ID: 1151365186

View in Genome Browser
Species Human (GRCh38)
Location 17:73612336-73612358
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 2, 1: 2, 2: 7, 3: 53, 4: 452}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151365175_1151365186 12 Left 1151365175 17:73612301-73612323 CCGCATGGTCCCCTACCCTCATC 0: 1
1: 0
2: 0
3: 22
4: 289
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365181_1151365186 -3 Left 1151365181 17:73612316-73612338 CCCTCATCGGGTCACTGTGACCC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365179_1151365186 2 Left 1151365179 17:73612311-73612333 CCCTACCCTCATCGGGTCACTGT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365173_1151365186 14 Left 1151365173 17:73612299-73612321 CCCCGCATGGTCCCCTACCCTCA 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365180_1151365186 1 Left 1151365180 17:73612312-73612334 CCTACCCTCATCGGGTCACTGTG 0: 1
1: 0
2: 3
3: 12
4: 96
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365182_1151365186 -4 Left 1151365182 17:73612317-73612339 CCTCATCGGGTCACTGTGACCCA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365178_1151365186 3 Left 1151365178 17:73612310-73612332 CCCCTACCCTCATCGGGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452
1151365174_1151365186 13 Left 1151365174 17:73612300-73612322 CCCGCATGGTCCCCTACCCTCAT 0: 1
1: 0
2: 1
3: 6
4: 204
Right 1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG 0: 2
1: 2
2: 7
3: 53
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900343352 1:2199093-2199115 CCCAGCTGCTCCTGGCTTTCTGG - Intronic
900395544 1:2451805-2451827 CCCCACTGCGTCTGGGCTGCCGG + Intronic
900419541 1:2549744-2549766 CCCCTCTGCACCTGGGGTGGTGG + Intergenic
900425691 1:2577642-2577664 CCCCTCTGCACCTGGGGTGGTGG - Intergenic
900659020 1:3773695-3773717 CCCTGCTGCACCCTGGCTCCTGG + Intronic
900952811 1:5867477-5867499 CACACCTGGACCTGGGCCGCGGG + Intronic
900991280 1:6099481-6099503 CCTAGCTGCACGGTGGCTGCTGG + Exonic
900992366 1:6103968-6103990 CCCAGCTGGGCCTGGGGTGGAGG - Exonic
901051684 1:6428672-6428694 CACAGCTGGACCTGGGAGGCTGG + Intronic
901764312 1:11490191-11490213 CCCAGATGCCCCTGGCCTGACGG - Intronic
901859132 1:12063187-12063209 GCCCGCCGCACCTGGGCTGCGGG - Intergenic
901870854 1:12138463-12138485 CCCATCTGCCCCTGGGCTGCAGG - Intronic
902118262 1:14139692-14139714 CCCAGCAGGGCATGGGCTGCAGG + Intergenic
902482639 1:16719689-16719711 CGCAGCTGGACCTGGGAGGCTGG - Intergenic
902514128 1:16980689-16980711 CCCAGCGGCTCCGGGGCTGGAGG - Exonic
902722799 1:18315329-18315351 CCCAGAGGCATCTGGGGTGCTGG - Intronic
902923303 1:19680008-19680030 AGCAGCTGCACCTGGGAGGCAGG + Intergenic
903173754 1:21568930-21568952 CCCAGCTGCCCCAGGCCCGCAGG - Intronic
903344763 1:22677150-22677172 CCCATCTGCTCCTGGGGAGCGGG + Intergenic
903743907 1:25574043-25574065 CCCAGGTGCAGCAGCGCTGCCGG - Intergenic
904033595 1:27547775-27547797 CCCAGGCCCACCTGAGCTGCCGG - Exonic
904602147 1:31679631-31679653 CCCTGGAGTACCTGGGCTGCAGG - Exonic
905387737 1:37615859-37615881 GCTAGCTCCACATGGGCTGCAGG - Intronic
906120183 1:43384443-43384465 CCAAGCTTCACCAGAGCTGCAGG + Exonic
906516314 1:46440811-46440833 CCCAGCTGGACCTGGGTGGGGGG + Intergenic
906762265 1:48386875-48386897 CCCTGCTGCCACTGGGCTCCAGG - Intronic
906854632 1:49291756-49291778 CCCTGCTGCACCTGGCATGATGG - Intronic
907305029 1:53508566-53508588 CCTGGTTCCACCTGGGCTGCGGG + Intronic
907752038 1:57271939-57271961 CCCATCTGCACCTGAGTTACAGG - Intronic
908527521 1:65002272-65002294 CCCCGCTGCCCCTGGGCAGTGGG + Intergenic
908984783 1:70004614-70004636 CCCAACTGCAGCTAGGCAGCTGG - Intronic
910116261 1:83735691-83735713 CCCAGCTGCACCTGTGCCAGAGG - Intergenic
911192333 1:94960377-94960399 CCCACAGGCCCCTGGGCTGCCGG - Intergenic
913009709 1:114670687-114670709 CCCAGTTTCACCGAGGCTGCGGG + Intergenic
913289795 1:117261616-117261638 CCCAGCTGTTGGTGGGCTGCAGG + Intergenic
914392881 1:147237505-147237527 CACAGCTGTACCTGGGGAGCAGG + Intronic
914948206 1:152085741-152085763 CACAGCTGCACCTGGGCCTTTGG + Exonic
915341148 1:155177453-155177475 CCAGGCTGTACCTGGGCTGCAGG + Intronic
916362845 1:163990401-163990423 CCCAGTCGCACCTGGAATGCCGG + Intergenic
917534379 1:175863818-175863840 CCCAGCTGCACCTGGCGCGTGGG - Intergenic
918015954 1:180632459-180632481 CCCGGCGGCAGCGGGGCTGCGGG - Intronic
918118400 1:181516611-181516633 ACCAGCTGTTCCTGTGCTGCTGG + Intronic
918955198 1:191198860-191198882 GCCAGCTGCAGCTGTGGTGCTGG - Intergenic
920660346 1:207909841-207909863 GACAGCTGCCCCTGGGCTGGAGG - Intronic
921150548 1:212398945-212398967 GTCAGCTGTAGCTGGGCTGCAGG + Intronic
921932863 1:220769452-220769474 CCAAGCTGCACCTGAGATGGAGG - Intronic
922193278 1:223338615-223338637 TCCAGCTACTCCTGGACTGCTGG - Intronic
922672217 1:227519182-227519204 CTCAGCTGAAGCTGGGCTGTGGG + Intergenic
922807420 1:228397588-228397610 CCCAGCTCCACCTGCCCTGCAGG + Intronic
922891970 1:229068507-229068529 CCCGGCTGCTCTTGGACTGCAGG - Intergenic
923099576 1:230801622-230801644 CCCAGCTGAATCTTGGCTTCTGG + Exonic
923436901 1:233975773-233975795 CCGAGCTGCACATGTGCTCCGGG - Intronic
923778902 1:237004344-237004366 CCCAACTGCTCCTGCGCCGCTGG - Exonic
924822171 1:247503808-247503830 CTCAGCTGAAGCTGGGCTGTGGG + Intergenic
924841313 1:247712309-247712331 CGCAGCTGGCCCTGGGCTCCTGG - Exonic
924878971 1:248137114-248137136 CCCAGCTACTGCTGGGCTGGTGG - Intergenic
1062802874 10:393025-393047 CCCGGCTGCACCTGGACTAGTGG + Intronic
1063145466 10:3291205-3291227 CCCACCTGCCCCTGGGCTAGTGG - Intergenic
1064466284 10:15585444-15585466 CCCAGCGGCACCAGGACAGCAGG + Intronic
1066184449 10:32995536-32995558 TCCAGCTGTACCTGGACTCCTGG + Intronic
1067080495 10:43209758-43209780 CCCAGCTGGACTTGGGGTGGAGG - Intronic
1067080702 10:43210809-43210831 CCCAGCTGGACCTGGGGTGGAGG - Intronic
1069562514 10:69440829-69440851 CGCAGTTGCACCTGGGGTCCAGG + Intergenic
1069867834 10:71514575-71514597 CCCAGCTTCTCCTGAGCTGGGGG - Intronic
1069946905 10:71992996-71993018 CTGAGCTGCACGTGGCCTGCGGG - Intronic
1070610231 10:77927238-77927260 CCCGGCTGCGCCTGGGCCTCGGG - Intergenic
1070765647 10:79054650-79054672 CCCAGCTGTGCCTGGGATCCAGG + Intergenic
1070777373 10:79117757-79117779 CCCAGCTGAAGATGGGCTGGAGG + Intronic
1071520885 10:86330927-86330949 CCCTCCTGCCCCTTGGCTGCGGG - Intronic
1071574428 10:86715356-86715378 GCCAGCTGGACCTTGCCTGCAGG + Intronic
1071598783 10:86946109-86946131 CCCAGCTGCACGTTGGTAGCAGG - Intronic
1072508101 10:96090306-96090328 AGCGGCTGCAGCTGGGCTGCTGG + Intergenic
1073033742 10:100548603-100548625 CCCCACTGCATCTGGGCTGCAGG + Exonic
1073882704 10:108001974-108001996 CCCAGCTTCCACTGGGTTGCTGG + Intergenic
1074451510 10:113563529-113563551 CCAAGCTGCACATCGGCTTCAGG + Intronic
1076475426 10:130748510-130748532 CGCTCCTGCATCTGGGCTGCAGG + Intergenic
1076727566 10:132420661-132420683 CCCAGCAGGGCCTAGGCTGCGGG - Intergenic
1076846303 10:133071139-133071161 CCCAGCAGCACCTTTGCTCCGGG - Intronic
1076905573 10:133359084-133359106 CCCAGCAGCACCTGAACAGCTGG + Intergenic
1076917181 10:133430115-133430137 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1076937276 10:133574874-133574896 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1077225060 11:1436033-1436055 CCCAGCTTCACCAGACCTGCGGG - Exonic
1077236220 11:1483222-1483244 CCCAGCTCCCCCTGTGCTGCTGG + Intronic
1077247344 11:1546192-1546214 CCGCCCTGCACCTGGGCTGGGGG + Intergenic
1077289789 11:1783707-1783729 CCCAGCCGCACCTGCCCTCCAGG + Intergenic
1077298579 11:1837246-1837268 CCCAGGTGCACCTTGCCTACGGG - Exonic
1077323263 11:1951941-1951963 CCCAGCAACACCAGTGCTGCTGG - Intronic
1077373477 11:2194510-2194532 CCCAGATCCAGCTGGGCGGCAGG - Intergenic
1077575341 11:3378896-3378918 TCCAGCTGCACCATGGCGGCCGG - Intronic
1078168524 11:8911135-8911157 CCCAGCTGCGCCGGCGCCGCCGG + Exonic
1079472469 11:20790865-20790887 CCCTGCTGCACCTGGTGTGATGG + Intronic
1080395151 11:31883156-31883178 CCCAGCCAGACCCGGGCTGCAGG - Intronic
1080646663 11:34192800-34192822 CACATCAGAACCTGGGCTGCTGG - Intronic
1080863073 11:36167337-36167359 CACAGCTGCATCTGGACTGGTGG + Intronic
1081088002 11:38824521-38824543 CCCAGCTGCAGCTTGGCTGTGGG - Intergenic
1083424089 11:62574089-62574111 GCCCGCTGCACCTGGGGGGCGGG - Exonic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083608080 11:63990986-63991008 CACAGCTGGATCTGGCCTGCAGG - Intronic
1083877492 11:65531964-65531986 CCCAGCTGCCCTGGGGTTGCAGG - Intronic
1083937751 11:65879242-65879264 CACAGGTGCAGCTGGGCTGAAGG + Intergenic
1084012952 11:66362868-66362890 CCCAGCTGGGCCTGGGCCCCAGG - Exonic
1084416793 11:69037195-69037217 CCCAGCTGCACGTGGGCAGTCGG + Intergenic
1084639712 11:70417789-70417811 CCCAGCTGAAACTTGACTGCAGG + Intronic
1084698707 11:70771709-70771731 TCCAGGAGCAGCTGGGCTGCCGG + Intronic
1084958278 11:72703017-72703039 CCCAGGCGCTCCTGGGCTGTGGG - Exonic
1084972349 11:72778773-72778795 CCCTCCTGCCCCTGGGATGCAGG - Intronic
1085527038 11:77170346-77170368 CTGAGGTGCACCTGGGATGCAGG - Intronic
1085932573 11:81102116-81102138 CCCAGCTGGACCTTTGCTTCTGG + Intergenic
1089007561 11:115105275-115105297 CCCAGCTGCACCTGCTTTGAGGG + Intergenic
1089931798 11:122320353-122320375 CCCAGCAGCAGCAAGGCTGCCGG + Intergenic
1090227989 11:125083028-125083050 CCAAGCTCCACCAGGGCTGAGGG + Intronic
1090333455 11:125948050-125948072 CCCAGCTGCAGCTGGTCCGCGGG + Intergenic
1090457574 11:126863170-126863192 TTCTGCAGCACCTGGGCTGCTGG + Intronic
1090662322 11:128891123-128891145 CCCGGCTGCACCCCTGCTGCGGG - Intergenic
1091054295 11:132404143-132404165 CCCACCTGCATCTGGTCTGCTGG - Intergenic
1091217750 11:133913697-133913719 CCCAGCTGCTGCTGCGCTGTAGG - Intronic
1202806249 11_KI270721v1_random:7136-7158 CCCAGCAACACCAGTGCTGCTGG - Intergenic
1091394101 12:143083-143105 CTCAGCACCACCTGGGCTGCAGG - Intronic
1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG + Intronic
1092073976 12:5657614-5657636 CCCAGGTGCTCCTGGGCTCAGGG + Intronic
1092181835 12:6451601-6451623 GCCAGCTGCGCCTGCGCTGCAGG + Exonic
1093908145 12:24715850-24715872 CCCACCTGCATCTGAGCTGGGGG - Intergenic
1094144375 12:27213893-27213915 CCCTGCTGCAGCTGGGGTGATGG - Intergenic
1094234525 12:28148422-28148444 ACCAGCTGTACCTGTGCAGCCGG - Intronic
1094468466 12:30779726-30779748 CCCAGCTCCACCTGAGCCCCTGG - Intergenic
1094704693 12:32903063-32903085 CCCAGCTGCAGCTGAGCAGAAGG + Intergenic
1096178793 12:49539509-49539531 CCCACTTGCACCCGGGCCGCCGG + Intronic
1096714425 12:53482727-53482749 CCCAGGTGAATCTGGGCTGGTGG + Exonic
1098798427 12:74922743-74922765 CCAGGCTGCACCTAGGCTCCAGG + Intergenic
1100028077 12:90153312-90153334 CGCAGCTGCAGCTGTGGTGCTGG - Intergenic
1101695364 12:107120584-107120606 GCCACCTGCACCTGGCCTGTAGG + Intergenic
1102381252 12:112468635-112468657 CCCACCTGAGCCTGGGATGCAGG + Intronic
1102651243 12:114444068-114444090 CGCAGCTTCACCCAGGCTGCCGG - Intergenic
1103731765 12:123032617-123032639 CTCAGCTCCACCTGGCCTCCCGG - Intronic
1104032899 12:125078189-125078211 ACCAACTGCACAGGGGCTGCTGG - Intronic
1104723192 12:131057795-131057817 CCCAGCTCCACCTGTGTTGTGGG - Intronic
1104899703 12:132182221-132182243 ACCATCTGCCCCTGGGCGGCAGG + Intergenic
1107671191 13:42747947-42747969 CCCAGCTGTCCTTGTGCTGCAGG - Intergenic
1107834753 13:44404397-44404419 CCCAGATGCTCCCTGGCTGCGGG - Intergenic
1109470522 13:62798958-62798980 CGCAGCTGCACCTGGGAAGCGGG - Intergenic
1111232610 13:85363291-85363313 ACCAGCTCCCTCTGGGCTGCCGG + Intergenic
1113628597 13:111864755-111864777 GCCAGATGCACCTGCGCTCCTGG + Intergenic
1113727907 13:112618743-112618765 CCCAGCTGCCCCTGGCCTCTCGG + Intergenic
1113807736 13:113119376-113119398 CCCACCTGCACGTGATCTGCTGG + Exonic
1113855839 13:113445051-113445073 CCCTGCAGCACCTGGGTTTCTGG - Intronic
1115724110 14:36194421-36194443 CCCAGCTGCTCTGCGGCTGCTGG + Intergenic
1121524148 14:94606926-94606948 CCCACCAGCCCGTGGGCTGCAGG - Intronic
1121727088 14:96160651-96160673 CCCAACTGAACTTGGCCTGCTGG - Intergenic
1122137716 14:99644584-99644606 CCCAGTGGGTCCTGGGCTGCAGG + Intergenic
1122248353 14:100420190-100420212 CCCATCTGCACATGGGCCGCAGG + Intronic
1122325976 14:100880856-100880878 GCCAGCTGCACCTGCTCAGCCGG - Exonic
1122604326 14:102938264-102938286 CCCACCTCCCCCAGGGCTGCGGG + Intronic
1122739917 14:103866327-103866349 CCCAGCTGGGCGGGGGCTGCGGG + Intergenic
1122880949 14:104690183-104690205 CCCACCTGCGCGTGGGCAGCTGG - Intronic
1122936022 14:104956657-104956679 CCCAGCAGAACCTTGCCTGCCGG + Exonic
1122946676 14:105014184-105014206 CCCTTCTGCTCCTGGGCTGTGGG + Intronic
1122951548 14:105047779-105047801 CCCAGCTGCGCCCGTCCTGCAGG + Intergenic
1122973389 14:105161404-105161426 CACAGCCACACCTGGGCTTCAGG + Intronic
1122983261 14:105201052-105201074 TCCAGCTGCACGTGGGGTTCTGG - Intergenic
1123020801 14:105397077-105397099 CCCTGCTGCTGCTGGGCTGTGGG + Exonic
1123106327 14:105843445-105843467 CCCGGCTGCATCTGGCCTGTGGG + Intergenic
1202917960 14_KI270723v1_random:2812-2834 CCCAGCTGCACCCGGCCTCCTGG + Intergenic
1123787336 15:23686922-23686944 ACCAGCTGCGCCGGGGCTGGCGG + Exonic
1124340538 15:28886813-28886835 CCCCGTTGCTCCTGGGCTGCAGG + Intronic
1124966555 15:34436827-34436849 CCTTGTTGCCCCTGGGCTGCAGG - Intronic
1125468277 15:39976632-39976654 CCGAGCTGCACGCGGGCAGCCGG + Exonic
1126392797 15:48177923-48177945 CCCAGCTGCACCTGCTCCTCAGG + Intronic
1126738065 15:51751646-51751668 CCCCGCTCCACCGGGGCTGACGG + Exonic
1127752551 15:62060279-62060301 CCCAGCTGAAGCTGGGCATCTGG - Exonic
1127822875 15:62675522-62675544 CCCAGCTGCCCAGGGGCTCCTGG - Intronic
1127827461 15:62717654-62717676 ACCAGCTGCTGCTGGGCCGCAGG - Exonic
1127901653 15:63345537-63345559 CGCAGCTGCACCTGCACTGGGGG - Exonic
1127906702 15:63381573-63381595 CTCAGCCGCCCCTGGGCTGAAGG - Intronic
1128508995 15:68302159-68302181 CCTGGCTGCAGCTGGGCAGCAGG - Exonic
1128771341 15:70284688-70284710 CCCAGCTTGACCTGGGCTGCAGG + Intergenic
1128847707 15:70916644-70916666 CCCTGCTGCAGCTGGCCTGATGG - Intronic
1129110840 15:73336135-73336157 CACAGCAGCATCTGGGCTGGGGG - Intronic
1130559540 15:84947259-84947281 TCCAGCTGCCCTTGGGCTGTGGG + Intergenic
1131007096 15:88987205-88987227 CCCAGCTGGGCCTGCACTGCAGG + Intergenic
1131107314 15:89743956-89743978 CACTGCTGCCCCTGGCCTGCTGG + Intergenic
1132603353 16:783601-783623 CACAGCTGAACCTGAGCTGCAGG - Intergenic
1132726659 16:1341845-1341867 ACCAGCTGCACCTGGACATCTGG + Exonic
1133050197 16:3113026-3113048 CCCACCAGCACCTGTTCTGCAGG + Intronic
1133060673 16:3172371-3172393 CTCAGCTCCACATGGGCTCCGGG + Intergenic
1133265174 16:4579100-4579122 CACAGCTGCACCTGGGAGGGGGG - Intronic
1133400442 16:5482400-5482422 GCCAGCCCCGCCTGGGCTGCAGG - Intergenic
1133452690 16:5916980-5917002 CCCAGGGGCACATGGGATGCAGG - Intergenic
1133635670 16:7662704-7662726 CCCAGCTGCAGGTGGGCACCGGG + Intronic
1133743588 16:8670362-8670384 CCCAGCTACAGCTGCGCTTCTGG + Intergenic
1134117208 16:11557948-11557970 TCCAGCTGCCCCATGGCTGCTGG - Intronic
1135300703 16:21324438-21324460 TACAGCTGCACCTGTGCTGTTGG - Intergenic
1135422268 16:22313433-22313455 CCCACCTCCACCTGGCCTGCTGG - Intronic
1136290421 16:29268281-29268303 CCCAGCTGCCCCTGCCCTTCAGG + Intergenic
1137270544 16:46899930-46899952 CGCAGGTGCACCTGGGAGGCGGG + Intronic
1137676466 16:50305975-50305997 CACAGCTGCTCCTGGGCGGGGGG + Intronic
1138381943 16:56608662-56608684 CCCAACTGCTCCTGCGCCGCCGG + Exonic
1138389221 16:56658065-56658087 CCCAACTGCTCCTGCGCCGCTGG + Exonic
1138390644 16:56667965-56667987 CCCAACTGCTCCTGTGCCGCTGG - Exonic
1139440973 16:66966642-66966664 CCCAGCAGCCACTGAGCTGCAGG - Intronic
1139573854 16:67829295-67829317 CCCAGCTGAAGCTGCCCTGCTGG + Intronic
1139642444 16:68302252-68302274 CTCAGTTGCGGCTGGGCTGCTGG + Intronic
1140218326 16:73025624-73025646 CCCAGGCACCCCTGGGCTGCAGG + Intronic
1141169299 16:81681031-81681053 CCCACCTGCACCCTGGCAGCTGG - Intronic
1141603835 16:85142052-85142074 CCCAGGTACCCCTAGGCTGCCGG + Intergenic
1141633658 16:85302595-85302617 CTCAGCATCACCAGGGCTGCTGG + Intergenic
1141713831 16:85715841-85715863 CCCACCTGCAGCTGGGGTTCTGG - Intronic
1142096303 16:88241802-88241824 CCCAGCTGCCCCTGCCCTTCAGG + Intergenic
1142138490 16:88462172-88462194 CCCAGCTTCCCCTGGGCTGCTGG + Intronic
1144218459 17:13078747-13078769 CACAGCTCCACGTGGGCTCCTGG + Intergenic
1144994871 17:19260507-19260529 CACAGGTGGACCTGGGCTGGTGG + Intronic
1145367696 17:22278488-22278510 CCCAGCTGCTCCTGCTCCGCAGG + Intergenic
1146457178 17:33017260-33017282 CCCTCCTGCAGCTGGGCTGGAGG - Intronic
1146970090 17:37065558-37065580 TCCAGCTGTACCCGGGCTGAGGG + Intergenic
1147158598 17:38558216-38558238 CCCAGCCTCACTTGAGCTGCTGG + Exonic
1147337880 17:39738180-39738202 CCCAGCCGCACCAGGGCCCCAGG + Intronic
1147425008 17:40342192-40342214 GCCAGCTGCCCCTGGCCTGGCGG + Intronic
1147615122 17:41822950-41822972 CTGAGCTGACCCTGGGCTGCTGG + Exonic
1147689035 17:42304300-42304322 CCCAGCTCCACATGGGCCCCAGG - Intronic
1147914161 17:43876861-43876883 CCCACTTGCATCAGGGCTGCTGG - Intronic
1147915303 17:43882141-43882163 GTCAGCTGCCCCTGGGCTGCAGG + Intronic
1148090123 17:45018471-45018493 CCCAGATGCACTTGGGCTGGGGG + Intergenic
1148653706 17:49267908-49267930 CTCAGCTGTACCTGGGCCTCAGG - Intergenic
1149998498 17:61417288-61417310 CCCAGCTGCACCTTTGGTTCTGG + Intergenic
1150225232 17:63521062-63521084 CCCGGCTGCAACTGAGCTGGTGG + Intronic
1150436072 17:65155210-65155232 CCCAGCTGCATCTGAGGTGATGG - Intronic
1151028452 17:70706599-70706621 CCCAGCTTCATCTGGCTTGCTGG - Intergenic
1151365142 17:73612208-73612230 CCCAGCTGCACCCGGGCTGCAGG + Intronic
1151365168 17:73612272-73612294 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG + Intronic
1151546189 17:74794641-74794663 CCCAGACGCACCTGGGGTTCAGG + Intronic
1151830642 17:76547343-76547365 CGCATCTCCAGCTGGGCTGCTGG - Intronic
1152157771 17:78646140-78646162 CCCAGCTGCTCCTCAGTTGCAGG + Intergenic
1152468772 17:80479186-80479208 CCCAGCTGCATCTGGGGTGTGGG - Intergenic
1152468779 17:80479193-80479215 CCCAGATGCAGCTGGGGTGAGGG + Intergenic
1152534238 17:80941233-80941255 CCCAGCTGCACCCGGGGTGGAGG + Intronic
1152544812 17:80995128-80995150 TCCAGCTGCACCTGCACTCCAGG - Intronic
1152624125 17:81380435-81380457 CCCAGAAGCATCTGGGGTGCAGG + Intergenic
1153945995 18:10017898-10017920 CCCAGCTGCACATGGCCACCTGG + Intergenic
1154302660 18:13207937-13207959 GACAGCTGAACCTGGGCTGCAGG + Intergenic
1155504763 18:26522369-26522391 CCTAGCTGCTCGTGGGTTGCTGG - Intronic
1156289404 18:35732772-35732794 ACCATCTGCAGCTGGGCAGCTGG + Intergenic
1157066560 18:44357040-44357062 CCCAGCTTGACCTGGGATGTTGG - Intergenic
1157328548 18:46686501-46686523 CCCAGCAGGCCCTGGGCTTCAGG - Intronic
1159346704 18:67215753-67215775 ACCAGCTCCCTCTGGGCTGCCGG - Intergenic
1160069011 18:75608241-75608263 CCCAGCTCCTCCTTGGCTCCTGG + Intergenic
1160386571 18:78500513-78500535 CCCAGTTGTCCCTGGGGTGCAGG - Intergenic
1160686517 19:439248-439270 CCAAGCTGCACCTGTCCTGTGGG - Intronic
1160794889 19:940782-940804 CCCGGCTGCACGTGAGCCGCCGG + Intronic
1161014843 19:1978464-1978486 CGCAGCTGCACCTGGAGTACCGG + Exonic
1161038298 19:2097245-2097267 TCCAGCTTCTCCCGGGCTGCGGG - Exonic
1161453740 19:4360253-4360275 CTCAGGAGCACCTGGGGTGCTGG + Intergenic
1161584551 19:5098095-5098117 CCCAGCTGGGCCAGGGCTGGTGG + Intronic
1161684416 19:5695919-5695941 CCCATCTGCTCCTCGGCCGCAGG + Intronic
1161686206 19:5703919-5703941 CTCAGCTGCCCTTGGGCTGGTGG - Intronic
1161739242 19:6010284-6010306 CCCACCCGCAGCAGGGCTGCTGG - Intronic
1162242051 19:9363067-9363089 CGCACCTGGACCTGGCCTGCTGG - Intronic
1162924045 19:13920743-13920765 GCCAGCTGCTGCTGGGCTGTGGG - Exonic
1163363439 19:16862517-16862539 TCCCACTGCACTTGGGCTGCTGG - Exonic
1163713239 19:18859484-18859506 CACAGCAGCCCCTGGGCTGAGGG + Intronic
1164463186 19:28465581-28465603 CTCAGCTGCACCTGGGCCCCAGG - Intergenic
1164606032 19:29598742-29598764 ACCAGTGGTACCTGGGCTGCAGG + Intergenic
1164973239 19:32550253-32550275 CCCAGCCGCACCTGTGTTTCTGG + Intergenic
1165080152 19:33302257-33302279 CCCAGCGGCTCCGGGGCGGCAGG + Exonic
1165829557 19:38723760-38723782 CCCTGCTGCCCCGGGGCTGGTGG + Intronic
1166897322 19:46032291-46032313 CGCAGCTGCACCTGGGAGGGTGG - Intergenic
1166919709 19:46221007-46221029 CCCAGCAGCACCTGGGGTTGTGG + Intergenic
1166942253 19:46374111-46374133 GGCAGCTCCACCTGGGCTGTGGG - Intronic
1167101935 19:47409068-47409090 CCACCCTGCACCTGGGCAGCAGG + Intronic
1167357376 19:49012183-49012205 CCCAGCTGAAACTGGGCGGTTGG + Intronic
1167774358 19:51545027-51545049 CCCTGTTGCATCTGGGCTCCAGG - Intergenic
1168137028 19:54359066-54359088 CTCAGAGGCTCCTGGGCTGCTGG - Intronic
1168161053 19:54510063-54510085 CTCAGAGGCTCCTGGGCTGCTGG + Intronic
1168244764 19:55106683-55106705 CCAAGCAGCAGCTGTGCTGCAGG - Intronic
1168314128 19:55476711-55476733 CACAGCTGCACCGCCGCTGCCGG + Exonic
1168337721 19:55605754-55605776 CCCCGCTGCACCCGGGCCCCCGG - Intronic
1168636283 19:57999803-57999825 CTCACCTGAACCTGGGCTGCTGG + Exonic
1168713454 19:58514375-58514397 CCCACCCCCACCTGGGCTCCTGG + Intronic
925115626 2:1376001-1376023 GCCTGCAGCAGCTGGGCTGCAGG - Intronic
925380306 2:3420238-3420260 ACCAGCCGTCCCTGGGCTGCAGG - Intronic
925426302 2:3751409-3751431 CGGAGCTGCACCTGGGGAGCTGG - Intronic
927111044 2:19863924-19863946 CTCAGCGCCACCTGGGCTCCAGG + Intergenic
927497479 2:23560692-23560714 GCAGGCTTCACCTGGGCTGCAGG + Intronic
927937616 2:27084437-27084459 CCCAGGGCCTCCTGGGCTGCAGG + Exonic
927980237 2:27370388-27370410 CACAGCGCCACCTGGGCTGGAGG + Intronic
928549510 2:32357276-32357298 CCCGGCTGCTCCTCGGCGGCGGG + Exonic
930411213 2:51028202-51028224 CGCTGCTGCTCCTGGGCTGCTGG - Exonic
932303310 2:70683788-70683810 CCCATGTGCACATGGGCTGAGGG - Intronic
932335218 2:70927277-70927299 CCCTCCTGCAGCTGGGCTGGAGG + Intronic
932502410 2:72194974-72194996 TCCACCTGGAGCTGGGCTGCAGG - Intronic
934684051 2:96307379-96307401 CACAGATGCAGCTGGGCTGTGGG + Intergenic
934984163 2:98872016-98872038 CCCAGCTCCATCTGTGTTGCTGG - Intronic
935423250 2:102892818-102892840 CCCAGGTGCACCTGTTCTGCCGG + Intergenic
935592038 2:104853327-104853349 CCGCGCTGGTCCTGGGCTGCAGG + Intergenic
935640104 2:105282129-105282151 CAGAGCAGCACCTGTGCTGCAGG + Intronic
935765786 2:106366605-106366627 CACAGCTGAACATGGGGTGCAGG - Intergenic
937257769 2:120566982-120567004 CCCAGGTGCTCCTGGCCGGCTGG - Intergenic
937901787 2:127025305-127025327 CCCAGCTGCCCCAGGGCCTCGGG + Intergenic
937916219 2:127100285-127100307 CCCAGCTCCACCTGGGGTCTAGG - Intronic
937990591 2:127659899-127659921 CCCAGCAGCACCTGGCCCGTGGG - Intronic
938551235 2:132384233-132384255 CAGAGCTGCCCCTGAGCTGCTGG - Intergenic
939096043 2:137834570-137834592 CCATGCTGCACCTGGACGGCAGG + Intergenic
942523401 2:176828579-176828601 CTCATCTGCACCTGGGAGGCAGG + Intergenic
944471087 2:200054822-200054844 CCCAGCCCCGCCTGGGCTGTCGG + Intergenic
948541613 2:238695039-238695061 CCCAGATGCCACTGAGCTGCCGG + Intergenic
948715996 2:239864302-239864324 TCCTGCTGCCCCTGGGCTGGAGG + Intergenic
948722856 2:239912337-239912359 CCGAGCTGCAGCTGGCCTCCAGG + Intronic
948805495 2:240452134-240452156 CCACGCAGGACCTGGGCTGCAGG + Intronic
948864528 2:240768578-240768600 CCATGCCCCACCTGGGCTGCTGG + Intronic
1168883475 20:1226309-1226331 TCCAGCCCCAGCTGGGCTGCGGG - Intronic
1168893869 20:1310719-1310741 GCCAGGTGCACCTGGGAGGCCGG + Intronic
1169217936 20:3804137-3804159 CCCACCTCCACCTGGGCACCGGG + Intronic
1171268374 20:23793274-23793296 ACCAGCTGCACATTGGCTGGGGG + Intergenic
1171485964 20:25486498-25486520 TGCAGCTGCATGTGGGCTGCTGG - Intronic
1171781921 20:29427472-29427494 CCCGGCTGCACCCGGCCTCCTGG + Intergenic
1172015127 20:31868992-31869014 CCCAGCTGCTCCAGGGCTCTGGG + Intronic
1172241767 20:33417708-33417730 CCCAGCCTTACCTGGGCTCCGGG + Exonic
1172484689 20:35291198-35291220 CCCAGCTGCAGATGTGGTGCAGG + Intronic
1173193866 20:40897526-40897548 CCCAGGACCACCTGGCCTGCAGG + Intergenic
1174052188 20:47774545-47774567 CCCAGCAGCACCTGAGCTATGGG + Intronic
1174631482 20:51962252-51962274 CCAAACTGCACATGGGGTGCGGG - Intergenic
1175211076 20:57355746-57355768 CCCTGCTGCCCCTGTGCTGTAGG - Intronic
1175704203 20:61163885-61163907 CCCAGCTGCACAGAGACTGCAGG + Intergenic
1175916899 20:62430248-62430270 CCCACCTGCACCTGAGGGGCTGG + Intergenic
1176031725 20:63016088-63016110 CACCCCTGCATCTGGGCTGCTGG + Intergenic
1176109770 20:63405959-63405981 CCCACCCGCTCCTCGGCTGCAGG + Intergenic
1176127620 20:63482954-63482976 TCCGGCTGTACCTGTGCTGCCGG - Intergenic
1176148196 20:63574626-63574648 CCCAGCAGCACCAGGGCCACGGG - Intergenic
1176151014 20:63590714-63590736 CACTGCTGCTCCAGGGCTGCAGG + Exonic
1178336729 21:31750082-31750104 CCCAGCTCCAACTTGGCGGCTGG - Intergenic
1179169672 21:38963086-38963108 CCCAGCTTCTGCTGGGTTGCTGG - Intergenic
1179572767 21:42287553-42287575 CCCAGCTCCACCTTGGAGGCTGG + Intronic
1179573783 21:42294295-42294317 CCCAGCTCATCCTGGGCTGCAGG + Intronic
1179709575 21:43205531-43205553 CCAGGCTCCAGCTGGGCTGCTGG + Intergenic
1180171937 21:46064051-46064073 CCCAGCAGCATCTGGGGTGTGGG + Intergenic
1180958882 22:19753796-19753818 CCTGGCTGCACCTGGGGTGGAGG + Intergenic
1181088496 22:20456391-20456413 ACCAGCTGCATCGTGGCTGCCGG - Intronic
1181671613 22:24427970-24427992 TGCAGCTGCACCCGGGCTGTGGG + Intronic
1181973539 22:26712017-26712039 CCCAGCTGGACTTGGGCCCCAGG + Intergenic
1182658234 22:31906500-31906522 CCAGGCTGCACCTGTGCTGGGGG + Exonic
1182688191 22:32136910-32136932 CCCACCTGCAGCTGTGGTGCAGG + Intergenic
1183030393 22:35099614-35099636 CCCCACTGCAGGTGGGCTGCAGG + Intergenic
1183097737 22:35563460-35563482 CTGAGCTGAGCCTGGGCTGCGGG + Intergenic
1183194133 22:36341681-36341703 CACACCTGCAGCAGGGCTGCGGG - Intronic
1183402016 22:37610061-37610083 CTCAGCAGCAACTGGGCTGGGGG + Intronic
1183672380 22:39280507-39280529 CCCAGCTGCACCGGAGGTTCAGG - Intergenic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1183862814 22:40681848-40681870 CGAAGCTGCCCCTGGGCTGCAGG - Exonic
1184449674 22:44575594-44575616 CCCAGCAGCACATTGGCTCCAGG - Intergenic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1184683718 22:46086452-46086474 CCCCGCTGCTCCTGCCCTGCTGG - Intronic
1185419333 22:50726812-50726834 CCCAGCTGCATGTGGCCTGCAGG - Intergenic
950215458 3:11155200-11155222 CCCAGCTGCAGCCGAACTGCAGG - Intronic
950440469 3:13007381-13007403 CCCAGCTGCCCCTGGGAGGAGGG + Intronic
950535871 3:13577806-13577828 CCCAGCTGCCCCCGGGCTGGTGG - Intronic
952834381 3:37591090-37591112 CCCTCCTGCCCCTGGGCTCCAGG + Intronic
953397089 3:42581941-42581963 CCTACCTGCGCCTGGGCTGCCGG - Exonic
954421266 3:50420274-50420296 CCCAGCTGCCCCTGCCCGGCTGG + Intronic
954613504 3:51958234-51958256 CACAGCTCCCCCTGGCCTGCTGG - Exonic
954637469 3:52079028-52079050 CCCAGCTGCACGGGAGCTGTGGG + Intronic
954713639 3:52516717-52516739 TCCACCTGCGCCTGTGCTGCGGG + Exonic
956482513 3:69687393-69687415 ACCACCTGCTCCTTGGCTGCAGG + Intergenic
956750124 3:72338405-72338427 GCCAACTGCAACTGGGCTGATGG + Intergenic
956771249 3:72527829-72527851 TGCAGCCTCACCTGGGCTGCAGG + Intergenic
957083578 3:75658925-75658947 CCCGGCTGCACCCGGCCTCCTGG - Intergenic
959498045 3:107073931-107073953 CCCAGAAGCACCTGGGATGCAGG + Intergenic
961381497 3:126498898-126498920 CCCTGCTTGTCCTGGGCTGCTGG + Intronic
961513732 3:127420156-127420178 CCCTCCTGCCCATGGGCTGCAGG - Intergenic
962840460 3:139227927-139227949 CCAAGCCCAACCTGGGCTGCAGG - Intronic
962850846 3:139307233-139307255 CCCAGCTGAATGTGGGCTTCTGG + Intronic
963284378 3:143418817-143418839 CCTGCCAGCACCTGGGCTGCTGG - Intronic
965454149 3:168876582-168876604 CCCAAATGCACATGGGCTGCTGG + Intergenic
965524237 3:169699662-169699684 CCCAGCTCCAGCAGGGCTTCTGG - Intergenic
966925077 3:184639469-184639491 CCCTTCAGCTCCTGGGCTGCTGG - Intronic
968063939 3:195747906-195747928 GTCAGCTGCACCTGGGCGGCAGG + Intronic
968509856 4:990856-990878 CACAGCCACACCTGGCCTGCTGG + Intronic
968518160 4:1023472-1023494 CCCAGCTGTCCCTGGGATTCTGG + Intronic
968669151 4:1839362-1839384 CACAGGTGCACCTCTGCTGCAGG - Intronic
968737488 4:2304867-2304889 CGCGGCTGCACCTGGACGGCTGG - Exonic
969264226 4:6054687-6054709 CCCAGCTGGGTCTGGGATGCAGG - Intronic
969486101 4:7473327-7473349 CCCAATTGCCCCTGGGCTGAGGG - Intronic
969681556 4:8646016-8646038 CACAGCAGCACCTTGTCTGCAGG + Intergenic
974396717 4:61346025-61346047 CCCAGCTGCTCCTGCGCTCACGG + Intronic
981006280 4:139878699-139878721 CCCAGGTGCTCCTGAGCTTCAGG - Intronic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
983060407 4:163153263-163153285 CCGCACTGCACCGGGGCTGCAGG - Intronic
985524713 5:396101-396123 CCCTCCCGCTCCTGGGCTGCAGG - Intronic
985680603 5:1253816-1253838 CTCAGCTGCGTCTGGGCTGCGGG + Exonic
985683725 5:1270960-1270982 CCCTCCGGCTCCTGGGCTGCAGG - Intronic
986045591 5:4034507-4034529 CCCAACTCCACCAGGGCTTCTGG + Intergenic
986233185 5:5885487-5885509 TCCAGCTGCTCCAGGGCTGGAGG - Intergenic
986315215 5:6582670-6582692 GCCACCTGCACCTGGGAGGCTGG + Intergenic
988541729 5:32116173-32116195 CCCAGCTGCTGCTGTCCTGCTGG - Intergenic
989201539 5:38769192-38769214 CCCAGATGTTCTTGGGCTGCAGG - Intergenic
992105872 5:73448496-73448518 CGGAGCTGCGCCGGGGCTGCCGG + Intergenic
992490096 5:77234381-77234403 CCCAACTCCACATGGGCTTCAGG + Intronic
992660689 5:78957890-78957912 CCCATCTGGACCTTGGCTGGTGG - Intronic
993280592 5:85920534-85920556 CCCAGCCCCACCTGGGCTCTTGG + Intergenic
994851075 5:105056669-105056691 CCCAGCTGCAGCTGGCATGATGG - Intergenic
997264493 5:132487180-132487202 CTCAGCTGCCCCTGGCCTGAAGG + Intronic
997840352 5:137234086-137234108 CCCAGAGACACCTGGGCAGCTGG - Intronic
998169292 5:139863027-139863049 CCCAGCTACAACTGGTATGCGGG - Intronic
1000137332 5:158365420-158365442 CCCAGCTACAACTTGGCTCCAGG + Intergenic
1001011810 5:168105466-168105488 CACAGGTGCACCTGGTCTCCTGG + Intronic
1001547663 5:172580422-172580444 CCCAGCTGCTCCTGGAGAGCAGG + Intergenic
1002197418 5:177509015-177509037 AGCAGCTGCAGCTGAGCTGCGGG + Intronic
1002212966 5:177609280-177609302 CCCAGCCACACCCGGGATGCAGG + Intronic
1002278525 5:178118020-178118042 CACAGCTGCAGCTGGCCTGCTGG + Intronic
1003168650 6:3703078-3703100 CCAAGGAGCCCCTGGGCTGCAGG - Intergenic
1003405117 6:5821482-5821504 CCAAGCTCCACCTGGGCAGAGGG - Intergenic
1003570112 6:7250492-7250514 CCCCACTGCACCTGAGCTCCTGG + Exonic
1005621079 6:27620882-27620904 ATCAGCTCCACCTGGGCAGCTGG + Intergenic
1005992566 6:30912491-30912513 ACAGGCTGCACTTGGGCTGCGGG + Intronic
1006669362 6:35720125-35720147 CCCAGCTGCAGCTGGTCTTCCGG + Intronic
1006719483 6:36140929-36140951 CCCAGGTGCACCAGGACTGCAGG + Intronic
1007094800 6:39206558-39206580 CCCAGCTGCCCCTCGCGTGCTGG + Intronic
1007605355 6:43114028-43114050 CCCTGCGGCCCCAGGGCTGCTGG + Intronic
1007829779 6:44629518-44629540 ACCAGCTGCCCCAGGGCTCCTGG - Intergenic
1008605361 6:53134223-53134245 CGCAGCGGCACCTGAGCAGCTGG - Exonic
1009492682 6:64311998-64312020 CCCAGTGGCACCTGGAATGCCGG + Intronic
1011530233 6:88312899-88312921 AGCAGCTGCACCTGGGGTGGGGG + Intergenic
1012142216 6:95637380-95637402 CCCAGCTGCAGCTGGTGTGATGG + Intergenic
1013004190 6:106056193-106056215 CCCAGCAGGACTTGGGCTACTGG + Intergenic
1013809482 6:114028244-114028266 CCCAGCTAGACCTGAGCTCCTGG - Intergenic
1017737736 6:157380325-157380347 CGCAGCTCCTCCTGGGCTGTCGG + Intergenic
1018238412 6:161748976-161748998 CCCAGCTGCCCCCTGGCGGCGGG - Intronic
1018275171 6:162122616-162122638 CCCAGAAGCAGCTGGGCTGATGG + Intronic
1018287728 6:162258489-162258511 TTGAGCTGCACCTGGGCTCCAGG - Intronic
1019023512 6:168939240-168939262 GCCAGCTGCAGCTGGGCACCAGG - Intergenic
1019140143 6:169937722-169937744 CCCTGCTGCTCCAGGCCTGCAGG - Intergenic
1019268146 7:130519-130541 CCCAGATGCTCCTGGACTGGTGG + Intergenic
1019342111 7:513212-513234 CCCACCTGCACCTGGCCGCCTGG - Intronic
1019352870 7:563154-563176 CCCACCTGCACCTGCCCTGGTGG - Intronic
1019429366 7:991563-991585 CACAGCTGCACTCAGGCTGCCGG + Intergenic
1019432829 7:1007351-1007373 CACCGCTGCCCCTGGGCTGGGGG + Intronic
1019433544 7:1010615-1010637 CCTGGCTCCCCCTGGGCTGCAGG + Intronic
1019596820 7:1861931-1861953 CCCAGCAGCTCCTGGGCTGGGGG - Intronic
1019659896 7:2218365-2218387 CGCAGCTGCACCAGGGCTGGGGG - Intronic
1022020285 7:26393749-26393771 CCCAGGTTTGCCTGGGCTGCTGG + Intergenic
1022389268 7:29929195-29929217 CCGAGCTGACTCTGGGCTGCTGG - Intronic
1022490790 7:30816037-30816059 CCCACCTCCAGCAGGGCTGCAGG + Intronic
1022806160 7:33824508-33824530 CATAGCTCCACCTAGGCTGCAGG - Intergenic
1023897195 7:44443780-44443802 CCGAGCAGCACCTGGGCCCCAGG - Intronic
1024185832 7:46946851-46946873 CCAAGCTGCTCCTGCCCTGCCGG + Intergenic
1024602385 7:50995227-50995249 CCCAGGTGAACATGGGCTACAGG - Intergenic
1025739670 7:64184394-64184416 CCCTGCTGCACCCGGGCTGCAGG + Intronic
1026001000 7:66558708-66558730 CCCTGCTGCATCTGGCCTGCAGG + Intergenic
1026099378 7:67372037-67372059 CCCCTCTGCACCTGGACTGGTGG - Intergenic
1026858017 7:73767798-73767820 CCCAGTTCCACAGGGGCTGCTGG + Intergenic
1028899164 7:96076304-96076326 TCCAACTGCAGCAGGGCTGCCGG + Intronic
1029047806 7:97649383-97649405 TCAGGCTGCACCTGTGCTGCAGG - Intergenic
1029185376 7:98734654-98734676 CCCAGCTGCTCTTGAGCTCCTGG + Intergenic
1030819729 7:114081784-114081806 CCTAGCTTCTCCTAGGCTGCTGG - Intergenic
1032076785 7:128839862-128839884 CCCAGCACAACCGGGGCTGCCGG - Intronic
1034885311 7:154794310-154794332 CCCCGCAGCAGCTGGGCGGCCGG - Intronic
1035125591 7:156606692-156606714 CCCAGGTGCGACTTGGCTGCCGG - Intergenic
1035168586 7:157005722-157005744 CCCAGCAGCTCCTCGGCTCCCGG + Exonic
1035299052 7:157885328-157885350 CCCAGGTGGGCCTGGGCTGGGGG + Intronic
1035352981 7:158259399-158259421 CGCAGCTGCTGCTGTGCTGCAGG + Intronic
1035699126 8:1624739-1624761 TCCCGCTGCACCTGGGCAGTGGG - Intronic
1035754502 8:2021736-2021758 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1035754508 8:2021776-2021798 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1035754514 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG + Intergenic
1039246959 8:35619616-35619638 TCCAGTTGCAACTGGGCAGCTGG + Intronic
1039408413 8:37331884-37331906 TCCAGCTTCACATGGGCTGCTGG + Intergenic
1039788982 8:40859073-40859095 CCCAGCTGGACCAGGGCTGCTGG + Intronic
1039822810 8:41148673-41148695 CCCAGGTTCTCATGGGCTGCAGG + Intergenic
1039895521 8:41714115-41714137 CCCAGCTGCCCCTGGAGAGCAGG - Intronic
1041090442 8:54296865-54296887 CTCAACTGCACCAGGGGTGCTGG - Intergenic
1041381759 8:57259553-57259575 CCCTGCTGCAGCTGTGCTGCGGG - Intergenic
1042876967 8:73448950-73448972 CCCAGCCCCAGCCGGGCTGCAGG - Intronic
1044434735 8:92148740-92148762 CACTACTGCCCCTGGGCTGCAGG + Intergenic
1047222815 8:122932148-122932170 CTCAGCTTCTCCAGGGCTGCTGG + Intronic
1047766121 8:127991524-127991546 CCCTGCTGCACCTGGAGGGCTGG + Intergenic
1048273454 8:133047677-133047699 CCCAGCAGCGTGTGGGCTGCAGG + Intronic
1049071482 8:140358960-140358982 CCCAGCTGCACAGGCCCTGCTGG + Intronic
1049240862 8:141536821-141536843 CCCAGCTGGACCTGAGATCCTGG - Intergenic
1049328943 8:142039475-142039497 CCCAGCTGCACTTGACCAGCTGG + Intergenic
1049408608 8:142462629-142462651 GCCAGCTGGGCCTGGGCAGCAGG + Intronic
1049483528 8:142839477-142839499 CCCAGCTGCTCCTGCGGTGGAGG + Intronic
1049537081 8:143187464-143187486 CCAAACTACACCTGGGCTTCAGG - Intergenic
1049929142 9:439430-439452 TCCAGCTGGACTTGGGGTGCTGG + Intronic
1051911170 9:22154880-22154902 CCCTGCTGCACCTGGCCTGCAGG + Intergenic
1053294395 9:36902576-36902598 CCCCTCTCCACCTGGGCTTCAGG - Intronic
1053300555 9:36946241-36946263 CCCAGCTGCCCCTGAGCTTCAGG + Intronic
1055315255 9:75028185-75028207 CCCGGCTGCCCGAGGGCTGCGGG - Exonic
1056812655 9:89776459-89776481 CGCAGCTCAACCTGGGCTGAGGG + Intergenic
1057422902 9:94926665-94926687 CCCAGGTGCTCCTGGCCAGCAGG + Intronic
1057724370 9:97557642-97557664 CCCACCTGTCCCTGGGATGCAGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1060488602 9:124065461-124065483 CTGAACTCCACCTGGGCTGCAGG - Intergenic
1060508840 9:124217699-124217721 CCCAGCTACTCCAGGGGTGCTGG - Intergenic
1060936923 9:127521473-127521495 CCCAGCTGCTCCAGGAATGCAGG + Intronic
1061193335 9:129094653-129094675 CACAGCTGGACCTTGGCTCCTGG + Intergenic
1061211093 9:129193925-129193947 CCCAGCTGCCCCTGGGAGGCAGG - Intergenic
1061215916 9:129222037-129222059 GCCAGAGTCACCTGGGCTGCTGG + Intergenic
1061625662 9:131839284-131839306 CTCAGCTGCAGCTGGGGTGGCGG - Intergenic
1061661325 9:132132248-132132270 AACAGCTCCACCTGGGCTGGTGG + Intergenic
1061859917 9:133462714-133462736 CCCAGCTGCACCTCACCAGCAGG - Intronic
1062405094 9:136392452-136392474 TCCAACTGCACCCGGGCTACAGG + Intronic
1062545787 9:137063275-137063297 CCCTGCTGCACCTGGTCTGCAGG - Exonic
1203441711 Un_GL000219v1:15696-15718 CCCAGCTGCACCGGGTCTCCTGG + Intergenic
1203512521 Un_KI270741v1:134605-134627 CCCAGCTGCACCGGGTCTCCTGG + Intergenic
1187258209 X:17660547-17660569 CCCAGCTGAACCTTGCCTGCAGG - Intronic
1187367368 X:18675982-18676004 CCCAGGTGAACTTGGTCTGCAGG + Intronic
1192234876 X:69289382-69289404 CCCAGCCCAAGCTGGGCTGCAGG - Intergenic
1195567769 X:106362954-106362976 CCGAGGTGCTCCTGGACTGCTGG + Intergenic
1195990328 X:110676169-110676191 TCAAGCTGCAGCTGGACTGCAGG - Exonic
1199255447 X:145713976-145713998 CACAACTACACCCGGGCTGCCGG + Intergenic
1199649876 X:149940089-149940111 CCAAGCTGCACCAAGGCTGGCGG + Intergenic
1199831468 X:151552816-151552838 CCCACCTGAACATGGGATGCAGG - Intergenic
1200117151 X:153774408-153774430 CCCATCTGCACCTGGGGGGCGGG - Exonic
1200758611 Y:7015623-7015645 CCCAGCTGAACCTGAACTCCTGG + Intronic
1201244186 Y:11986872-11986894 CCCAGCTGCAGGAGGGGTGCAGG - Intergenic