ID: 1151365206

View in Genome Browser
Species Human (GRCh38)
Location 17:73612399-73612421
Sequence CCCAGCTGCACCTAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 273}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151365197_1151365206 0 Left 1151365197 17:73612376-73612398 CCACCCTCACCGGGTCCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 284
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365200_1151365206 -4 Left 1151365200 17:73612380-73612402 CCTCACCGGGTCCCTGTGGCCCA 0: 1
1: 0
2: 1
3: 25
4: 229
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365195_1151365206 2 Left 1151365195 17:73612374-73612396 CCCCACCCTCACCGGGTCCCTGT 0: 1
1: 1
2: 1
3: 39
4: 372
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365192_1151365206 11 Left 1151365192 17:73612365-73612387 CCGCACAGTCCCCACCCTCACCG 0: 1
1: 0
2: 4
3: 61
4: 524
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365190_1151365206 13 Left 1151365190 17:73612363-73612385 CCCCGCACAGTCCCCACCCTCAC 0: 1
1: 0
2: 3
3: 48
4: 668
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365196_1151365206 1 Left 1151365196 17:73612375-73612397 CCCACCCTCACCGGGTCCCTGTG 0: 1
1: 1
2: 2
3: 19
4: 255
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365201_1151365206 -9 Left 1151365201 17:73612385-73612407 CCGGGTCCCTGTGGCCCAGCTGC 0: 1
1: 0
2: 1
3: 42
4: 510
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365191_1151365206 12 Left 1151365191 17:73612364-73612386 CCCGCACAGTCCCCACCCTCACC 0: 1
1: 2
2: 6
3: 102
4: 844
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365189_1151365206 30 Left 1151365189 17:73612346-73612368 CCTGGGCTGCAGGCTGGCCCCGC 0: 2
1: 0
2: 3
3: 60
4: 491
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273
1151365199_1151365206 -3 Left 1151365199 17:73612379-73612401 CCCTCACCGGGTCCCTGTGGCCC 0: 1
1: 0
2: 2
3: 29
4: 259
Right 1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG 0: 1
1: 2
2: 1
3: 21
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151365206 Original CRISPR CCCAGCTGCACCTAGGCTGC AGG Intronic
900170362 1:1265142-1265164 CTCAGCCGCCCCAAGGCTGCTGG - Intronic
900428909 1:2592801-2592823 GCCACCAGCACCCAGGCTGCGGG - Intronic
900540187 1:3198726-3198748 ACCAGCCGCACGCAGGCTGCGGG + Intronic
900630353 1:3631786-3631808 CCCAACTGAACCCAGACTGCAGG - Intronic
900659020 1:3773695-3773717 CCCTGCTGCACCCTGGCTCCTGG + Intronic
900991280 1:6099481-6099503 CCTAGCTGCACGGTGGCTGCTGG + Exonic
901859132 1:12063187-12063209 GCCCGCCGCACCTGGGCTGCGGG - Intergenic
901870854 1:12138463-12138485 CCCATCTGCCCCTGGGCTGCAGG - Intronic
902374001 1:16021767-16021789 CCCAGCTGTACTCAGGCTCCTGG - Intronic
902378928 1:16043602-16043624 CCCAGCTGTACTCAGGCTCCTGG - Intergenic
903161084 1:21489586-21489608 CCCAACGGCCCCTAGGCTTCAGG - Intergenic
905910078 1:41647629-41647651 CCCTGCTGGAGCCAGGCTGCAGG - Intronic
907164789 1:52400783-52400805 CACGGCTGCCCCTAGGCTGGAGG - Intronic
907326902 1:53644177-53644199 TCCCACTGCAGCTAGGCTGCCGG + Intronic
907328565 1:53656812-53656834 CCAAGGTGCCACTAGGCTGCAGG + Intronic
908431619 1:64064192-64064214 CCCAGCTACACTTAGGTTGGAGG + Intronic
908984783 1:70004614-70004636 CCCAACTGCAGCTAGGCAGCTGG - Intronic
910434448 1:87191022-87191044 CCCAGCTGCACCCAGCCTAGTGG + Intergenic
913009709 1:114670687-114670709 CCCAGTTTCACCGAGGCTGCGGG + Intergenic
915341148 1:155177453-155177475 CCAGGCTGTACCTGGGCTGCAGG + Intronic
915491098 1:156250441-156250463 CCTAGCTGCTCAGAGGCTGCAGG - Exonic
917833022 1:178913861-178913883 CCAAGGTGCTCCCAGGCTGCTGG + Intronic
919910069 1:202105830-202105852 CCCCCCTGCACTTAGGCTACAGG + Intergenic
921824685 1:219659400-219659422 ACCAGCTTTATCTAGGCTGCTGG - Intergenic
922606315 1:226891913-226891935 CCCTCCTCCACCCAGGCTGCAGG - Intronic
922728891 1:227939957-227939979 CCCAGCTGCACCCAGGAGGTGGG + Intronic
922807420 1:228397588-228397610 CCCAGCTCCACCTGCCCTGCAGG + Intronic
923099576 1:230801622-230801644 CCCAGCTGAATCTTGGCTTCTGG + Exonic
923255684 1:232219491-232219513 CCCAGCTCCTCCCAGGGTGCTGG + Intergenic
1063656685 10:7997432-7997454 CCCAGCTGCACAGAGCCTCCAGG - Intronic
1065170375 10:23021107-23021129 TCCAGCTGCATCCACGCTGCTGG + Intronic
1067080702 10:43210809-43210831 CCCAGCTGGACCTGGGGTGGAGG - Intronic
1069617274 10:69814078-69814100 CCCAGCAGCAGTTATGCTGCAGG + Intronic
1070392786 10:75985689-75985711 GCCAACTCCACCTAGGCTCCAGG - Intronic
1070986630 10:80695206-80695228 CCCACCTGCTCCGAGGCTGAGGG - Intergenic
1071520885 10:86330927-86330949 CCCTCCTGCCCCTTGGCTGCGGG - Intronic
1071574428 10:86715356-86715378 GCCAGCTGGACCTTGCCTGCAGG + Intronic
1071598783 10:86946109-86946131 CCCAGCTGCACGTTGGTAGCAGG - Intronic
1073033742 10:100548603-100548625 CCCCACTGCATCTGGGCTGCAGG + Exonic
1074451510 10:113563529-113563551 CCAAGCTGCACATCGGCTTCAGG + Intronic
1076727566 10:132420661-132420683 CCCAGCAGGGCCTAGGCTGCGGG - Intergenic
1076833366 10:133007820-133007842 GCCAGCTGTGCCTAGGCTGTGGG - Intergenic
1076846303 10:133071139-133071161 CCCAGCAGCACCTTTGCTCCGGG - Intronic
1076915095 10:133419462-133419484 CGTACCTGCACATAGGCTGCAGG - Exonic
1076917181 10:133430115-133430137 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1076937276 10:133574874-133574896 CCCAGCTTCTCCTGGGCTGGAGG + Intergenic
1077236220 11:1483222-1483244 CCCAGCTCCCCCTGTGCTGCTGG + Intronic
1077298579 11:1837246-1837268 CCCAGGTGCACCTTGCCTACGGG - Exonic
1077370537 11:2179723-2179745 CCCAGCTGCCCCCAGGGTGGAGG - Intergenic
1077575341 11:3378896-3378918 TCCAGCTGCACCATGGCGGCCGG - Intronic
1080525306 11:33110545-33110567 CTCAACTGCACCTAGGAAGCTGG - Intronic
1081088002 11:38824521-38824543 CCCAGCTGCAGCTTGGCTGTGGG - Intergenic
1081315740 11:41626936-41626958 CCCAGATACACTGAGGCTGCTGG + Intergenic
1083298425 11:61727652-61727674 CCCAGCTACCCACAGGCTGCTGG - Intronic
1083431525 11:62615831-62615853 CCCAGCTGCAGCCAGGCCTCTGG + Intronic
1083738139 11:64693495-64693517 CCCAGTTACCCCTAGGATGCTGG + Intronic
1084416793 11:69037195-69037217 CCCAGCTGCACGTGGGCAGTCGG + Intergenic
1084639712 11:70417789-70417811 CCCAGCTGAAACTTGACTGCAGG + Intronic
1085932573 11:81102116-81102138 CCCAGCTGGACCTTTGCTTCTGG + Intergenic
1088295743 11:108291950-108291972 CCCAGCTACTCCTAGGCTTTAGG + Intronic
1088526711 11:110763620-110763642 CCCAGCTGAAATCAGGCTGCAGG - Intergenic
1089863860 11:121614977-121614999 CCCACCTGCACCTAGCCTCAAGG + Exonic
1089931798 11:122320353-122320375 CCCAGCAGCAGCAAGGCTGCCGG + Intergenic
1090333455 11:125948050-125948072 CCCAGCTGCAGCTGGTCCGCGGG + Intergenic
1090662322 11:128891123-128891145 CCCGGCTGCACCCCTGCTGCGGG - Intergenic
1091054295 11:132404143-132404165 CCCACCTGCATCTGGTCTGCTGG - Intergenic
1091394101 12:143083-143105 CTCAGCACCACCTGGGCTGCAGG - Intronic
1091567129 12:1657124-1657146 CACAGTTGCACACAGGCTGCTGG + Intergenic
1091695780 12:2627221-2627243 CCCACCTCCTCCCAGGCTGCTGG + Intronic
1091700345 12:2654889-2654911 CCCAGCTCCCACTGGGCTGCAGG + Intronic
1092181835 12:6451601-6451623 GCCAGCTGCGCCTGCGCTGCAGG + Exonic
1094817725 12:34204103-34204125 CCCAGCTGGAGCCAGGCTCCTGG - Intergenic
1095488200 12:42706206-42706228 CCCAGCTGGACGAAGCCTGCAGG + Intergenic
1096612447 12:52811699-52811721 CCCAGCCACACCCAGGCTCCCGG - Intronic
1098798427 12:74922743-74922765 CCAGGCTGCACCTAGGCTCCAGG + Intergenic
1102651243 12:114444068-114444090 CGCAGCTTCACCCAGGCTGCCGG - Intergenic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1104682716 12:130762396-130762418 CCCCACTGCACTTACGCTGCGGG - Intergenic
1106579006 13:31001578-31001600 CAAAGCTGCAGCTAGTCTGCAGG - Intergenic
1107834753 13:44404397-44404419 CCCAGATGCTCCCTGGCTGCGGG - Intergenic
1107959061 13:45542972-45542994 CACAGCTGCATCTATTCTGCTGG + Intronic
1109470522 13:62798958-62798980 CGCAGCTGCACCTGGGAAGCGGG - Intergenic
1112700152 13:101998676-101998698 CACATCTGCACATAGGCTGGAGG + Intronic
1115724110 14:36194421-36194443 CCCAGCTGCTCTGCGGCTGCTGG + Intergenic
1120482347 14:85066906-85066928 CCTAGGGGCAACTAGGCTGCTGG + Intergenic
1121157527 14:91700672-91700694 TCCAGCTGCATCTATGTTGCTGG - Intronic
1122129177 14:99595171-99595193 CCCAGCTGAACCCAAGGTGCAGG + Intronic
1122248353 14:100420190-100420212 CCCATCTGCACATGGGCCGCAGG + Intronic
1122627174 14:103090649-103090671 GCCAGCTGCAACCAGGCAGCAGG - Intergenic
1122662908 14:103309833-103309855 CCCAGCTCCAGCCAGGGTGCCGG + Intergenic
1122826830 14:104374635-104374657 CCCAGCAGCACCCAGCCAGCAGG - Intergenic
1122936022 14:104956657-104956679 CCCAGCAGAACCTTGCCTGCCGG + Exonic
1122945639 14:105007455-105007477 TCCAGCTGCAGCAAGTCTGCTGG + Intronic
1123033247 14:105460994-105461016 CCCATCTCCAGGTAGGCTGCGGG + Intronic
1202917960 14_KI270723v1_random:2812-2834 CCCAGCTGCACCCGGCCTCCTGG + Intergenic
1124340538 15:28886813-28886835 CCCCGTTGCTCCTGGGCTGCAGG + Intronic
1125424039 15:39532151-39532173 TCCAGCTGCATCTATGTTGCTGG + Intergenic
1125608695 15:40956809-40956831 CCCAGCTGCCCCAAGGAGGCTGG + Intergenic
1125919692 15:43518120-43518142 CTCAGCTGCTCCTATGCTGGGGG + Intronic
1128771341 15:70284688-70284710 CCCAGCTTGACCTGGGCTGCAGG + Intergenic
1132603353 16:783601-783623 CACAGCTGAACCTGAGCTGCAGG - Intergenic
1132866952 16:2097806-2097828 CCAAGCTGCGCCAAGGCGGCAGG + Intronic
1134117208 16:11557948-11557970 TCCAGCTGCCCCATGGCTGCTGG - Intronic
1134524813 16:14935297-14935319 CCAAGCTGCGCCAAGGCGGCAGG - Intronic
1134548085 16:15125629-15125651 CCAAGCTGCGCCAAGGCGGCAGG + Intronic
1134712402 16:16333784-16333806 CCAAGCTGCGCCAAGGCGGCAGG - Intergenic
1134720268 16:16377096-16377118 CCAAGCTGCGCCAAGGCGGCAGG - Intergenic
1134880914 16:17745022-17745044 AGCAGCTCCACCTAGGCTGGGGG + Intergenic
1134947159 16:18334789-18334811 CCAAGCTGCGCCAAGGCGGCAGG + Exonic
1134954425 16:18374910-18374932 CCAAGCTGCGCCAAGGCGGCAGG + Intergenic
1135411922 16:22241841-22241863 AGCTGCTGCACCTAGCCTGCTGG - Intronic
1135422268 16:22313433-22313455 CCCACCTCCACCTGGCCTGCTGG - Intronic
1135944507 16:26854054-26854076 CCAGGCAGCACCAAGGCTGCTGG - Intergenic
1140218652 16:73028048-73028070 CCCAGCTGCACCGAGACAGTGGG + Intronic
1141169299 16:81681031-81681053 CCCACCTGCACCCTGGCAGCTGG - Intronic
1141445216 16:84053505-84053527 ATCACCTGCCCCTAGGCTGCTGG - Intergenic
1141603835 16:85142052-85142074 CCCAGGTACCCCTAGGCTGCCGG + Intergenic
1141875877 16:86824109-86824131 CCCAGATGCACACAGGCTGGTGG + Intergenic
1142138490 16:88462172-88462194 CCCAGCTTCCCCTGGGCTGCTGG + Intronic
1142276684 16:89122428-89122450 CCCTGCTGGTACTAGGCTGCTGG + Intronic
1142502027 17:338601-338623 CCCAAGTGCTCCCAGGCTGCCGG + Intronic
1145091888 17:19992998-19993020 CCCAGCTGCAGCTACTCTGGAGG + Intergenic
1145188820 17:20820754-20820776 TCCAGCTGCATCCATGCTGCTGG - Intergenic
1145251927 17:21301482-21301504 CCCAGCATCGCCTAGGCTCCCGG - Intronic
1145996270 17:29106641-29106663 GCCAGGTGAACATAGGCTGCCGG - Intronic
1146368834 17:32251385-32251407 GCCAGTTGCACCTATGCTCCTGG - Intronic
1147915303 17:43882141-43882163 GTCAGCTGCCCCTGGGCTGCAGG + Intronic
1148087567 17:45003609-45003631 CCCAGCTGCCCCCAGTCTCCAGG - Intergenic
1148090123 17:45018471-45018493 CCCAGATGCACTTGGGCTGGGGG + Intergenic
1148811889 17:50298286-50298308 CCCAGCTGACCTGAGGCTGCTGG - Intergenic
1149480825 17:57001811-57001833 CCCAGTGAAACCTAGGCTGCTGG - Intronic
1149998498 17:61417288-61417310 CCCAGCTGCACCTTTGGTTCTGG + Intergenic
1150077858 17:62208469-62208491 TCCAGCTGCATCCATGCTGCTGG + Intergenic
1151231759 17:72690123-72690145 CCCATCTGTACCCAGGCTGGTGG + Intronic
1151365142 17:73612208-73612230 CCCAGCTGCACCCGGGCTGCAGG + Intronic
1151365168 17:73612272-73612294 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG + Intronic
1151475663 17:74343167-74343189 CCCATCTGAGCCTAGGCTGGGGG - Intronic
1151564635 17:74891063-74891085 CTCAGCTGCCTCTAGGCTCCTGG + Intronic
1152157771 17:78646140-78646162 CCCAGCTGCTCCTCAGTTGCAGG + Intergenic
1152304976 17:79515076-79515098 ACCAGGTGCACCCAGGCTGAGGG - Intronic
1152468772 17:80479186-80479208 CCCAGCTGCATCTGGGGTGTGGG - Intergenic
1152534238 17:80941233-80941255 CCCAGCTGCACCCGGGGTGGAGG + Intronic
1154032764 18:10767738-10767760 CAGAGCTGCTCCAAGGCTGCGGG + Intronic
1154302660 18:13207937-13207959 GACAGCTGAACCTGGGCTGCAGG + Intergenic
1155633332 18:27921661-27921683 TCCTGCTGCCTCTAGGCTGCTGG - Intergenic
1157815782 18:50728684-50728706 CCCAGCTGCTCTGATGCTGCTGG - Intronic
1158834686 18:61318347-61318369 CCCAGATTCTCCTAGCCTGCAGG - Intergenic
1160069011 18:75608241-75608263 CCCAGCTCCTCCTTGGCTCCTGG + Intergenic
1161288452 19:3480382-3480404 CCCCCCTGCACCTACCCTGCTGG + Exonic
1161684416 19:5695919-5695941 CCCATCTGCTCCTCGGCCGCAGG + Intronic
1163722429 19:18904682-18904704 CCCACCTGTGCGTAGGCTGCTGG - Intronic
1163817854 19:19477810-19477832 CCCCACTGCCCCTAGACTGCTGG - Intronic
1164463186 19:28465581-28465603 CTCAGCTGCACCTGGGCCCCAGG - Intergenic
1167303646 19:48694822-48694844 CCCAGCTTCAGCTAAGCAGCAGG - Intergenic
1168314128 19:55476711-55476733 CACAGCTGCACCGCCGCTGCCGG + Exonic
1168636283 19:57999803-57999825 CTCACCTGAACCTGGGCTGCTGG + Exonic
925421854 2:3719066-3719088 AACAGCTGCACCAAGCCTGCAGG - Intronic
925844034 2:8019927-8019949 CCCAGCTGCTCCCAAGCAGCGGG + Intergenic
928549510 2:32357276-32357298 CCCGGCTGCTCCTCGGCGGCGGG + Exonic
930411213 2:51028202-51028224 CGCTGCTGCTCCTGGGCTGCTGG - Exonic
934113573 2:88764619-88764641 GGCAGCTGCACCTAGGGCGCTGG - Intergenic
935177589 2:100663398-100663420 CCCAGCTCCTGCCAGGCTGCGGG + Intergenic
935423250 2:102892818-102892840 CCCAGGTGCACCTGTTCTGCCGG + Intergenic
938408104 2:131043917-131043939 CCCAGCTTCCTCTACGCTGCCGG + Intronic
942100631 2:172579307-172579329 CCCAGCAGCTACCAGGCTGCTGG + Intronic
944613274 2:201433269-201433291 TCCAGCTGCACCGATGCCGCGGG + Intronic
945494842 2:210497687-210497709 CCCAGCTGCATCCACGTTGCTGG + Intronic
948429717 2:237911801-237911823 CGCGGGTGCACCCAGGCTGCAGG + Exonic
1171123621 20:22584574-22584596 CCGAGCTGCCCCGAGGCGGCGGG + Intronic
1171268374 20:23793274-23793296 ACCAGCTGCACATTGGCTGGGGG + Intergenic
1171391531 20:24804598-24804620 CCCAGATGCACCAAAGCTCCTGG - Intergenic
1173195197 20:40908515-40908537 CCCAGCTGAGCCTAGACTCCTGG - Intergenic
1173333552 20:42095440-42095462 AACACCTGCACCCAGGCTGCAGG - Intronic
1173701426 20:45075198-45075220 CCCAGCTCCACCCAGGCTTTGGG + Exonic
1173945824 20:46950248-46950270 CCCAGCTGCCACTAATCTGCAGG + Intronic
1175704203 20:61163885-61163907 CCCAGCTGCACAGAGACTGCAGG + Intergenic
1176022890 20:62971107-62971129 CCCAGCCGCACACAGGCTCCTGG + Intergenic
1176109770 20:63405959-63405981 CCCACCCGCTCCTCGGCTGCAGG + Intergenic
1176903060 21:14467003-14467025 CCCAGTGGCTCCTAGGCTTCTGG + Intergenic
1178336729 21:31750082-31750104 CCCAGCTCCAACTTGGCGGCTGG - Intergenic
1179572767 21:42287553-42287575 CCCAGCTCCACCTTGGAGGCTGG + Intronic
1179573783 21:42294295-42294317 CCCAGCTCATCCTGGGCTGCAGG + Intronic
1181088496 22:20456391-20456413 ACCAGCTGCATCGTGGCTGCCGG - Intronic
1181601419 22:23954004-23954026 CCCAGCAGCAGCTACTCTGCAGG - Intergenic
1181607088 22:23987333-23987355 CCCAGCAGCAGCTACTCTGCAGG + Intergenic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1183862814 22:40681848-40681870 CGAAGCTGCCCCTGGGCTGCAGG - Exonic
1184118627 22:42436452-42436474 CCCGGCTGCTCCTAGGATGGAGG - Intergenic
1184449674 22:44575594-44575616 CCCAGCAGCACATTGGCTCCAGG - Intergenic
1185291674 22:50030615-50030637 CCCACCCGCACCAAAGCTGCTGG - Exonic
1185419333 22:50726812-50726834 CCCAGCTGCATGTGGCCTGCAGG - Intergenic
950002379 3:9667187-9667209 CCCCGCTTCATCTAAGCTGCTGG - Intronic
950535871 3:13577806-13577828 CCCAGCTGCCCCCGGGCTGGTGG - Intronic
950835602 3:15915896-15915918 CCCAGCTACAGCTACGCTGGAGG + Intergenic
953397089 3:42581941-42581963 CCTACCTGCGCCTGGGCTGCCGG - Exonic
954248831 3:49352864-49352886 TCCAGCTGCCCCGAGACTGCAGG + Intergenic
956482513 3:69687393-69687415 ACCACCTGCTCCTTGGCTGCAGG + Intergenic
959498045 3:107073931-107073953 CCCAGAAGCACCTGGGATGCAGG + Intergenic
964343384 3:155731374-155731396 CCCTCATGCACCTAGGCAGCAGG + Intronic
965454149 3:168876582-168876604 CCCAAATGCACATGGGCTGCTGG + Intergenic
967740087 3:192995216-192995238 TCCAGCTGCATCCATGCTGCTGG + Intergenic
967917643 3:194590656-194590678 ACCAGAAGCACCCAGGCTGCTGG + Intronic
968063939 3:195747906-195747928 GTCAGCTGCACCTGGGCGGCAGG + Intronic
968551992 4:1228570-1228592 CTCAGCCGCATGTAGGCTGCAGG + Intronic
968669151 4:1839362-1839384 CACAGGTGCACCTCTGCTGCAGG - Intronic
969281789 4:6175655-6175677 CCCAGCTCCACCCAGGCAGATGG + Intronic
969681556 4:8646016-8646038 CACAGCAGCACCTTGTCTGCAGG + Intergenic
972998442 4:44913446-44913468 CCTAGCTGCCACAAGGCTGCAGG - Intergenic
980243095 4:130202274-130202296 CCCTGTGGCACCCAGGCTGCTGG - Intergenic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
981337167 4:143580946-143580968 CCCAGCCCCACCTAGGCTCTTGG + Intronic
981727364 4:147861937-147861959 CCCAGCGGCTCCCAGGCTTCAGG + Intronic
985673189 5:1216886-1216908 ACCAGCTGCGCGTAGGCCGCGGG - Exonic
985680603 5:1253816-1253838 CTCAGCTGCGTCTGGGCTGCGGG + Exonic
985959806 5:3292925-3292947 CCCAGCTACACAGAGGCTGAAGG - Intergenic
987245301 5:16042464-16042486 ACCAGATGCACCTAGGATGTGGG + Intergenic
987726939 5:21715537-21715559 TCCAGCTGCATCTAGGTTGATGG + Intergenic
992660689 5:78957890-78957912 CCCATCTGGACCTTGGCTGGTGG - Intronic
994306995 5:98217400-98217422 CCTAGCTGTTCTTAGGCTGCTGG - Intergenic
998392142 5:141794097-141794119 CCCTGCTGAATCTAGGCAGCCGG - Intergenic
999131621 5:149288090-149288112 CCCAGCCTCACCTAGGCCTCAGG + Intronic
1000137332 5:158365420-158365442 CCCAGCTACAACTTGGCTCCAGG + Intergenic
1002134831 5:177101039-177101061 CCCAGCTGCTGCCATGCTGCCGG - Intergenic
1002198809 5:177515426-177515448 CCTGGCTGCACCTAGCCTGTGGG - Intronic
1002278525 5:178118020-178118042 CACAGCTGCAGCTGGCCTGCTGG + Intronic
1002527495 5:179822895-179822917 CTCAGCTGGACATAAGCTGCTGG - Intronic
1005220167 6:23577517-23577539 CCCAGGTTCACCTAGACTCCAGG + Intergenic
1005278164 6:24242388-24242410 CCTACATGCACCTAGGCTGGAGG - Intronic
1006037232 6:31223183-31223205 CCCAGCTGCTCCCAGGCCACTGG + Intergenic
1006669362 6:35720125-35720147 CCCAGCTGCAGCTGGTCTTCCGG + Intronic
1006719483 6:36140929-36140951 CCCAGGTGCACCAGGACTGCAGG + Intronic
1007094800 6:39206558-39206580 CCCAGCTGCCCCTCGCGTGCTGG + Intronic
1011713782 6:90083059-90083081 TCCAGCTGCCACAAGGCTGCAGG + Intronic
1013603438 6:111726370-111726392 CCAGCCTGCACCTAGGCTACAGG - Intronic
1016539433 6:145147742-145147764 TCAAGCTGCAGCTAGTCTGCAGG - Intergenic
1017222895 6:151987104-151987126 CCCATTTGGACCCAGGCTGCAGG - Intronic
1018238412 6:161748976-161748998 CCCAGCTGCCCCCTGGCGGCGGG - Intronic
1018311163 6:162510481-162510503 GCCAGCTGCACCGAGGAAGCAGG + Intronic
1019354495 7:571669-571691 TCCAGCTGCCCCCAGGCTGTGGG + Intronic
1019413072 7:914994-915016 CCCGGCTGCAGGGAGGCTGCTGG - Intronic
1019429366 7:991563-991585 CACAGCTGCACTCAGGCTGCCGG + Intergenic
1019596820 7:1861931-1861953 CCCAGCAGCTCCTGGGCTGGGGG - Intronic
1019659896 7:2218365-2218387 CGCAGCTGCACCAGGGCTGGGGG - Intronic
1022806160 7:33824508-33824530 CATAGCTCCACCTAGGCTGCAGG - Intergenic
1023002129 7:35821073-35821095 TCCAGTTGCCACTAGGCTGCTGG + Intronic
1024090894 7:45939083-45939105 CCCTGCTGCTCTCAGGCTGCAGG - Intergenic
1024361169 7:48470029-48470051 CACAGCTGCAGAGAGGCTGCTGG - Intronic
1025739670 7:64184394-64184416 CCCTGCTGCACCCGGGCTGCAGG + Intronic
1026001000 7:66558708-66558730 CCCTGCTGCATCTGGCCTGCAGG + Intergenic
1026087644 7:67275615-67275637 CCCATCAGCACCAAAGCTGCTGG + Intergenic
1026726588 7:72874616-72874638 CCCATCAGCACCAAAGCTGCTGG - Intergenic
1026968720 7:74455154-74455176 CCCAGCTGAAGCGAGGGTGCTGG + Intronic
1027117252 7:75490994-75491016 CCCATCAGCACCAAAGCTGCTGG + Intergenic
1027274557 7:76544608-76544630 CCCATCAGCACCAAAGCTGCTGG - Intergenic
1030549776 7:110943831-110943853 CCCTGCAGCACTTATGCTGCTGG + Intronic
1030819729 7:114081784-114081806 CCTAGCTTCTCCTAGGCTGCTGG - Intergenic
1035125591 7:156606692-156606714 CCCAGGTGCGACTTGGCTGCCGG - Intergenic
1035168586 7:157005722-157005744 CCCAGCAGCTCCTCGGCTCCCGG + Exonic
1035171106 7:157017969-157017991 CCCAGATGCACCCAGGCGCCGGG - Intergenic
1035347813 7:158217221-158217243 TCAAGGTGCAGCTAGGCTGCTGG - Intronic
1035569289 8:661319-661341 CCCAGCTGCCGCCAGGCTCCAGG - Intronic
1036794766 8:11747416-11747438 CCCAGCTACCACAAGGCTGCCGG - Intronic
1039408413 8:37331884-37331906 TCCAGCTTCACATGGGCTGCTGG + Intergenic
1039788982 8:40859073-40859095 CCCAGCTGGACCAGGGCTGCTGG + Intronic
1039842055 8:41301068-41301090 CCCAGCTCCACAGAGGCTCCCGG + Intronic
1041381759 8:57259553-57259575 CCCTGCTGCAGCTGTGCTGCGGG - Intergenic
1042604523 8:70532289-70532311 CACAGCTGCCCGTAGGATGCTGG - Intergenic
1044430520 8:92102308-92102330 CCCGGCTGCAACTAGGGTGGGGG - Intronic
1048037728 8:130693339-130693361 GCCATCTGCACCCAGGTTGCTGG + Intergenic
1048335436 8:133498874-133498896 CCCAGGTGCGCCTAAGCTCCGGG + Intronic
1049999034 9:1056694-1056716 CCCAGCTGGCCCCAGGCTTCAGG - Exonic
1051911170 9:22154880-22154902 CCCTGCTGCACCTGGCCTGCAGG + Intergenic
1053260723 9:36661125-36661147 TCCAGCGGCTCCTAGGTTGCTGG + Intronic
1053300555 9:36946241-36946263 CCCAGCTGCCCCTGAGCTTCAGG + Intronic
1053550430 9:39073697-39073719 CCCAGAGGCTCCGAGGCTGCAGG + Exonic
1056814627 9:89792329-89792351 CTCAGCTGCCCCCAGCCTGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059735650 9:117097063-117097085 TCCAGTGGTACCTAGGCTGCAGG + Intronic
1059908134 9:119011594-119011616 CTCAGCTGCAACTACCCTGCAGG + Intergenic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1061193335 9:129094653-129094675 CACAGCTGGACCTTGGCTCCTGG + Intergenic
1061211093 9:129193925-129193947 CCCAGCTGCCCCTGGGAGGCAGG - Intergenic
1061859917 9:133462714-133462736 CCCAGCTGCACCTCACCAGCAGG - Intronic
1062545787 9:137063275-137063297 CCCTGCTGCACCTGGTCTGCAGG - Exonic
1203441711 Un_GL000219v1:15696-15718 CCCAGCTGCACCGGGTCTCCTGG + Intergenic
1203512521 Un_KI270741v1:134605-134627 CCCAGCTGCACCGGGTCTCCTGG + Intergenic
1187258209 X:17660547-17660569 CCCAGCTGAACCTTGCCTGCAGG - Intronic
1189235600 X:39484658-39484680 GCCACCTGCACAAAGGCTGCAGG - Intergenic
1192169246 X:68844194-68844216 CCCAGCTGGGCCTAAGCTCCTGG + Intergenic
1194542877 X:95196446-95196468 CTGAGCTGCTCCTAGTCTGCTGG + Intergenic
1195341780 X:103913641-103913663 CCCAGCTGAGCCTAGGATCCAGG - Intergenic
1197788316 X:130223170-130223192 CCCAGCTACTCGTAGGCTGAGGG - Intronic
1199649876 X:149940089-149940111 CCAAGCTGCACCAAGGCTGGCGG + Intergenic
1199895493 X:152122943-152122965 CCTACCAGCACCTAAGCTGCTGG + Intergenic
1200117151 X:153774408-153774430 CCCATCTGCACCTGGGGGGCGGG - Exonic