ID: 1151362743

View in Genome Browser
Species Human (GRCh38)
Location 17:73598342-73598364
Sequence TGCCCTGCATGAGCCCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151362743_1151362745 -7 Left 1151362743 17:73598342-73598364 CCTGTGCGGGCTCATGCAGGGCA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1151362745 17:73598358-73598380 CAGGGCAGCTCAGATGGCACAGG 0: 1
1: 0
2: 4
3: 34
4: 267
1151362743_1151362746 13 Left 1151362743 17:73598342-73598364 CCTGTGCGGGCTCATGCAGGGCA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1151362746 17:73598378-73598400 AGGCCTCCCTGACAGCCAGCTGG 0: 1
1: 0
2: 5
3: 39
4: 232
1151362743_1151362749 19 Left 1151362743 17:73598342-73598364 CCTGTGCGGGCTCATGCAGGGCA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1151362749 17:73598384-73598406 CCCTGACAGCCAGCTGGCCGAGG 0: 1
1: 0
2: 1
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151362743 Original CRISPR TGCCCTGCATGAGCCCGCAC AGG (reversed) Intronic