ID: 1151364960

View in Genome Browser
Species Human (GRCh38)
Location 17:73611372-73611394
Sequence ACCAGTGTGGAGCACGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151364951_1151364960 26 Left 1151364951 17:73611323-73611345 CCATGATGAAGCCAGCGTCCTCT 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 105
1151364954_1151364960 15 Left 1151364954 17:73611334-73611356 CCAGCGTCCTCTCTCTGGCAGGG 0: 1
1: 1
2: 3
3: 22
4: 240
Right 1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 105
1151364958_1151364960 8 Left 1151364958 17:73611341-73611363 CCTCTCTCTGGCAGGGTCAGGGA 0: 1
1: 0
2: 2
3: 18
4: 273
Right 1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151364960 Original CRISPR ACCAGTGTGGAGCACGCCCC AGG Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901810416 1:11764198-11764220 AACAGTGAGGGGCAGGCCCCAGG + Intronic
901934579 1:12618605-12618627 CCGAGTGTGGAGCAGGCCCGGGG + Intergenic
904297044 1:29526573-29526595 ACCAGAGTGGAGCACACTCTGGG - Intergenic
904993362 1:34612002-34612024 ACCAGTGTGGAGAAGGGACCTGG + Intergenic
906674999 1:47687219-47687241 ACCAGTGTGAAGTACGGGCCTGG + Intergenic
909898996 1:81109442-81109464 TCCAATGTGGATCACGCCCAGGG - Intergenic
911178724 1:94842717-94842739 GCCAGTGTGGGGTCCGCCCCAGG - Intronic
911846062 1:102751964-102751986 ATCACTGTGAAGCAAGCCCCTGG + Intergenic
912709173 1:111937539-111937561 CCCAGTGTGGAGCAGTCCCCTGG - Intronic
913486025 1:119333505-119333527 AGCAGTCTGGAGCAGGGCCCAGG - Intergenic
918314339 1:183310557-183310579 ACCAGGGTTGATCACCCCCCAGG + Intronic
919740368 1:200977538-200977560 ACTAGAGTGGAGCTCTCCCCTGG - Intronic
1064612069 10:17114077-17114099 ACAAGTGTGGAGCAAGGCCCGGG + Exonic
1069838623 10:71325447-71325469 ACCAATGCGGGCCACGCCCCAGG + Intronic
1072253153 10:93597604-93597626 ACCAGTATGGAGCATGCCCAAGG + Intronic
1072408539 10:95177902-95177924 ACCTGTGTGGAGCACACACTCGG + Intergenic
1075328309 10:121552965-121552987 ACGGGTGTAGAGCACGTCCCTGG + Intronic
1075875462 10:125802513-125802535 ACCAGTGTGGAGAAGCCCTCTGG - Intronic
1076919590 10:133444791-133444813 ACCCGTGAGGACCACGGCCCTGG + Intergenic
1078348809 11:10575524-10575546 ACCAGTGTGGGGCAGTCACCAGG - Exonic
1083666706 11:64279237-64279259 ACCTGTGTGGATCATGCCCCCGG + Intronic
1084447006 11:69209569-69209591 ACGGGTGTGGAGCAGGCCCCGGG - Intergenic
1085151439 11:74255400-74255422 AACAGTGTGGAGGACCACCCAGG - Intronic
1085278936 11:75317666-75317688 GCCAGTGCGGTGCACACCCCTGG - Intronic
1085467939 11:76736918-76736940 ACCAGTGTGGGGCACCCCACAGG + Intergenic
1090435930 11:126686262-126686284 ACCAGTCTGGAGCAGGCCTTGGG - Intronic
1091468195 12:704000-704022 AACAGCGTGGAGCAAGCCCTTGG + Intergenic
1091629598 12:2149778-2149800 CCCAGGGGGGAGCACACCCCAGG + Intronic
1113489169 13:110677966-110677988 GCCAGTGGGCAGCACGCCCCAGG + Intronic
1114587948 14:23831990-23832012 AACAGAGTGGAGCATGCGCCTGG + Intergenic
1121641923 14:95490601-95490623 ACAAGTGTCCAGCAAGCCCCTGG + Intergenic
1122319985 14:100849311-100849333 ACCAGTGTGCAGAAGGCTCCAGG + Intergenic
1128695968 15:69763067-69763089 GCCAGTGTGGACCAGGACCCGGG + Intergenic
1130224539 15:82046918-82046940 ACCAGTGTCCAGCACACGCCCGG + Intergenic
1131533690 15:93216170-93216192 ATCTGTGTGGAGCTCGCGCCAGG + Intergenic
1132714130 16:1282398-1282420 ACCAGGGTGGAGGACGCCAGTGG + Intergenic
1133013827 16:2929791-2929813 ACCAGTTTGGAGAACTCCCTGGG - Exonic
1140449853 16:75062262-75062284 AGCAGCGTGGAGCACAGCCCCGG + Intronic
1141552197 16:84813530-84813552 GCCACTGTGGAGCACACCTCAGG + Intergenic
1142525424 17:536999-537021 CCCAGAGATGAGCACGCCCCAGG + Intronic
1146059421 17:29596644-29596666 CCCACGGTGGAGAACGCCCCAGG - Intronic
1146401588 17:32504220-32504242 GTGAGTGTGGATCACGCCCCCGG - Intronic
1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG + Intronic
1152160608 17:78666347-78666369 TCCAGCTTGGAGCAGGCCCCAGG + Intergenic
1152243923 17:79175512-79175534 TCCAGTGGGCAGCACGCCCGCGG - Intronic
1152749923 17:82057942-82057964 TGCAGTGGGGAGCAGGCCCCAGG - Exonic
1153385992 18:4496669-4496691 ACCATTGTGGAGCAGAGCCCTGG + Intergenic
1154079557 18:11242929-11242951 ACCAGTGTGGAGTGCTCCCAGGG + Intergenic
1154411277 18:14143466-14143488 AGCAGTGTGGAGAAGACCCCTGG + Intergenic
1157381558 18:47222752-47222774 ACCAGGCTGGAGCACTTCCCTGG + Intronic
1158869047 18:61666386-61666408 ACCAGTGTGAACCAAGCCCACGG - Intergenic
1160894169 19:1395027-1395049 AGCAGTGGGGAGCAGGGCCCGGG - Intronic
1161736507 19:5995203-5995225 CCCTGTGGGGAGCAGGCCCCAGG - Intronic
1165066617 19:33232846-33232868 ACCAGGGGAGACCACGCCCCAGG - Intergenic
1167042690 19:47032112-47032134 ACCTGTGTGTCCCACGCCCCAGG + Intronic
926048453 2:9727559-9727581 ACCAGAGAGGAGCTCACCCCTGG + Intergenic
926142276 2:10374855-10374877 ACCAGAGTGGAGAACTCCCTGGG + Intronic
926541152 2:14182771-14182793 CCCAGTGTGGGGCAGACCCCAGG - Intergenic
927857019 2:26534279-26534301 CCCTGTGTGGAGCAGGCCCCAGG - Intronic
929389960 2:41458701-41458723 GTCAGTGTGGAGGACACCCCTGG + Intergenic
946133829 2:217629109-217629131 ACCAGGTTGGAGATCGCCCCCGG + Intronic
946210531 2:218143842-218143864 CCCAGTGTGGAGCCCTCACCAGG + Intergenic
946621402 2:221567753-221567775 ACCGGTGTGGAGCCCACGCCAGG + Intronic
946939110 2:224752516-224752538 AGCAGTGTGGAGCACCACTCTGG - Intergenic
948458939 2:238119890-238119912 ACAAGTGTCCAGCAGGCCCCAGG - Intronic
1170307643 20:14957715-14957737 ACCAGTGTGTAGCACTTCTCTGG + Intronic
1170921959 20:20687570-20687592 ACCAGTCTGGAGCCAACCCCAGG + Intronic
1173528349 20:43749924-43749946 ACCAGAGGGCAGCACGGCCCCGG + Intergenic
1179525299 21:41972141-41972163 ACCAGTCAGGAGCAGGCCCTTGG - Intergenic
1183176012 22:36225282-36225304 CCCAGTGTGGAGCATGGTCCAGG + Intergenic
949917328 3:8975199-8975221 TCCAGTATGGAGCCGGCCCCGGG + Intergenic
954100997 3:48372568-48372590 AGCTGTGTGGATCAGGCCCCAGG + Intronic
955228227 3:57078584-57078606 ACCAGGGTGGAGGACGCCAAGGG - Intronic
956148951 3:66221184-66221206 ACCAGTGCAGAGAACGCCCGCGG - Intronic
957219927 3:77369173-77369195 AAGAGTGTGAAGCACACCCCGGG - Intronic
961565613 3:127761395-127761417 ACCAGGGTGGAGGCCTCCCCAGG + Intronic
961774207 3:129272364-129272386 ACCAGTGTGTAGCAGGTCCCGGG - Exonic
964548801 3:157864191-157864213 CCCAGTGTTGAGGACCCCCCCGG + Intergenic
966517016 3:180829720-180829742 ACCAGTTTGGAGAACTTCCCGGG + Intronic
968094791 3:195921265-195921287 ACCAGTGAGGACCAGGCCCAAGG - Intergenic
969138118 4:5047620-5047642 ACCAGTGCTGAGCAAGACCCTGG + Intergenic
969610381 4:8224799-8224821 ATCAGTGGGGAGCACGCTCTCGG - Intronic
971969734 4:33605851-33605873 ACCAGTGTGGAGGAAGGGCCTGG - Intergenic
976297877 4:83489829-83489851 ACCAGAGTGGAGCATGTCCATGG - Intronic
989195870 5:38715721-38715743 ATCAGTATGGTGCAGGCCCCAGG - Intergenic
990519564 5:56565753-56565775 AACTATGTGGAGCACGCCCAAGG + Intronic
993740145 5:91528759-91528781 AACAGTGTGGAGAAAGCCCAGGG - Intergenic
995367893 5:111384449-111384471 ACCAGTGTGGCTCAAGCCACAGG - Intronic
1002057911 5:176609506-176609528 ACCAGTGTGGCACACACTCCGGG - Intronic
1003824880 6:9942195-9942217 ACAAGTGTGGCGCACAGCCCTGG - Intronic
1008459669 6:51753490-51753512 ACCTTTGTGGAGAATGCCCCAGG - Intronic
1010142017 6:72622643-72622665 GCGAGCGCGGAGCACGCCCCAGG - Intronic
1020428128 7:8092694-8092716 ACCACTCTGCAGCAAGCCCCGGG + Intronic
1022645948 7:32228757-32228779 ACCCATGTGGAGGACTCCCCAGG + Intronic
1023602769 7:41896458-41896480 ACTAGTGTGGTCCATGCCCCCGG - Intergenic
1023938234 7:44754730-44754752 ACCAGTGGTCAGCACGCCTCAGG + Intronic
1024210630 7:47200371-47200393 ACCAGTGTGCAGCACCAGCCTGG - Intergenic
1032311063 7:130787556-130787578 TCCTTTGTGGAGCAGGCCCCTGG + Intergenic
1032841148 7:135714510-135714532 CCCAGTGTGGAGCTCAGCCCTGG + Intronic
1035280498 7:157775526-157775548 AGGAGCGTGGAGCACGCCCGGGG + Intronic
1035477888 7:159156582-159156604 GCCGGTGTGGAGCAAACCCCTGG + Intergenic
1035564597 8:633052-633074 ACCAGTGTGGGGCCCGCGCGGGG + Intronic
1035564620 8:633148-633170 ACCAGTGTGGAGCCCGCGTGGGG + Intronic
1036110678 8:5897690-5897712 ACCAGAGAGGAGCAAGCCACGGG + Intergenic
1039743420 8:40402515-40402537 AACAGTGTGCAGCACCTCCCAGG - Intergenic
1040988927 8:53328234-53328256 ACCAGAGTGGAGCGTGCCTCTGG - Intergenic
1049257274 8:141620656-141620678 ACCAGTGTGGGGCTCACTCCAGG + Intergenic
1049409047 8:142464316-142464338 ACCAGCGTGGCGCACGGCTCGGG - Exonic
1054158908 9:61659889-61659911 AACTTTGTGGAGCAGGCCCCGGG - Exonic
1054449713 9:65397302-65397324 AACTTTGTGGAGCAGGCCCCTGG + Intergenic
1054478682 9:65590894-65590916 AACTTTGTGGAGCAGGCCCCGGG - Intergenic
1061676811 9:132221965-132221987 AGCAGTGCGGAGCACAGCCCCGG + Intronic
1062482393 9:136758555-136758577 GGCAGTGTGGAGCCCGGCCCTGG + Intergenic
1191995279 X:67088950-67088972 AGCAGGGTGGACCAGGCCCCAGG + Intergenic
1195046865 X:101062402-101062424 TCCAGTGTGGAGCAGGACCCAGG - Intergenic