ID: 1151365999

View in Genome Browser
Species Human (GRCh38)
Location 17:73616953-73616975
Sequence ATGAGAGGGCGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151365991_1151365999 12 Left 1151365991 17:73616918-73616940 CCTAGGGAGAGCGGAGGTCTAGA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1151365999 17:73616953-73616975 ATGAGAGGGCGGGTTTTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151365999 Original CRISPR ATGAGAGGGCGGGTTTTCAC AGG Intronic
903032659 1:20475024-20475046 ATGAGTGGGCGGGATTTCAGCGG - Intergenic
904463805 1:30696062-30696084 AAGAGAGGGTGGGAATTCACAGG + Intergenic
907679371 1:56549501-56549523 ATGAAAGGGCTGGTTTTCCCAGG + Intronic
912196303 1:107401193-107401215 ATCGGATGGCGGATTTTCACAGG + Intronic
913317338 1:117564136-117564158 AAGAGAGGGCAGCTCTTCACTGG + Intergenic
917847417 1:179032809-179032831 AGGAGTGGGCTGGTTTTCCCAGG + Intronic
923843906 1:237706878-237706900 ATGATATGGCGGATTTCCACAGG - Intronic
1064352170 10:14586235-14586257 AAGAGAAGGTGGGTTTTCAGTGG - Intronic
1072692462 10:97580958-97580980 GTGAGAGGGCAGGTATTCAATGG + Intronic
1075609590 10:123841732-123841754 ATAAGACGGAGGGTTTTCAGGGG + Intronic
1080929468 11:36793503-36793525 AGGAGAGGGCTGGGATTCACAGG + Intergenic
1081722471 11:45300411-45300433 AAGAGAGGGGGAGTTATCACTGG + Intergenic
1081810028 11:45909408-45909430 ATGAGAGGCTGGCTCTTCACAGG + Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1096484993 12:51974031-51974053 ATGACAGGGTGGCTTTTCATGGG + Intronic
1099774604 12:87109340-87109362 ATGACAGGGAGGTTTTTCAGGGG + Intergenic
1101609900 12:106281617-106281639 ATGATAGGGAGGGTTTTCAAGGG + Intronic
1111046804 13:82824245-82824267 ATCAGAGGAGAGGTTTTCACAGG + Intergenic
1114590103 14:23856193-23856215 AAGAGAGAGCAGATTTTCACTGG - Intergenic
1114955107 14:27807599-27807621 GTGAGAGGTCGAGTATTCACTGG + Intergenic
1116001351 14:39245759-39245781 ATGAGCGGGCTTGTTATCACAGG - Intronic
1117083532 14:52176564-52176586 AGGATAGGAAGGGTTTTCACAGG - Intergenic
1119894366 14:78207233-78207255 AAGAAGGGGTGGGTTTTCACAGG - Intergenic
1128637500 15:69312605-69312627 AGGAGAAGGGGGGTTTTCATGGG - Intronic
1134571914 16:15298336-15298358 GGGAGCGGGCTGGTTTTCACAGG + Intergenic
1134730470 16:16457707-16457729 GGGAGCGGGCTGGTTTTCACAGG - Intergenic
1134936963 16:18254189-18254211 GGGAGCGGGCTGGTTTTCACAGG + Intergenic
1142718312 17:1759839-1759861 ATGAGAGGAAGGCTTTTCACTGG - Intergenic
1143731580 17:8885440-8885462 ATGGGAGGGCGGGGTTACCCAGG - Intronic
1143731701 17:8885719-8885741 ATGGGAGGGCGGGGTTACCCAGG - Intronic
1143731716 17:8885752-8885774 ATGGGAGGGCGGGGTTACCCAGG - Intronic
1143731731 17:8885785-8885807 ATGGGAGGGCGGGGTTACCCAGG - Intronic
1143731800 17:8885949-8885971 ATGAGAGGGCGGGGTTACCTAGG - Intronic
1145212432 17:21024266-21024288 ATGTGTGGGCTGTTTTTCACGGG - Intronic
1151365999 17:73616953-73616975 ATGAGAGGGCGGGTTTTCACAGG + Intronic
1152684870 17:81688980-81689002 ATGTGAGGGCGGGTTCAGACCGG + Intronic
1158052113 18:53234548-53234570 AAGAGAGTGAGGGTTTTCACAGG - Intronic
1162721343 19:12664711-12664733 GGGAGAGGGCGGGGTTTGACTGG + Intronic
1167603786 19:50469272-50469294 ATGAGGGGGCGGGTCTTGCCTGG - Intronic
925888197 2:8411643-8411665 ATGAGAGGGCGAGTCTTTGCTGG - Intergenic
930072054 2:47374163-47374185 ATGAGAAGGAAGCTTTTCACTGG - Intronic
934482237 2:94661923-94661945 GTGAGAGGTCGAGTATTCACTGG - Intergenic
938996911 2:136689428-136689450 TTGGGAGGCAGGGTTTTCACTGG - Intergenic
946028915 2:216690038-216690060 ATAAAAGGGGGGGATTTCACTGG + Intronic
1170152236 20:13237761-13237783 AAGAGATGGCTGATTTTCACTGG + Intronic
1173036962 20:39421183-39421205 ATGAGAGGTCTGGTCTTCGCTGG + Intergenic
1178872014 21:36385276-36385298 ATGAGTGGGCGGGGCTTCCCTGG + Intronic
1181784093 22:25213701-25213723 ATTAGTGAGCGGGTTATCACTGG - Intergenic
954043622 3:47910083-47910105 AGGAGTGGGCAGTTTTTCACAGG + Intronic
963634288 3:147775058-147775080 ATGAGAGGGCGTGTCTTGCCGGG - Intergenic
969344652 4:6563403-6563425 AGGAGAGGGCGCGTCTTCGCGGG - Intronic
982343574 4:154331548-154331570 AGCAGATGGAGGGTTTTCACAGG - Intronic
998174793 5:139895128-139895150 ATGTGAGGGCAGGTATGCACAGG + Intronic
1001127163 5:169030064-169030086 AGGAGAGGGCAGGTTTCCAAGGG - Intronic
1001534237 5:172487624-172487646 AGGAGAGGCCAGGGTTTCACAGG - Intergenic
1003052657 6:2793759-2793781 GTAAGAAGGCGTGTTTTCACCGG - Intergenic
1003447036 6:6194216-6194238 AAGTGAGGGAGAGTTTTCACTGG - Intronic
1022432327 7:30337849-30337871 GTGAGAGGGAGAGTTTTCACTGG - Intronic
1033705644 7:143882879-143882901 AGGAGAGGAGGGGTTTCCACGGG + Intronic
1033909391 7:146246425-146246447 ATGAGAGTGGGGGTTTTAAGAGG + Intronic
1035294862 7:157861301-157861323 ATGAGAGGCCTGGATTGCACCGG + Intronic
1045093517 8:98772368-98772390 TTGAGATGGTGAGTTTTCACAGG + Intronic
1045990600 8:108302176-108302198 ATGAGAATGCATGTTTTCACTGG + Intronic
1046263131 8:111797152-111797174 ATGAGAGGGAGACGTTTCACTGG + Intergenic
1047511929 8:125522004-125522026 ATGAGAAGGCTGATTTTCGCTGG + Intergenic
1060748775 9:126155153-126155175 AGGAGGGGGCAGGTTTTCCCAGG - Intergenic
1061202384 9:129145460-129145482 AGGAGAGGGCTTGTTTTCTCAGG + Intronic
1062732801 9:138119116-138119138 ATGAGAGTGGGGGTTGTCTCAGG - Intronic
1187002138 X:15193134-15193156 GTGAGAGGGAGGCTTTTCATGGG + Intergenic
1197658115 X:129139760-129139782 ATGAGATGGTGAATTTTCACTGG + Intergenic