221-150189243 TCTACCTCCCCAGAGAGGCAGGG + Intergenic