ID: 1151365015

View in Genome Browser
Species Human (GRCh38)
Location 17:73611546-73611568
Sequence CCATGTGAGCAGAGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151365015_1151365021 3 Left 1151365015 17:73611546-73611568 CCCTGTGGCCTCTGCTCACATGG 0: 1
1: 0
2: 6
3: 37
4: 404
Right 1151365021 17:73611572-73611594 GTGGAATGAGCACGGCCTCATGG 0: 1
1: 0
2: 1
3: 4
4: 110
1151365015_1151365020 -5 Left 1151365015 17:73611546-73611568 CCCTGTGGCCTCTGCTCACATGG 0: 1
1: 0
2: 6
3: 37
4: 404
Right 1151365020 17:73611564-73611586 CATGGTAAGTGGAATGAGCACGG 0: 1
1: 0
2: 1
3: 38
4: 621
1151365015_1151365022 6 Left 1151365015 17:73611546-73611568 CCCTGTGGCCTCTGCTCACATGG 0: 1
1: 0
2: 6
3: 37
4: 404
Right 1151365022 17:73611575-73611597 GAATGAGCACGGCCTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151365015 Original CRISPR CCATGTGAGCAGAGGCCACA GGG (reversed) Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900647603 1:3716000-3716022 ACAGGTGAGCAGGAGCCACACGG - Intronic
900810834 1:4800340-4800362 CCAAGTGACCAGGGGCCCCATGG + Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
901277598 1:8004816-8004838 CCATGGAAGCACAGGCCACCTGG + Intronic
902870038 1:19308371-19308393 TCATGAGAGCAGAGGCACCAGGG - Intronic
903005092 1:20293173-20293195 CCAGGTGAGTAGGGGCCACAGGG - Intronic
903353203 1:22730592-22730614 ACGTTTGAGCAGAGGCCAGAAGG + Intronic
903673960 1:25052947-25052969 CCATGGGAGCAGCTGCCACCTGG - Intergenic
904363936 1:29998795-29998817 CATTCTGTGCAGAGGCCACAGGG + Intergenic
904607387 1:31705250-31705272 CCGGGTTAGCCGAGGCCACAGGG - Intergenic
905168877 1:36098617-36098639 CCAGGGGAGCAGGGCCCACAGGG - Exonic
905462128 1:38128924-38128946 CCATGTGAGGTGTGGCCAGAGGG - Intergenic
905501421 1:38441957-38441979 CTATGTGAACAGAGGCTAAAGGG - Intergenic
906143694 1:43547986-43548008 GCTTGTGAGCAGTGACCACAGGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
907262803 1:53234060-53234082 CCTTGAGGGCAGAGGCCCCAGGG + Intronic
907314321 1:53558856-53558878 ACATCTGAGCAGAGTCTACATGG - Intronic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
907628473 1:56055569-56055591 CCATGAGAGCAGAGCCCTCCTGG - Intergenic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
909012449 1:70350217-70350239 CCTTGTGAGCAAAGACAACAGGG - Intronic
911116567 1:94251740-94251762 CCATTTGAGGAGAGACCAGAAGG - Intronic
912078914 1:105911680-105911702 CCATCTCAGGAGAGGCTACAAGG + Intergenic
912884495 1:113455718-113455740 CTATGAGAGCAGATGGCACAGGG - Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913984570 1:143553194-143553216 CAATGAGAGCAGAGTCCTCAGGG + Intergenic
916850661 1:168700179-168700201 TCATGAGAGCAGAGCCCTCATGG - Intronic
917629049 1:176875213-176875235 CAATGTGTGCAAAGGCCTCATGG + Intronic
920159564 1:203985908-203985930 TCATGAGAGCAGAGCCCTCATGG + Intergenic
921165508 1:212503996-212504018 CCATGTGAGGACTGGCAACACGG + Intergenic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
921347958 1:214206658-214206680 CCATGTGACCAGAAGCAAAAGGG - Intergenic
921889766 1:220342085-220342107 GTAGGTGAGCAGAGACCACATGG - Intergenic
922025683 1:221746453-221746475 TCATGAGGGCAGAGGCCTCATGG + Intergenic
922111381 1:222560016-222560038 CCATGAGAGCTGAAGTCACAGGG + Intronic
922201362 1:223404345-223404367 CAATGCCAGCAGAGACCACAGGG + Intergenic
922221339 1:223610733-223610755 CCAAGTAAGCAGGTGCCACAAGG + Intronic
922812958 1:228428247-228428269 CCCTGTGTGCAGAGGTCACAGGG + Intergenic
922914775 1:229248207-229248229 TCATGCGAGCAGAGTCCTCACGG + Intergenic
923150209 1:231226320-231226342 CCATGTGTACAGAGATCACATGG - Intronic
924793780 1:247277422-247277444 TCATGAGAGCAGAGGCCTCATGG + Intergenic
1063835813 10:10010533-10010555 CCTTGCCAGCAAAGGCCACATGG + Intergenic
1064241220 10:13631286-13631308 CCATGTGAACAGAGGCCTCTCGG - Intronic
1067452083 10:46387978-46388000 TCATGTCAGCTGGGGCCACATGG - Intronic
1067521998 10:47014549-47014571 CCAGGTGAAGAGAAGCCACATGG + Intergenic
1067585154 10:47471777-47471799 TCATGTCAGCTGGGGCCACATGG + Intronic
1067774010 10:49148503-49148525 CCATGTCCCAAGAGGCCACAGGG - Intergenic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG + Intergenic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1075907284 10:126092727-126092749 CCATTTGGGCAGAGGCTTCAGGG - Intronic
1076897913 10:133323168-133323190 CCTGGTGTGCAGAGACCACAGGG - Intronic
1077217455 11:1400883-1400905 CCAGAGGAGCAGACGCCACAGGG - Intronic
1077396632 11:2327051-2327073 CCAAGGGAGCAGAGGACACTCGG - Intergenic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077725512 11:4671248-4671270 TCATGTCAGCAAAGGCCAAATGG - Intergenic
1078366288 11:10709112-10709134 CCATGAAAGCACAGGCCAAATGG - Intergenic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1080450749 11:32376969-32376991 CCATCTGGGGAGAGGACACATGG - Intergenic
1080714909 11:34790736-34790758 CCATGTCATGAGAAGCCACATGG + Intergenic
1080767281 11:35308648-35308670 CCATGAAAGCAGAGACCTCATGG + Intronic
1080769256 11:35325336-35325358 CCTTGAGAGCACAGGCGACATGG - Intronic
1081008725 11:37781251-37781273 CCTTGTGAGCCCATGCCACAAGG + Intergenic
1081453342 11:43194990-43195012 GCATGGGAGAAGAGGGCACATGG - Intergenic
1082004905 11:47414090-47414112 CCATGTAAGTCGAGGCCCCAAGG - Intronic
1082793987 11:57366898-57366920 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082794368 11:57369096-57369118 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1083764072 11:64833792-64833814 GCATCTCAGGAGAGGCCACAAGG - Exonic
1083965306 11:66040117-66040139 CCAAGTATGCAGAGACCACAGGG - Intergenic
1084080252 11:66818482-66818504 CTATGTGAGCATAAGCCACAGGG - Intronic
1084899741 11:72300682-72300704 CCATGTCATAGGAGGCCACAGGG - Intronic
1085644766 11:78215891-78215913 CCATGGGAGAAGGGGCCAGAGGG + Exonic
1085794024 11:79520363-79520385 CCAGGTGAGCAGGGGCCAGGAGG - Intergenic
1085897065 11:80652875-80652897 CCATGGGAGAAGAGTCCCCATGG - Intergenic
1086882661 11:92167587-92167609 GCATGTTAGCAGAAGCCATAAGG + Intergenic
1087632341 11:100664962-100664984 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1091348522 11:134873261-134873283 CTGTGTGTGCAGAGACCACATGG - Intergenic
1091651557 12:2313996-2314018 CTATGTGGGCACAGGGCACACGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1093135083 12:15440011-15440033 CCCTGTGTGCAGAGGCTACAGGG + Intronic
1094096704 12:26713141-26713163 GCATGTGAGCAGAGGCCTGCAGG + Intronic
1094289391 12:28830202-28830224 TGCTGTGAGCAGAGCCCACATGG + Intergenic
1095214459 12:39531357-39531379 TCATGAGAGCAGAGACCTCATGG + Intergenic
1096521484 12:52187075-52187097 CCAAGGGAGGAGAGGCCCCAAGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097057266 12:56257725-56257747 TCATCTGAGCAGAGGAGACACGG + Intronic
1097228039 12:57490489-57490511 CCAGGTGAGGAGGGCCCACAGGG - Intronic
1097575362 12:61386474-61386496 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1099375514 12:81892893-81892915 CCATGTTAGGAAAGGCCAAATGG + Intergenic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1100576321 12:95894624-95894646 ACATGTGTACAGAGACCACATGG - Intronic
1100789541 12:98115417-98115439 CCATGTGAGCATAAGTCATAGGG + Intergenic
1100799267 12:98213994-98214016 CCATGATAGCAAAGGGCACAAGG + Intergenic
1101356692 12:103985701-103985723 CCATTTGAAGAGAAGCCACAAGG - Exonic
1101693800 12:107105864-107105886 CCATCTGTGCAGAGGCCAGTAGG - Intergenic
1102819437 12:115895430-115895452 TCATGCCAGCAGTGGCCACAGGG + Intergenic
1102907502 12:116688077-116688099 CCCTAGGAGCAGAGGCCACGCGG - Intergenic
1104040986 12:125130473-125130495 CCTTGGGAGGAGAGGCCAAAAGG + Intronic
1104754501 12:131260614-131260636 CCATCTGAGAAGAGTCCACGTGG + Intergenic
1105024983 12:132842193-132842215 CCCTGTCAGCAGATGCCACGGGG - Intronic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1107664753 13:42677382-42677404 GGATGTGAGAAGAGGCCTCACGG + Intergenic
1109023924 13:57136246-57136268 CAATGTGAGCAGAAGTGACAAGG + Intergenic
1109733111 13:66442769-66442791 CTATGTGAGGAGAGTCCAAATGG - Intronic
1110516741 13:76421716-76421738 ACATTTGATCAGAGGCCATATGG - Intergenic
1111020800 13:82447504-82447526 CCATGTGAGATGATGCCAAAAGG + Intergenic
1111656276 13:91157534-91157556 CCATTGGAGCAGAGTCCACATGG - Intergenic
1111874245 13:93873532-93873554 TCATTTGGGTAGAGGCCACAGGG + Intronic
1115803164 14:37019217-37019239 GCAACTGAGAAGAGGCCACATGG - Intronic
1115820806 14:37210730-37210752 TCATGTGGCCAGAGGTCACAAGG - Intronic
1116439985 14:44940214-44940236 TCATGAGAGCAGAGCCCTCATGG + Intronic
1117097055 14:52309692-52309714 CCAGGTTAGCATTGGCCACAAGG + Intergenic
1117180057 14:53182370-53182392 TCATGTGGCCAGAGGTCACAAGG + Intergenic
1118630409 14:67697317-67697339 ACATTTGAGCGGAGGCCAGAGGG + Intergenic
1119192010 14:72689324-72689346 GCATGTGAGCGGAGGCCTAATGG - Intronic
1119277304 14:73370158-73370180 TCATGTGGGCAGAGCCCTCATGG - Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1121215706 14:92246102-92246124 CAGTGTGTGCAGAGACCACATGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1122588346 14:102826762-102826784 CCATCTGAGCAGAGGCCGCGTGG + Intronic
1122763640 14:104049700-104049722 CTACATGAGCAGAGGCCACGTGG + Intronic
1122788969 14:104176451-104176473 CCAGGCGAGCACAGCCCACACGG - Exonic
1123685686 15:22795537-22795559 CCCTGTGTGAAGAAGCCACAGGG - Intronic
1124177235 15:27437864-27437886 CCATGTGTGCAGAGATCCCATGG + Intronic
1124477719 15:30049411-30049433 CCATGAGGGCAGAGCCCCCATGG + Intergenic
1125087561 15:35748143-35748165 CCATGTGTGCACAGGGCCCAGGG + Intergenic
1125454831 15:39846433-39846455 CCATATCAACAGAGGCCAGATGG + Intronic
1125507917 15:40277725-40277747 CCAGGGGAGAAGAGCCCACAAGG + Intergenic
1125578508 15:40770379-40770401 CCCTAGGAGCAGAGGCCTCAGGG - Exonic
1125881138 15:43197050-43197072 CAACGTGAGCAGAGATCACAGGG - Exonic
1126931777 15:53661338-53661360 CCATGTGTGCAGAGATCACATGG + Intronic
1127042029 15:54987835-54987857 TCATGTGGCCAGAGGTCACAAGG - Intergenic
1127322723 15:57863373-57863395 CCAGGTGAGCAAGGTCCACAGGG - Intergenic
1129582550 15:76827962-76827984 TCATGAGAGCAGAGCCCTCATGG - Intronic
1129820204 15:78595790-78595812 TCATGAGAGCAGAGCCCCCATGG - Exonic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1130927867 15:88398622-88398644 CCATGGGGGCAGAGCCCTCAAGG - Intergenic
1132257202 15:100385953-100385975 GCATGTCAGCAGAGGTCTCAGGG + Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132574359 16:657748-657770 CCATGTCCGCTGTGGCCACACGG - Exonic
1132695159 16:1198792-1198814 CCATCTGGGCAGGGGCCTCACGG - Intronic
1132752457 16:1465092-1465114 CCAAGTGAGCAGAGGCAGCTGGG - Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1132864254 16:2085807-2085829 GCTTCTGAGCAGAGGGCACATGG + Intronic
1132882424 16:2168299-2168321 CCATGTCTGCCGAGGCCTCAGGG - Intronic
1134008949 16:10836948-10836970 CCACGTGTGCAGAGATCACATGG - Intergenic
1134605093 16:15564046-15564068 TCATGTGTGCAGAAGTCACAGGG - Intronic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135907048 16:26521787-26521809 CGCTGTGTGCAGAGACCACATGG - Intergenic
1136011152 16:27364041-27364063 CCATGAGAGTAGAGGGCACTGGG + Exonic
1137480034 16:48844683-48844705 CCATTTGAGCAGAGTCCTGAGGG - Intergenic
1137683994 16:50373324-50373346 CCGTGTGGGCAGAGGCCATGTGG - Intergenic
1138135486 16:54517653-54517675 ACATGTAAGCAGAGGCCTGAAGG - Intergenic
1138695746 16:58811563-58811585 CCATGGGGACAGAGCCCACATGG + Intergenic
1138781675 16:59796116-59796138 CCATCTGAGCAGAGACAAGAAGG - Intergenic
1139056320 16:63189263-63189285 CTATTTGAGCAGAGGCAACTGGG - Intergenic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1141578697 16:84982519-84982541 CCCTGTCAGCAGGGGCTACAGGG - Intronic
1141688553 16:85583847-85583869 CCCTGGGAGCAGAGGCCGCCGGG - Intergenic
1141914188 16:87082749-87082771 CTATCGGAGCAGAGGTCACAAGG - Intergenic
1142022329 16:87791615-87791637 CCAGGAGAGCAGAGGCCTCTGGG - Intergenic
1142313616 16:89329115-89329137 CCGTGGGAGTAGAGTCCACAGGG - Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142929658 17:3272018-3272040 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143858242 17:9868632-9868654 CCAGATGAGCAGAGGCTTCATGG + Intronic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144950600 17:18991638-18991660 CCATGTGAGCAGCTGGCACAGGG + Intronic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1146937478 17:36821266-36821288 CAATGTGTCCAGAGGCCACAGGG - Intergenic
1148896388 17:50841493-50841515 TGCTGTGAGCAGAGGCCACTCGG + Exonic
1150076588 17:62197610-62197632 TAATGTGAGAAGTGGCCACAAGG - Intergenic
1150157507 17:62866428-62866450 CCAAGTGGGCAGGGGCCAAATGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1150857410 17:68766387-68766409 TGGTGTGTGCAGAGGCCACATGG + Intergenic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151510015 17:74552538-74552560 ACATCTGAGAAGAGGCCACCAGG - Intergenic
1152810776 17:82381454-82381476 CCATGTGTGCACATGACACAGGG - Intergenic
1152810814 17:82381784-82381806 CCATGTGTGCACATGACACAGGG - Intergenic
1153489618 18:5633403-5633425 TCATGTGAGGAGAGACCAAAGGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1156451368 18:37268167-37268189 CCATCTGAGCAGAGCCCCCGTGG - Intronic
1157524268 18:48367676-48367698 CCATGTCAGCAAAGGCCACATGG + Intronic
1158679240 18:59551960-59551982 CCAGCTGAGCTTAGGCCACATGG - Intronic
1158954512 18:62524951-62524973 CCCTCAGAGCAGAAGCCACAAGG - Intronic
1159026575 18:63187958-63187980 CCCTATGAGCAGGGGCCAAATGG - Intronic
1159494799 18:69188997-69189019 TCATGTGAGCAGAGCCCTCGTGG - Intergenic
1159690858 18:71485724-71485746 TCATGTTATTAGAGGCCACAAGG + Intergenic
1159961592 18:74559439-74559461 CCATGTCCACCGAGGCCACACGG - Exonic
1160212727 18:76895981-76896003 CCACGTGGGCACTGGCCACAGGG + Intronic
1160366888 18:78334081-78334103 CCATGGCTGCAGTGGCCACATGG - Intergenic
1161258931 19:3324887-3324909 CCATTTGAGTTGAGGCCAGATGG - Intergenic
1162095849 19:8309551-8309573 CAGGGTGTGCAGAGGCCACAAGG - Intronic
1162341063 19:10091827-10091849 CCATGGGGGCAGAGGCCATGGGG - Intronic
1162400645 19:10444570-10444592 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1162753538 19:12843494-12843516 CAAGGTGCTCAGAGGCCACAAGG - Intronic
1162971934 19:14185947-14185969 CTATCTGAGCAGAGGCCTGAAGG - Intronic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1163999247 19:21082244-21082266 CTCTGCGAGCAGAGGACACAGGG - Exonic
1165181279 19:33973079-33973101 CAGTGTGTGCAGAGACCACACGG - Intergenic
1165329396 19:35133150-35133172 CCATGTCAGCAGCAGCAACAGGG + Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166948474 19:46411675-46411697 CCAGCTGACCAGAGGTCACAGGG - Exonic
1167054655 19:47102081-47102103 CAATGTGAGGAGAGGCTGCAAGG + Intronic
1168009379 19:53518302-53518324 GCCTGTGGCCAGAGGCCACAGGG - Intergenic
924964067 2:59349-59371 CCATCTCAGGAGAGGTCACAAGG + Intergenic
925708185 2:6710577-6710599 CAGTGTGTGCAGAGACCACATGG - Intergenic
925802042 2:7611044-7611066 CCAGGTGAGCAGAGCAGACAGGG - Intergenic
927138079 2:20111872-20111894 ACAAGTGAGCAGAGGGCTCAAGG + Intergenic
927665095 2:25026418-25026440 CCCAGTCAGCAGAGGCCAAATGG + Intergenic
927963651 2:27256392-27256414 CCAGGTGTGCAGAGGCAACATGG + Exonic
928125095 2:28610058-28610080 ACATTTAAGCAGAGGCCATAGGG - Intronic
928810427 2:35218169-35218191 CCATGTGAACAGGGTCCACTTGG - Intergenic
930171100 2:48252567-48252589 GCATCTGAGCAGAGGACAAAAGG + Intergenic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931803126 2:65778164-65778186 CTGTGTGTGCAGAGACCACAGGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
937096281 2:119237322-119237344 CCATGTGTGCAGAGATCACCTGG + Intronic
937206334 2:120239260-120239282 TCAAGTGAGCAGAGCACACAGGG + Intergenic
937260692 2:120585315-120585337 CCATGCGTGCAGAGATCACATGG + Intergenic
937775845 2:125774967-125774989 ACAAGGGAGCTGAGGCCACAGGG - Intergenic
938291514 2:130153233-130153255 CCTTGTGAGCAGAGGCCATCAGG - Intronic
938465033 2:131519730-131519752 CCTCGTGAGCAGAGGCCATCAGG + Intergenic
939082575 2:137680416-137680438 CCCTGTGGGCAGAGGCCCCGGGG + Intergenic
942489263 2:176473714-176473736 CACTGTGAGCAGAGGTCACCAGG + Intergenic
947352852 2:229264449-229264471 CCAAGTGATCAAGGGCCACAAGG + Intronic
947544603 2:231001926-231001948 GCATGTGAGCCGAGTCCAGAAGG + Intronic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948790248 2:240373071-240373093 CCTTGTAAGAAGAGGCCAGAGGG - Intergenic
1169353558 20:4889576-4889598 TCATGTGAGCGGATGCCAAAGGG - Intronic
1170869006 20:20187382-20187404 ACACGTGAGCAGAGGCTCCAAGG + Intronic
1171364656 20:24615612-24615634 GCCTGTGAGAAGAGGCCACTTGG - Intronic
1172069555 20:32246557-32246579 ACATTTGAGCAGAGGCCTGAAGG + Intergenic
1172435245 20:34924436-34924458 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1172902339 20:38344266-38344288 CAAGCTGAGCAGAGGCCTCAGGG - Intergenic
1173590281 20:44219728-44219750 CCCTGTGAGCAGTGGCCACAGGG - Intergenic
1173861172 20:46284679-46284701 TCATGTGAGCCAAGGCCACAGGG + Intronic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1174289709 20:49499375-49499397 CCGTGTGTGCAGAGACCTCATGG + Intergenic
1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG + Intronic
1175383090 20:58577156-58577178 GCATGTGGGCAGTGCCCACATGG - Intergenic
1175642287 20:60640957-60640979 ACAAGTGAGCAGAGTCAACATGG + Intergenic
1175714279 20:61245359-61245381 CCAAGTGATCAGACACCACATGG - Intergenic
1175872285 20:62214210-62214232 CCAGGTGCTCAGAGGCCACTTGG - Intergenic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1176372628 21:6071599-6071621 CTATGGTTGCAGAGGCCACAAGG - Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1178117335 21:29430831-29430853 CCATGTGCTCAGAGACCAAAGGG - Intronic
1179058740 21:37959958-37959980 CCATTTGATCAGTGGCAACAAGG + Intronic
1179497269 21:41780508-41780530 CAGTGTGAGCACAGTCCACAGGG + Intergenic
1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG + Intergenic
1180786872 22:18552495-18552517 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181243783 22:21492016-21492038 CCATGTGAGCAGCAGCCAGCGGG + Intergenic
1181392227 22:22591993-22592015 CCCTGTAAGCAGTGTCCACATGG - Intergenic
1181522361 22:23456975-23456997 CCACGTGAGCAGTGCTCACACGG - Intergenic
1182087493 22:27571401-27571423 TCAAGGGAACAGAGGCCACAGGG + Intergenic
1183572927 22:38667806-38667828 TCATGAGAGCAGAGCTCACATGG + Intronic
1185022788 22:48389828-48389850 CCCTGTAAGGAGAGACCACAGGG + Intergenic
950372339 3:12541778-12541800 CTCTGTGAGCTGAGGCTACACGG + Intronic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
954746414 3:52789962-52789984 ACATGTCTGCACAGGCCACATGG - Intronic
954888056 3:53894080-53894102 ACACATGAGCAGAGGCAACAAGG - Intergenic
955698554 3:61660507-61660529 CTATGTGAACAGAGGCGAGAGGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
956368235 3:68529673-68529695 CTGTGTGTGCAGAGACCACATGG + Intronic
956557817 3:70541554-70541576 CCATCTCAGGAGAGGCTACAAGG - Intergenic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
956866764 3:73376799-73376821 CACTGTAAGCAGAGGCCACAAGG - Intergenic
957167184 3:76690357-76690379 TCATGAGAGCAGAGCCCTCATGG + Intronic
958467012 3:94471493-94471515 CCATCTCAGGAGAGGCTACAAGG - Intergenic
959720243 3:109478849-109478871 CCATGTGTGCAGAGACTGCATGG - Intergenic
960131899 3:114065693-114065715 CCCTGGGAGCAGTGGCGACATGG - Intronic
960241673 3:115349663-115349685 CAATGTGTGCAGAGATCACACGG - Intergenic
960527021 3:118721454-118721476 CCATGCCAGCAAAGGCCAAATGG - Intergenic
961366290 3:126401943-126401965 CCATGGGAGCAGAGCCCCAAGGG - Intronic
961755203 3:129122766-129122788 CCTTGTGAGGAGAGGACCCAGGG + Intronic
963793301 3:149605991-149606013 TCATGGGGGCAGAGCCCACATGG + Intronic
964359344 3:155878108-155878130 GCATGAGGGCAGAGCCCACACGG - Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966855804 3:184193202-184193224 TCATCTGAGCAAAGGCCACTCGG - Exonic
968973845 4:3810950-3810972 CCGTGTGTGCAGAGACCACATGG + Intergenic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
969212535 4:5698898-5698920 CCATGTGAACAGTAGCCACATGG - Intronic
970186509 4:13460309-13460331 CCATGTGAGGATAGGCAAGAAGG - Intronic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
972639948 4:40916351-40916373 TCTTGTGAGCAGAAGCCACAAGG - Intronic
975090888 4:70402772-70402794 CCATGCAAGCAGAGGAAACAGGG + Intronic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
976613518 4:87053247-87053269 TGATGTGACAAGAGGCCACAAGG - Intronic
976768219 4:88620860-88620882 CCATGGGAGCAGAGACCTGAAGG - Intronic
977954373 4:103010382-103010404 CCATGTGGGCACAGCCCTCAAGG + Intronic
978184187 4:105837443-105837465 CCATGTGATGAAGGGCCACATGG - Intronic
979669482 4:123347104-123347126 CCATGTGTGCAAAGACGACATGG - Intergenic
981239064 4:142452628-142452650 CCAGCTGACCAGTGGCCACACGG + Intronic
981312971 4:143314668-143314690 CTATGTGAGAAGACACCACAAGG - Intergenic
985231155 4:187819719-187819741 TCATGAGGGCAGAGGCCTCATGG - Intergenic
985552921 5:542431-542453 CCCTGGGAGCACAGGCCCCATGG + Intergenic
985649953 5:1102811-1102833 CCACGTGAGCTGATGCCACTGGG - Intronic
986353461 5:6902298-6902320 CCCTGTGAACAGTGGCCACCTGG + Intergenic
986504068 5:8430535-8430557 CCATGAGTGCTGGGGCCACAGGG - Intergenic
987478288 5:18419846-18419868 CCAGGAGAGTAGAGCCCACATGG - Intergenic
987718976 5:21610502-21610524 CCATCTGAAGAGAGGCCAGATGG - Intergenic
987856614 5:23426864-23426886 TCATGTGGGCAGTGGCCTCATGG - Intergenic
988581356 5:32471704-32471726 TCTTGGGAGCAGAGGCCTCAAGG - Intergenic
990055578 5:51572737-51572759 CCATGAGAGTAGAGGCCTCATGG - Intergenic
991044091 5:62204948-62204970 GCATGGAAGCAGAGGCCACCGGG - Intergenic
992072155 5:73158157-73158179 TCATGTGTGCAGAGATCACATGG + Intergenic
992558262 5:77924477-77924499 GCATATGCGCAGAGACCACACGG - Intergenic
992688945 5:79224530-79224552 TCATGTGGCCAGAGGTCACAAGG - Intronic
995829128 5:116334361-116334383 CCATGGCAGCTTAGGCCACAGGG - Intronic
995972630 5:117990905-117990927 GCATTTTAGCAGAGGCTACATGG + Intergenic
996590416 5:125140550-125140572 CCATGAGGACAGAGGCCTCATGG + Intergenic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
999100474 5:149019943-149019965 CCCTGTGAGCAGAGGCTTCCAGG - Intronic
999280209 5:150360311-150360333 CCTTTGGAGCAGAGGCCAGAGGG - Intronic
999812706 5:155142973-155142995 CAATGTGTGCAGAGACCACATGG + Intergenic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001365431 5:171133645-171133667 CCATGTGGGCATAGGCTACCCGG + Intronic
1001859404 5:175040355-175040377 CCATGTGAGGACAAACCACATGG - Intergenic
1002074314 5:176699073-176699095 CCAGATGCACAGAGGCCACAAGG - Intergenic
1002374650 5:178780010-178780032 CCTTGGGAGGAGAGGCCAAAAGG - Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003173746 6:3739555-3739577 CCACGTGGACAGAGGCCCCAGGG - Intronic
1003855865 6:10273924-10273946 TAATGTGAGTGGAGGCCACAGGG + Intergenic
1004624168 6:17359059-17359081 GCATGTGTGCAGAGATCACATGG - Intergenic
1004756885 6:18619747-18619769 CAATGTGTGCAGAGATCACATGG - Intergenic
1005169719 6:22968949-22968971 CTATGAGAGCAGAGCCCTCATGG + Intergenic
1005337212 6:24809240-24809262 TCAGATGGGCAGAGGCCACAGGG + Intronic
1005338573 6:24821647-24821669 TCAAGTGAGTAGAGGCCAAAAGG - Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1007292725 6:40799432-40799454 CCATTTGGGTAGAGCCCACAGGG + Intergenic
1007336289 6:41157328-41157350 CCATGTGAGCTATGGCCACAGGG + Intergenic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1008682665 6:53890489-53890511 CCTTGTGACCGGGGGCCACATGG - Intronic
1010131481 6:72499512-72499534 CCAGGTAAGCAGTGTCCACACGG + Intergenic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1011731234 6:90266149-90266171 CCATGGGTGCAGTGGCCGCAAGG - Intronic
1011961653 6:93098388-93098410 CCTTCCTAGCAGAGGCCACAGGG - Intergenic
1012155357 6:95813062-95813084 ACATGTCAGTAGAGGCCACATGG - Intergenic
1012305167 6:97647033-97647055 CCGTGTGTGCAGAGATCACATGG + Intergenic
1012414594 6:98999495-98999517 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1015182819 6:130379069-130379091 CCATGAGGGCAGAGGCCTCGTGG + Intronic
1015871437 6:137780169-137780191 CCACCACAGCAGAGGCCACACGG - Intergenic
1017275750 6:152565971-152565993 TGATGGGAGCAGAGGGCACAGGG + Intronic
1017334275 6:153237045-153237067 ACGTGTCAGCAGAGACCACATGG - Intergenic
1017849555 6:158293256-158293278 CCCTGTGAGCAAAAGCCACAAGG - Intronic
1018002802 6:159594627-159594649 CCAAGTTGGCAGCGGCCACATGG + Intergenic
1018202245 6:161405770-161405792 CCATTTGAGAAGTGGCAACAGGG + Intronic
1018633578 6:165841359-165841381 CCTGGTCAGCAAAGGCCACAGGG - Intronic
1018735818 6:166686516-166686538 GCCTGTCAGCAGAAGCCACATGG - Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1018951624 6:168382015-168382037 CTATGTGTCCACAGGCCACAGGG - Intergenic
1019343037 7:517489-517511 TCCTGCAAGCAGAGGCCACACGG + Exonic
1019636652 7:2079567-2079589 CCAGATAAACAGAGGCCACACGG + Intronic
1019641880 7:2107632-2107654 GCATCTGAGCAGAGGCCTGAGGG - Intronic
1020565760 7:9793622-9793644 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1020664932 7:11028764-11028786 CCTTTTGAGCACAGGTCACATGG - Exonic
1021130017 7:16900308-16900330 CCTTGTGAGCCCAGGCCACCAGG - Intergenic
1021174224 7:17432063-17432085 CCATGTGAGCAGCCGCACCAAGG + Intergenic
1022245675 7:28556908-28556930 CCATGTGGGGAGAGGGCACGTGG - Intronic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1025236320 7:57237117-57237139 CCCTTTGAGCAGAGGCCTGAAGG - Intergenic
1025501230 7:61301619-61301641 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025516090 7:61647842-61647864 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025540427 7:62076668-62076690 CTATGTCCCCAGAGGCCACAAGG + Intergenic
1025751705 7:64299573-64299595 CCATGTGAGCAGGGCCCAGCAGG + Intergenic
1025782279 7:64612369-64612391 CCATGTGAGCAGGGCCCAGGTGG - Intergenic
1026069441 7:67104996-67105018 CCATGTGAGTAGAGGCCCCTGGG - Intronic
1026892401 7:73989981-73990003 ACACATGAGCAGAGGCCACAGGG + Intergenic
1030828253 7:114187947-114187969 CCATGAAAGCAGAGCCCTCATGG + Intronic
1031162803 7:118188936-118188958 CCAAGTAAACTGAGGCCACAGGG - Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1031619101 7:123914521-123914543 CAATGTGAGCAGAGGTGAAAGGG + Intergenic
1032975591 7:137218872-137218894 CCATGTGGGAAGAGACTACATGG + Intergenic
1034678398 7:152909466-152909488 CCATGTGAAGAGACGGCACAGGG + Intergenic
1034726449 7:153340588-153340610 CCCTGTGTGCAGAGGTCACATGG + Intergenic
1034904122 7:154929069-154929091 CCCTGTGAGCTGAGGGCACTTGG - Intronic
1034932879 7:155177126-155177148 CCACGAGAGCAGAGCCCTCATGG + Intergenic
1034958765 7:155351412-155351434 CCATTTCTGCTGAGGCCACATGG + Intergenic
1034970547 7:155416719-155416741 CAATATCAGCAAAGGCCACAAGG + Intergenic
1035589695 8:803025-803047 TAAGGTGAGAAGAGGCCACAAGG + Intergenic
1036428399 8:8667296-8667318 CAATGTCAGCAGAGGCCACATGG - Intergenic
1038412312 8:27368094-27368116 CCTTGTTAGCAGACGCCAGATGG + Intronic
1038499949 8:28035528-28035550 CACTGTGTGCAGAGGTCACATGG - Intronic
1038841421 8:31187986-31188008 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1039438957 8:37581431-37581453 CCAGGGGAGCACAGGACACATGG - Intergenic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1041231921 8:55761326-55761348 CCATGTGAGCAGAAGCACAAAGG - Intronic
1042474696 8:69233893-69233915 CCATGAGGGCAGAGACCTCAGGG - Intergenic
1042586989 8:70351110-70351132 TCATGAGAGCAGAGCCCTCACGG + Intronic
1042703052 8:71637675-71637697 CAATGTTAGAAGTGGCCACATGG + Intergenic
1042766697 8:72330125-72330147 TAATTTTAGCAGAGGCCACAGGG + Intergenic
1043356408 8:79417661-79417683 CCATGTTACCAATGGCCACATGG + Intergenic
1044100616 8:88132560-88132582 ACATGTGAAAAGAGCCCACATGG - Intronic
1045683158 8:104683926-104683948 CCATGAGAGCAGAGTCCTTATGG + Intronic
1046294677 8:112202054-112202076 CCAGGTGGGGGGAGGCCACAAGG - Intergenic
1046665286 8:116995592-116995614 CTATGTGAACAGAGCCCAAAGGG + Intronic
1047260860 8:123258263-123258285 GCATGTGGGCAGAGATCACATGG - Intronic
1048167000 8:132071308-132071330 CCATGTGAAAAGAAGCCACTGGG + Intronic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048571311 8:135659428-135659450 CCTTGTCAACAGAGGCCAAATGG - Intergenic
1048971285 8:139646173-139646195 GCCTGTGAGCAGGAGCCACAAGG + Intronic
1049619064 8:143589630-143589652 CCATGGGTGCAGAGACCCCAAGG + Exonic
1050769282 9:9176611-9176633 TCATGAGGGCAGAGGCCTCATGG - Intronic
1052413849 9:28152333-28152355 CAATGTGTGCAGAGGTCACATGG - Intronic
1054920148 9:70535630-70535652 CCATGAGAGCAGGGGAAACAAGG - Exonic
1055078161 9:72238268-72238290 CCATATAAACAGAGGCCAAAAGG - Intronic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055630062 9:78214677-78214699 CCTTGTGAGCTGTGGCAACAAGG + Intergenic
1056777014 9:89520494-89520516 CCATGAGAACAGAGCCCTCATGG + Intergenic
1057149177 9:92781059-92781081 CCATGAGTGCAGACACCACATGG - Intergenic
1058364176 9:104188267-104188289 TTCTGTGAGTAGAGGCCACATGG - Intergenic
1058900554 9:109438790-109438812 GGATGTGCTCAGAGGCCACAGGG + Intronic
1059350043 9:113658154-113658176 CCATTTGGGAAGTGGCCACAAGG - Intergenic
1059693922 9:116713005-116713027 CCATGTGTCCAAAGGTCACATGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1060002179 9:119968788-119968810 CCTGGTGAGCTGGGGCCACAGGG + Intergenic
1060821294 9:126662860-126662882 CCATTTGAGCTGAGGGCACCAGG - Intronic
1062389829 9:136329561-136329583 CCACGTGAGGAGTGCCCACACGG - Intronic
1203770134 EBV:45673-45695 TCATGTCAGAAGAGGACACAGGG + Intergenic
1189380018 X:40496083-40496105 CCATGAGGGCAGAGTCCCCAGGG - Intergenic
1189774498 X:44458260-44458282 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1189916174 X:45857826-45857848 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1190384219 X:49868665-49868687 CCATGCTAACAGAGGCCAAATGG - Intergenic
1192359143 X:70427299-70427321 CCATCGGAGCTGAGGGCACAAGG - Exonic
1192704753 X:73518064-73518086 CCATGAGAGCAGAGTCCTTATGG + Intergenic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1194323151 X:92477367-92477389 TCATGTTGGCAGTGGCCACAGGG - Intronic
1195543445 X:106088297-106088319 CCACCCCAGCAGAGGCCACATGG - Intergenic
1197534271 X:127667385-127667407 CCATGGGAGCAGTTTCCACATGG + Intergenic
1197949660 X:131880863-131880885 TCATGCCAGCAGAAGCCACATGG + Intergenic
1198384387 X:136114693-136114715 CTATGTCAGCTGAGGCCTCATGG - Intergenic
1199048204 X:143202896-143202918 ACACCTGAGCAGAGGCAACATGG - Intergenic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199963498 X:152799029-152799051 TGGTGTCAGCAGAGGCCACATGG - Intergenic
1200631249 Y:5590524-5590546 TCATGTTGGCAGTGGCCACAGGG - Intronic