ID: 1151366742

View in Genome Browser
Species Human (GRCh38)
Location 17:73622528-73622550
Sequence CAGTGTTTGAGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 766}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151366733_1151366742 -7 Left 1151366733 17:73622512-73622534 CCTCTTCCCCACAATTCAGTGTT 0: 1
1: 0
2: 3
3: 21
4: 267
Right 1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 63
4: 766
1151366731_1151366742 7 Left 1151366731 17:73622498-73622520 CCAGTCTTTTTCCTCCTCTTCCC 0: 1
1: 1
2: 21
3: 196
4: 1655
Right 1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 63
4: 766
1151366730_1151366742 8 Left 1151366730 17:73622497-73622519 CCCAGTCTTTTTCCTCCTCTTCC 0: 1
1: 1
2: 13
3: 201
4: 2026
Right 1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 63
4: 766
1151366732_1151366742 -4 Left 1151366732 17:73622509-73622531 CCTCCTCTTCCCCACAATTCAGT 0: 2
1: 0
2: 1
3: 33
4: 328
Right 1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 63
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151366742 Original CRISPR CAGTGTTTGAGGAGGGAGGG AGG Intronic
900534137 1:3168720-3168742 CAGGGAATGAGGAGGGAGTGGGG + Intronic
900557132 1:3286285-3286307 CAGTGTTTGCGGACCAAGGGGGG + Intronic
900562628 1:3315023-3315045 CAGGGGCTGGGGAGGGAGGGTGG - Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900946852 1:5835674-5835696 CAGTGGTTGAGGCAGGAGGATGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
902456711 1:16538826-16538848 CAGTGCTTGGGGAGGGAGTTGGG - Intergenic
902495457 1:16869085-16869107 CAGTGCTTGGGGAGGGAGTTGGG + Intronic
902785512 1:18730521-18730543 CAGGGTTTGTGGTGGGTGGGTGG - Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903743918 1:25574083-25574105 GAGTGCTGGAGGAGGTAGGGAGG + Intergenic
903979593 1:27176321-27176343 CAAAGTGTGAGGAGGGAGGTGGG + Intergenic
904053545 1:27655690-27655712 CACTGTGTGAGGAAGAAGGGTGG + Intergenic
904251168 1:29225338-29225360 CAGTGTATGAGGAGAGAAAGTGG - Intronic
904497600 1:30895854-30895876 GAGGGTGGGAGGAGGGAGGGAGG + Intronic
904532777 1:31180361-31180383 GAGTGTCTGTGGAGGGAGGTGGG + Exonic
904609672 1:31718572-31718594 CAGTGGTTGATGGGGGATGGGGG - Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905894095 1:41534120-41534142 CAGTGGTATAGGAGAGAGGGTGG - Intronic
905965794 1:42094077-42094099 CAATGTTGGAGGATGGAGGTGGG - Intergenic
906099958 1:43253885-43253907 AAATGTTTGAGGAAGCAGGGAGG + Intronic
906483485 1:46216791-46216813 GACTGTTGGAGGAGGGAGAGAGG - Intronic
906560031 1:46749514-46749536 AAGTGGTTGAGGAAGGAGGCAGG - Intergenic
906727164 1:48052453-48052475 CAGGGTATGAGGAGTCAGGGAGG + Intergenic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
907427801 1:54391879-54391901 CTGTGATTGAGGTGGGTGGGTGG - Intronic
908437523 1:64121195-64121217 CAGGGGAGGAGGAGGGAGGGAGG - Intronic
909187488 1:72506688-72506710 AAGTGTCTGAGGAAGGAAGGTGG - Intergenic
909610767 1:77549594-77549616 CAGTGTCTGGGAAGGGAGAGGGG - Intronic
909857683 1:80559877-80559899 CATTGTTAGGGGAGGGAGTGGGG - Intergenic
910060674 1:83088024-83088046 CAGTGTTTTAGTAGTGAAGGAGG + Intergenic
910158061 1:84242772-84242794 GCGTGTTTGGGGAGGGAGAGTGG - Intergenic
912516680 1:110220670-110220692 CTGTTTTTCAGGAGAGAGGGTGG + Intronic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
913462806 1:119105920-119105942 AAGTGTATTAGGAGGGAGGGTGG + Intronic
913661957 1:121012469-121012491 CAGTGCTTGGGGAGGGAGTTGGG - Intergenic
913998384 1:143670897-143670919 CAGGGATTAAGGAGGGAAGGAGG + Intergenic
914320745 1:146556987-146557009 CAGTGTTTGAGGACAAAGGCTGG + Intergenic
914651956 1:149704263-149704285 CAGTGCTTGGGGAGGGAGTTGGG - Exonic
914919288 1:151836972-151836994 CAGGCTTGGAGGAGGGAGGGAGG - Intergenic
915351409 1:155228912-155228934 CAGAGGTTGTGGAGAGAGGGTGG + Intergenic
915396621 1:155590036-155590058 CAGTGTTGGAGGTGGGGGCGGGG + Intergenic
915527024 1:156482241-156482263 CAGGGTCTGAGGAGGAAGGAAGG - Intronic
915567909 1:156726792-156726814 CAACGTTTGTGGAGGGAGGGAGG - Intronic
915580126 1:156808545-156808567 AAGGGTCTGAGGAGGGAGGCTGG + Intronic
917286801 1:173429684-173429706 AAATGTTTGAGAAGGGAGAGAGG + Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918403905 1:184192795-184192817 CAGGGTTGGGGGTGGGAGGGTGG + Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
919763168 1:201111029-201111051 CAGTGTTTGAGAAAAGAGGAGGG + Intronic
919856265 1:201708410-201708432 TAGGGTTTGAGGGGGGAAGGGGG - Intronic
920119372 1:203644364-203644386 GAGGTTTTGAGCAGGGAGGGTGG - Intronic
920309283 1:205039129-205039151 CAGAGGATGAGGAGAGAGGGAGG - Intergenic
920577573 1:207072742-207072764 AAGTGTTGGGGGATGGAGGGCGG + Exonic
920726322 1:208438574-208438596 CAATGTTTCTGGAGTGAGGGAGG + Intergenic
920792435 1:209106059-209106081 TAGTGTTTCAGGAATGAGGGTGG + Intergenic
921036451 1:211383393-211383415 AAGGGTTTGAGAAGGAAGGGAGG - Intergenic
921185659 1:212667378-212667400 AAGTGTTGGAGGTGTGAGGGTGG + Intergenic
921399167 1:214701766-214701788 AAGGGTTTAAGGAGGGAGAGCGG - Intergenic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922002466 1:221493910-221493932 GAGTATTTGAGGAAGGAGAGAGG - Intergenic
922481635 1:225943398-225943420 GTGTGTTTGAGGAGGCATGGGGG + Intergenic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922712157 1:227842309-227842331 CAGTGTCTAAGAAGGGAGAGAGG - Intronic
923531742 1:234817530-234817552 CACTCTTTGATGATGGAGGGTGG + Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924250911 1:242132183-242132205 CAGTGATTGCGGGGGGGGGGGGG + Intronic
924572411 1:245249043-245249065 CAGTGTTAGAGGAGGTAATGTGG + Intronic
924898189 1:248365478-248365500 CAAAGTTGGAGGTGGGAGGGAGG - Intergenic
1063407585 10:5812579-5812601 CAGTAAGTGAGAAGGGAGGGTGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063608026 10:7540036-7540058 AAGTTTTTGGGGATGGAGGGAGG - Intergenic
1064097018 10:12431416-12431438 CAGTGTCTGAGGAGAGAGACTGG + Intronic
1064232453 10:13541202-13541224 CAGTGTTTGCGGATGGGGAGAGG + Intergenic
1064339877 10:14476329-14476351 CAGTGTTTCAGCTGGGAGGCTGG - Intergenic
1065189495 10:23196851-23196873 CAGAAATTGAAGAGGGAGGGAGG - Intergenic
1065443261 10:25773168-25773190 CCGGGTGTGAGGAGGGGGGGTGG + Intergenic
1065610462 10:27466834-27466856 CCGGGTGTGAGGAGGGGGGGTGG - Intergenic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1065702818 10:28442216-28442238 CAGTGCTTGGGAAAGGAGGGAGG - Intergenic
1066107220 10:32166599-32166621 GAGCTTTTGTGGAGGGAGGGAGG + Intergenic
1067172867 10:43922293-43922315 CCGTGTTTGGGGAGGAAGGGAGG - Intergenic
1067501162 10:46806435-46806457 CAGTGTCTGATTAGGGTGGGTGG - Intergenic
1067593418 10:47533480-47533502 CAGTGTCTGATTAGGGTGGGTGG + Intronic
1067640527 10:48041584-48041606 CAGTGTCTGATTAGGGTGGGTGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067720593 10:48725013-48725035 CAGGGTCTGAGGAGGTAGTGTGG + Intronic
1068905331 10:62315785-62315807 CAGCGATAGAGGAGGGAGGAGGG + Intergenic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069489648 10:68850404-68850426 AAGTGTTTAAGGTGGGAGGGAGG - Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069592378 10:69650128-69650150 AAGTCTTTGAGGGGTGAGGGTGG + Intergenic
1069780062 10:70949722-70949744 CAGTGGTCTAGGAGAGAGGGAGG + Intergenic
1069906701 10:71736293-71736315 CACTGTTTGAGGTGCTAGGGTGG + Intronic
1069917324 10:71795703-71795725 CGGGGTGGGAGGAGGGAGGGAGG - Intronic
1069949673 10:72010226-72010248 CTGGGTTTGAGGTGGGAGTGGGG - Exonic
1069984178 10:72272842-72272864 CAGTGGTTGCTGAGGGTGGGTGG - Intergenic
1070190438 10:74107084-74107106 CAGTGATTGAAGAAGGGGGGAGG - Intronic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1071371993 10:84961133-84961155 CAGTGATTAAGGAGGCAGTGGGG - Intergenic
1071708130 10:88021607-88021629 CAGAGTTTCATGAGTGAGGGAGG + Intergenic
1072722455 10:97789283-97789305 AAGTGTCTGGGTAGGGAGGGTGG + Intergenic
1073515767 10:104074336-104074358 CAGTGTTTCAGGGGGGAATGAGG + Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1075223603 10:120605126-120605148 GGGTGTTTGGGGATGGAGGGTGG + Intergenic
1075576085 10:123578487-123578509 GAGGGTATGAGAAGGGAGGGAGG + Intergenic
1075859896 10:125666662-125666684 CAAGGTTGGAGGAGGGGGGGCGG - Intronic
1076058612 10:127395660-127395682 CAGACTTAGAGGAGGGAGGGTGG + Intronic
1076579016 10:131494507-131494529 CAGTGTTGGAGCAGGGAGATTGG + Intergenic
1076612556 10:131735802-131735824 CTGGCTTTGAGGATGGAGGGCGG + Intergenic
1076809359 10:132878672-132878694 CAGTGGTTGAGGCTGGTGGGGGG + Intronic
1077082349 11:729638-729660 CACTGGGCGAGGAGGGAGGGCGG + Intergenic
1077543483 11:3158672-3158694 CAGTGGTGCAGGAGAGAGGGAGG + Intronic
1077976287 11:7251933-7251955 CGGTGTCTGGGGAGGGACGGAGG + Exonic
1078182327 11:9022515-9022537 CAGTTTTGGAGGAGTGATGGGGG - Intronic
1078760567 11:14248087-14248109 AAGTGTTTGAGGCGGGTGGTTGG + Intronic
1078846543 11:15123888-15123910 CAGTGTTAGAGGTAGGAAGGAGG - Intronic
1080250761 11:30230366-30230388 TGGTGTTGGAGGAGGCAGGGAGG + Intergenic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1081647842 11:44802308-44802330 AAGTGGTTGAGGTGGGTGGGGGG + Intronic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1081772142 11:45656716-45656738 CAGTGCCTGGGGGGGGAGGGTGG - Intronic
1082641798 11:55669991-55670013 GAGGGTTGGAGGAGGGAGAGGGG - Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082920797 11:58491317-58491339 CAGAATTTGAGGAGGGAGGGAGG + Intergenic
1083363485 11:62127748-62127770 CTGTGTTTGGGCAGGGAGTGAGG + Intronic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084353982 11:68624604-68624626 CAGGGTGTGAGGAGGGGAGGTGG - Intergenic
1084457125 11:69274308-69274330 CAGGAATTGAGGAAGGAGGGAGG + Intergenic
1085310431 11:75513497-75513519 CAGTCTGTGAGGAGGAAGTGTGG - Intronic
1085325965 11:75606801-75606823 CAGAGCTAGAGGAGGGAGGTTGG - Intronic
1085407919 11:76275004-76275026 CTGACTTTGAGGAGGGAAGGGGG + Intergenic
1085703740 11:78768035-78768057 CAGTTTTAGTGGAGGGAGAGAGG - Intronic
1086080825 11:82900909-82900931 CAGTGTATCACGAGGCAGGGAGG + Intronic
1087433060 11:98078107-98078129 CATTGTTTGGGGATGGAGGGCGG - Intergenic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088245533 11:107814494-107814516 GAGTTTGTGGGGAGGGAGGGAGG + Intronic
1088723182 11:112612404-112612426 CAGGGTTGGGGGTGGGAGGGGGG + Intergenic
1088949504 11:114553043-114553065 CAGTGTTGGTGCAGTGAGGGAGG - Intronic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089316905 11:117598145-117598167 CAGTGGAGGAGAAGGGAGGGAGG - Intronic
1090527920 11:127557266-127557288 CAGTGTGTGAGGAAGTAGAGGGG + Intergenic
1090589119 11:128246490-128246512 CAGTGGGGGAGGAGGGAGCGGGG - Intergenic
1091312152 11:134582189-134582211 CAGGGTCTAAGGATGGAGGGTGG + Intergenic
1091446382 12:546196-546218 GGGTGTGAGAGGAGGGAGGGGGG + Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092971587 12:13700680-13700702 GAGTGTTTGACGAGGGCTGGAGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094564487 12:31587841-31587863 CAGTATTTGAGGTGAGAGGCTGG - Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096511511 12:52132238-52132260 CAGTGATTGCACAGGGAGGGGGG + Intergenic
1096695537 12:53345931-53345953 AATTGTTCCAGGAGGGAGGGAGG - Intergenic
1096841655 12:54383549-54383571 CAGTGTTTGAGGAAGGTGAGTGG - Intronic
1097173102 12:57128427-57128449 GACGGGTTGAGGAGGGAGGGAGG - Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1101566343 12:105909503-105909525 CAGTGTCTGAGGACAGAGGCTGG - Intergenic
1102173751 12:110861187-110861209 CAGTGTTGGAGGAGGGACCTGGG - Intronic
1102394359 12:112574544-112574566 GGGTGATGGAGGAGGGAGGGGGG + Intronic
1102394494 12:112574966-112574988 GGGTGGTGGAGGAGGGAGGGAGG + Intronic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1103137289 12:118518568-118518590 CAGTGTTGGAGGTGGGAGCCTGG - Intergenic
1103508118 12:121454968-121454990 CTGTATTTGAGGAGAAAGGGGGG - Intronic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1104647403 12:130506977-130506999 CTGTGGTGGAGGTGGGAGGGAGG - Intronic
1105854126 13:24360524-24360546 GAGGGTTTGAGGATGGAAGGAGG + Intergenic
1106351661 13:28936644-28936666 CAGCGTTGGAGGAGGGCGTGTGG + Intronic
1106747996 13:32724355-32724377 CAATTTTTGAGGAGGAAGGGTGG - Intronic
1107011318 13:35673799-35673821 AAGTGCTTGGGGTGGGAGGGGGG - Intergenic
1107578851 13:41759895-41759917 GGGTATTTGGGGAGGGAGGGAGG - Intronic
1108203723 13:48067181-48067203 CAGTGGTTGGGGGGGGAGGGAGG - Intronic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108554638 13:51581249-51581271 CAAAGTTTGAGGAGGGAGGAAGG - Intergenic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109214489 13:59572427-59572449 CAGAGACTAAGGAGGGAGGGTGG + Intergenic
1109935252 13:69274453-69274475 GAGTGTGTGTGGCGGGAGGGAGG + Intergenic
1109987782 13:70012512-70012534 CAGTCTTTGAAGAGGGGGAGGGG + Intronic
1110009352 13:70312349-70312371 CAGAGTCTGGGGAGGGATGGGGG + Intergenic
1110064527 13:71087238-71087260 CCCTGTTGGAGGATGGAGGGTGG + Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111479794 13:88809894-88809916 CAGTGTTGGAGGTGGGTGGGAGG + Intergenic
1111546564 13:89745613-89745635 CAATCTGTAAGGAGGGAGGGAGG - Intergenic
1111696032 13:91625510-91625532 AAGTGTTTGAGTAGAGAGAGTGG + Intronic
1111827878 13:93291300-93291322 CATTGTTTGAGAAGAGATGGTGG - Intronic
1112163461 13:96893088-96893110 GAGTGACTGAGGAAGGAGGGAGG + Intergenic
1112199470 13:97261041-97261063 CAGTGTTGGAGGAAGCAGTGTGG - Intronic
1113391878 13:109905711-109905733 AAGGGTGTGTGGAGGGAGGGAGG - Intergenic
1114265105 14:21069258-21069280 CGGGGTTTGATGAGGGAGTGAGG + Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1115351906 14:32404912-32404934 CTGTATTCCAGGAGGGAGGGAGG + Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1117370031 14:55069704-55069726 GAGGGTTTGCGGAGGAAGGGTGG - Exonic
1118471592 14:66079716-66079738 CATAGTTTGGGGAGGGAGAGTGG - Intergenic
1118781706 14:69012960-69012982 CACTGGTTTAGGAGGGAGGTGGG - Intergenic
1118880156 14:69818948-69818970 CGGTGTTTGGGGAGGCGGGGAGG + Intergenic
1119320690 14:73728497-73728519 CAGCGATGGAGGAGGGCGGGGGG - Intronic
1120655595 14:87186193-87186215 CAGTGCTTCAGCAGGGAGGCAGG + Intergenic
1120996358 14:90421276-90421298 CAGTGTTTGAAGAGGGAGATTGG - Intergenic
1121122167 14:91382980-91383002 CAGAGTTGGAGGATGGAAGGAGG - Intronic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121646621 14:95522157-95522179 CAGAGTTTAAGGAGGGAATGGGG - Intergenic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1121894507 14:97634010-97634032 AGGTATTTGTGGAGGGAGGGAGG + Intergenic
1122629464 14:103100699-103100721 CAGGGTTTGGGGAGCTAGGGAGG - Intronic
1123445883 15:20329812-20329834 CAGGCTTTGAGGATGGAGGAAGG - Intergenic
1123685506 15:22794391-22794413 CAGTGTGTGAAGATGGAGTGTGG + Intronic
1123790194 15:23711933-23711955 CAGTCTCTGAGGAGGTAAGGAGG + Intergenic
1125408700 15:39382228-39382250 CCCTGTTTGAGGGTGGAGGGTGG + Intergenic
1125927269 15:43573211-43573233 AAGTCTTTGAGGTGGGAGGAGGG - Intronic
1125940412 15:43672776-43672798 AAGTCTTTGAGGTGGGAGGAGGG - Intergenic
1126572896 15:50170498-50170520 CAGTTCTTGTGGAGGGTGGGGGG - Intronic
1126645845 15:50874225-50874247 GAGTGTCTGCGGAGGGCGGGGGG - Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127395432 15:58540903-58540925 CAGAGTCTGAGGTGGGAGGATGG - Intronic
1127762124 15:62149818-62149840 CAGATCTTGAGGAGGCAGGGAGG + Intergenic
1127856535 15:62958190-62958212 CAGTGTTGTAGGAGAGAGTGAGG - Intergenic
1128377992 15:67090905-67090927 AAGTGTTCAAGTAGGGAGGGAGG - Intronic
1129321729 15:74778796-74778818 CAGTGTTGGAGGAGTGGGGGAGG - Intergenic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1132231977 15:100191142-100191164 TGGTGTTTGAGGAGGCAGGAGGG - Intronic
1132587455 16:711789-711811 CAGTGTCTGTGGTTGGAGGGAGG - Intronic
1132664758 16:1076291-1076313 CAGGGTGTGGGGAGAGAGGGAGG - Intergenic
1132888193 16:2191668-2191690 CAGTGTCTGAGCAGAGGGGGAGG - Intronic
1132940601 16:2505802-2505824 GGGTGTTGGAGGAGAGAGGGAGG + Intronic
1132974516 16:2704756-2704778 CACTGCTGCAGGAGGGAGGGTGG - Intronic
1133002000 16:2856488-2856510 CAGAGAGTGAGGATGGAGGGAGG - Intronic
1133031853 16:3014791-3014813 CAGTGTTGGAGGTGGGGGCGGGG + Exonic
1133663272 16:7939885-7939907 CAATTTTTGAGGGGGGAGGAAGG + Intergenic
1133873604 16:9712459-9712481 CAATGTTGGAGAAGGGTGGGAGG - Intergenic
1134143993 16:11745376-11745398 CGGGGTTTGAGGAGGGAATGGGG + Intergenic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1135464149 16:22670781-22670803 CAGTTTTGAATGAGGGAGGGAGG + Intergenic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1135586129 16:23672497-23672519 CTGTGTTTTGGTAGGGAGGGAGG + Exonic
1136561125 16:31039868-31039890 CAGGGTCTGAGGGAGGAGGGAGG - Intronic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1138358309 16:56404014-56404036 CCCTTTTTGAGGGGGGAGGGAGG + Intronic
1138556680 16:57775046-57775068 CAGTGTTTGCTGGGGGTGGGAGG + Intronic
1140012789 16:71153118-71153140 CAGTGTTTGAGGACAAAGGCTGG - Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1140730208 16:77849485-77849507 CAGTGTTTGAGCAAGGGGGATGG + Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1141028329 16:80568429-80568451 GTGTGGTTGAGTAGGGAGGGTGG - Intergenic
1141028433 16:80568735-80568757 GTGTGTTTGAGTGGGGAGGGTGG - Intergenic
1141729232 16:85810619-85810641 CACTGTGGGAGGAGGCAGGGTGG + Intergenic
1142034667 16:87855710-87855732 CAGTGTTGGAGGAGAGGGGTGGG + Intronic
1142077311 16:88127628-88127650 CAGTGCTGGAGGCGGCAGGGAGG + Intergenic
1142174907 16:88640679-88640701 CACTGCTTGAGGAAGGAGGCTGG - Intergenic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1142548926 17:725789-725811 CAGCATTTGAGGAGGCAAGGTGG + Intergenic
1142990294 17:3725643-3725665 CAGGCTTTGAGGAGCAAGGGAGG - Exonic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1145117841 17:20227954-20227976 CAGTGGGTGACGAGGGGGGGTGG + Intronic
1145289328 17:21530735-21530757 CAGCATTTGAGGTGTGAGGGAGG - Exonic
1145325703 17:21822513-21822535 CAGTGTTGGTGCAGTGAGGGAGG - Intergenic
1145837147 17:27963189-27963211 AAATGTTTGCTGAGGGAGGGAGG - Intergenic
1145850860 17:28094638-28094660 TAGTCTTTGAGGTGGGTGGGTGG + Intronic
1146624942 17:34428030-34428052 CCAAGTCTGAGGAGGGAGGGAGG - Intergenic
1146686037 17:34842217-34842239 CAGGGTGTCAGGAGGGAGAGTGG - Intergenic
1146910494 17:36645537-36645559 GAGAGTGGGAGGAGGGAGGGAGG - Intergenic
1147177036 17:38662367-38662389 CAGTGCGTTAGGAGAGAGGGAGG - Intergenic
1147326084 17:39670238-39670260 CAGTGTCTGAGGAGGAGGTGAGG + Exonic
1147585920 17:41654049-41654071 CAGAGTGTGAGGAGGGGGTGAGG + Intergenic
1147614443 17:41819903-41819925 CCAAGTTTGGGGAGGGAGGGTGG + Intronic
1147865766 17:43551161-43551183 AAGAGTTTGAGGTGGGAGGCCGG + Intronic
1148760524 17:49997435-49997457 GAGGGCCTGAGGAGGGAGGGAGG - Intergenic
1148836051 17:50466509-50466531 CAGTGTTTGTGCAGGGATTGTGG - Intronic
1148837196 17:50471639-50471661 CAGTGTTGGAGCAGGAAAGGAGG - Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149456078 17:56789648-56789670 GAGTGTTTGTGGATGGGGGGAGG + Intergenic
1149553416 17:57556509-57556531 CAGTCTTTGGGGTGGGAGGGAGG + Intronic
1149957256 17:61065676-61065698 TATTGTTTGTGGAGGAAGGGTGG + Intronic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150476890 17:65482434-65482456 GAATGTCTGAGGAGGGAGGCTGG + Intergenic
1150813026 17:68371382-68371404 CAGTTTGTGAGGAGGGAGCCAGG + Intronic
1151178442 17:72308327-72308349 TAGCTTTTGAGGAGGGAAGGAGG - Intergenic
1151276543 17:73038762-73038784 GAGGGATGGAGGAGGGAGGGAGG + Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151961342 17:77407576-77407598 CAGCATTTCAGGAGGGAGTGTGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152260634 17:79264953-79264975 CAGTGCGAGAGGAGGGGGGGGGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152643789 17:81459771-81459793 GGGTGTGTGGGGAGGGAGGGTGG + Intronic
1153140168 18:1962319-1962341 CATGGAATGAGGAGGGAGGGGGG + Intergenic
1153230984 18:2935809-2935831 GAGGGGTTGAGGAGAGAGGGAGG + Intronic
1153806988 18:8717508-8717530 GAGGGTTTGAGTAGGGAGTGAGG + Intronic
1154493112 18:14936404-14936426 ATGCGTTTGTGGAGGGAGGGAGG - Intergenic
1155618938 18:27753643-27753665 CAGTGTATGAGAAGAGAAGGAGG - Intergenic
1156385385 18:36599953-36599975 CAGTGTTTGGGGTGGGGGTGGGG + Intronic
1157411297 18:47465540-47465562 CAGTGTTGGAGGAAGGAGCTGGG - Intergenic
1157549393 18:48570798-48570820 CAGACTTTGAGGAGGGTGGAGGG + Intronic
1158435493 18:57432977-57432999 GAGTGAGGGAGGAGGGAGGGAGG + Intergenic
1159994897 18:74955071-74955093 CAGTGTTTGAGGGGAGAGGAAGG + Intronic
1160244814 18:77148832-77148854 CACTCTGTGAGGAGTGAGGGCGG + Intergenic
1160271112 18:77384438-77384460 CAGAGGCTGAGGTGGGAGGGTGG - Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160990004 19:1856650-1856672 CAGTGGTTGAGATGGGAGTGGGG - Intronic
1161083292 19:2322048-2322070 CATGGTTTGTGGAGTGAGGGAGG - Intronic
1161630853 19:5354700-5354722 CAGACTGTGAGGAGGCAGGGTGG + Intergenic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162562790 19:11427106-11427128 CAGTGTGGGAGAAGGAAGGGAGG - Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162855710 19:13466982-13467004 CAGTGTTTTGGGAGGTGGGGAGG - Intronic
1163256499 19:16159133-16159155 CAGCACTTGAGGAGGGTGGGAGG + Intergenic
1163405125 19:17117188-17117210 CAATGTTTGGGGCGGGAGTGTGG + Intronic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165817749 19:38652705-38652727 AAGTGTTGGAGGAAGCAGGGTGG + Intronic
1165943690 19:39428638-39428660 CGGTATTCGAGGAGGCAGGGAGG + Intergenic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166516110 19:43448273-43448295 CTGTTTTTGAGGTGGGAGGCTGG + Intergenic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167195177 19:48023401-48023423 AAGTGAGGGAGGAGGGAGGGAGG + Intronic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167481648 19:49735749-49735771 CAGTGTTGGACCAGGGAGGATGG + Intergenic
1167659110 19:50785642-50785664 CTGTGTTTCAGAAGGGAGTGGGG - Intergenic
1168102497 19:54148534-54148556 CAGTGAGTGAGGAGGCAGCGGGG + Exonic
1168251908 19:55146491-55146513 GAGGGTTTGGGGAGCGAGGGGGG + Intronic
1168266404 19:55226104-55226126 GGGTCTTGGAGGAGGGAGGGCGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925868373 2:8248220-8248242 CAGTGTTTGAGGACAGGGTGAGG - Intergenic
926096637 2:10085364-10085386 CAAGGTTTGAGGGGAGAGGGAGG + Intronic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926846965 2:17152044-17152066 CAGTGATGGAGGAGGGATGGTGG + Intergenic
926929112 2:18018367-18018389 GACTGCTTGAGGAGGGAGGGTGG - Intronic
927054890 2:19358661-19358683 GGGTGGTGGAGGAGGGAGGGTGG - Intergenic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927968363 2:27286890-27286912 AAGTGGTTGAGGAGGCAGGCTGG - Intronic
928225953 2:29448300-29448322 CAGTAATTTAGGAGGGAGGCTGG + Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928294246 2:30069194-30069216 AAGTGTCTGATGAGGGAAGGAGG - Intergenic
929528170 2:42725762-42725784 CAGTGCTGGAGCAGGGAGGTAGG - Intronic
930054918 2:47244428-47244450 CACTGATTGGGGAGGGAAGGGGG + Intergenic
930622519 2:53658874-53658896 GAGGGAGTGAGGAGGGAGGGGGG + Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
931250569 2:60527554-60527576 CTGAGTTTGAGGTGGGATGGAGG - Intronic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
933145802 2:78851229-78851251 GAGTTTTTGAGGAGCCAGGGTGG + Intergenic
933168336 2:79098143-79098165 CAGGGTTTGAAGGGGAAGGGGGG + Intergenic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
934085857 2:88508973-88508995 CAGAATTTGATGAGGGAGGCTGG - Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935179901 2:100679891-100679913 CAGGGTTTGAAGAGGGAGTCAGG + Intergenic
935466604 2:103405799-103405821 CAGAATTTGAGGAAGGATGGAGG + Intergenic
935570150 2:104651223-104651245 CAGGGGTTGCGAAGGGAGGGAGG + Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937038691 2:118803866-118803888 CAGTGTTTGGGCAGGTGGGGCGG - Intergenic
937290754 2:120780402-120780424 CAGTGTGAAAGGAGGAAGGGAGG + Intronic
937389055 2:121466962-121466984 CAGGGTTTGGGGTGGGAGGAGGG - Intronic
937470610 2:122171028-122171050 CTGGCTTTGAGGATGGAGGGAGG + Intergenic
937718598 2:125063939-125063961 GAGTGTTTGTGTGGGGAGGGTGG + Intergenic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
939562359 2:143747537-143747559 GAGGTTTTGGGGAGGGAGGGAGG - Intronic
940518121 2:154707229-154707251 AAGTATTTGAGGTGGGAGGGTGG + Intronic
941707899 2:168679166-168679188 CAGAGATTGGGAAGGGAGGGTGG + Intronic
942343263 2:174972679-174972701 CACTCTATTAGGAGGGAGGGAGG + Intronic
942407018 2:175667027-175667049 CAGTGTAGGAGGAGGTTGGGGGG - Intergenic
942547384 2:177079137-177079159 CAGCATTAGAGGAGGGAGTGAGG - Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944156164 2:196609870-196609892 CTGTGTTTGAGGCAGAAGGGAGG - Intergenic
945152098 2:206802590-206802612 CAGTGTATGGAGAGGAAGGGTGG + Intergenic
945192797 2:207207558-207207580 CAGTGTTGGGGGAGGTAGGTCGG - Intergenic
945469511 2:210211466-210211488 CAGTGTTGGAGGAGGGGGCCTGG + Intronic
945741061 2:213661906-213661928 CAGTCTTTGAGGAGGAAAGATGG - Intronic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
946153637 2:217792778-217792800 CAATGTTTGTAGAGGGAGTGAGG - Intergenic
946177734 2:217931733-217931755 CAGTTTTTGAGGAGGAGGGAAGG + Intronic
946322505 2:218961935-218961957 GGTTGTTTGCGGAGGGAGGGGGG + Exonic
946403214 2:219479742-219479764 CAGAGTCTGAGGGGGAAGGGTGG - Intronic
946483845 2:220081703-220081725 CAGTGAGTGGGGAGGCAGGGCGG + Intergenic
946540201 2:220676020-220676042 CAGTGTTGGAGGTGGGGGGTGGG - Intergenic
947053800 2:226077407-226077429 CAGTGTTTGGGCTGGGAGGTGGG - Intergenic
947832077 2:233148550-233148572 CAGGGTGTCAGGAGGCAGGGGGG + Intronic
948019133 2:234715814-234715836 CAGGGTTTGAGGAGGGATTTGGG + Intergenic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
1168904016 20:1389886-1389908 CAGGCATTGAGGTGGGAGGGAGG - Intronic
1168984818 20:2039057-2039079 GAGTGGTTTAGGAGGGATGGAGG - Intergenic
1169185602 20:3614338-3614360 AAGTGTGTGAGGTGGGAAGGTGG + Intronic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1170407362 20:16052435-16052457 AAGAGTTACAGGAGGGAGGGAGG + Exonic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170792707 20:19521139-19521161 GATTGTGTGGGGAGGGAGGGAGG - Intronic
1171191889 20:23164739-23164761 GAGTGTGGGAGGAGGGAGAGCGG - Intergenic
1171206185 20:23283166-23283188 CAGTGTTGGAGTGGGGTGGGAGG + Intergenic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172646701 20:36474731-36474753 CAGTGTGTGGGAAGGGTGGGGGG + Intronic
1172879130 20:38187031-38187053 GAGGGGTGGAGGAGGGAGGGGGG + Intergenic
1173082303 20:39879919-39879941 CTGTATTGGAGGATGGAGGGTGG - Intergenic
1173370364 20:42429494-42429516 CAGGGGATGAGGAGAGAGGGAGG - Intronic
1173657371 20:44709647-44709669 CAGTGTTTGGTGACTGAGGGAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174419902 20:50392652-50392674 CAGTGCTTTAGGAGGCAAGGTGG + Intergenic
1174846691 20:53949633-53949655 CAATGATGGAGGACGGAGGGGGG - Intronic
1175133777 20:56808257-56808279 GAGTGTCTCAGGTGGGAGGGAGG + Intergenic
1175219484 20:57408825-57408847 CAGTGTTTGGGGAGTTGGGGAGG - Exonic
1175224908 20:57439293-57439315 CAGTGCAGGAGGAGGGGGGGTGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175794990 20:61765811-61765833 GAGGGTTTGAGATGGGAGGGTGG - Intronic
1177829792 21:26125238-26125260 CAGTGTATGAGGAGGATGCGGGG + Intronic
1178372258 21:32036174-32036196 AATTGTTTGGGGAGGGAGGGTGG - Intronic
1178635544 21:34299086-34299108 ATGTGATTGAGGAGAGAGGGAGG - Intergenic
1178981356 21:37267619-37267641 CCGGGTTAGCGGAGGGAGGGAGG + Intronic
1179290465 21:40013776-40013798 CAGGGTTTGAGGAGAGAGCCAGG + Intronic
1179484180 21:41699162-41699184 GAGTTTTGGAGGAGAGAGGGGGG - Intergenic
1179707667 21:43191633-43191655 CAGGGTGTCAGGTGGGAGGGAGG + Intergenic
1180059034 21:45375306-45375328 CAGGATGTGGGGAGGGAGGGAGG + Intergenic
1182067922 22:27443505-27443527 CTCTCCTTGAGGAGGGAGGGTGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183059378 22:35326829-35326851 CAGTCTTCTAGGAGAGAGGGCGG + Intronic
1183085794 22:35486242-35486264 CAGGGTCTGAGGACGGAAGGAGG - Intergenic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183543012 22:38440784-38440806 CAGGGTTTGAGGGTGGAAGGGGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183724009 22:39578493-39578515 CAGGGGAGGAGGAGGGAGGGTGG - Intronic
1183904625 22:41031177-41031199 CAGTGTTGGACCAGGGAGAGTGG - Intergenic
1184384456 22:44166417-44166439 CCGTTTTTGAGGAGTGAGGCAGG + Intronic
1185057099 22:48586836-48586858 CACTGTTGCAGGAGGCAGGGAGG + Intronic
949357290 3:3195166-3195188 CAATGTCTGAGTAGGGTGGGAGG - Intergenic
949566403 3:5249115-5249137 CAGTGCTGGAGGCAGGAGGGAGG + Intergenic
949601686 3:5605897-5605919 CAGGGGTTGAGGTGGGAGGCTGG + Intergenic
950077248 3:10195886-10195908 GGCAGTTTGAGGAGGGAGGGTGG + Intronic
950090471 3:10290989-10291011 CCCTGGTGGAGGAGGGAGGGAGG + Exonic
950550513 3:13663371-13663393 CTGGCTTTGAGGATGGAGGGAGG - Intergenic
950783368 3:15411494-15411516 CAGTCCTTGAGGAGGGATAGAGG + Intronic
950936671 3:16846298-16846320 CAGTGTTGCAGAAGGCAGGGAGG + Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951120229 3:18917973-18917995 CACAATGTGAGGAGGGAGGGAGG + Intergenic
951329250 3:21345565-21345587 CAGTGTTGGAGGAATGAGAGGGG - Intergenic
951655335 3:25001101-25001123 AAATGTGTGAGGATGGAGGGAGG + Intergenic
952538371 3:34338295-34338317 CAGAGGCTGAGGAGGTAGGGTGG + Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
953282079 3:41568858-41568880 GAGTGTTTGAAGTGGGAAGGAGG - Intronic
953673194 3:44979842-44979864 CAGTTTGTGAGAAGGGAGGGTGG + Intronic
954228774 3:49200050-49200072 TAGTGTTTGAGGCGGGCCGGTGG + Intronic
956057836 3:65319301-65319323 CAGGGTTTGAGGAGGAATTGGGG + Intergenic
956345784 3:68276790-68276812 AATAGTTTGTGGAGGGAGGGAGG + Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958579853 3:96004297-96004319 CAGTGACTGAGGAGGTATGGTGG + Intergenic
958712711 3:97737502-97737524 CACTGTTTGAATATGGAGGGAGG + Intronic
958774137 3:98461056-98461078 CAGGGTTTGAAGATGGAAGGGGG + Intergenic
959022888 3:101208082-101208104 CACTATTTGAGGAAAGAGGGTGG - Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
960340268 3:116466516-116466538 GACTGTTTGAGGGGGTAGGGTGG - Intronic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
960973118 3:123153254-123153276 CAGGTTTTGAGGAAGGGGGGTGG + Intronic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
963254436 3:143130798-143130820 GAGGGATTGGGGAGGGAGGGAGG - Intergenic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964131414 3:153291931-153291953 GAGTGTTTGAGGAGTTATGGGGG - Intergenic
964172160 3:153783623-153783645 CAGTATTAGAGGAGGCAGGGAGG + Intergenic
964290983 3:155179679-155179701 CAGTGTTTGAGGGGAGAGATGGG - Intronic
964838241 3:160964625-160964647 CAGTGTTTGGGAAGGCAGAGGGG + Intronic
965912319 3:173794092-173794114 CTGGGTATGAGGAGGTAGGGTGG - Intronic
966905459 3:184521165-184521187 CAGAGGCTGAGGTGGGAGGGTGG - Intronic
966989692 3:185217125-185217147 CAGTGTTTGAGGTGGGAGCCTGG + Intronic
967137617 3:186525761-186525783 CAGTGTTTGGGGGGCAAGGGTGG + Intergenic
967407735 3:189136262-189136284 CATTGTTTCAGAAGGGAAGGTGG + Intronic
968066368 3:195761787-195761809 CAGCGGTGGAGGAGGGCGGGAGG + Intronic
968110890 3:196045616-196045638 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968511272 4:996973-996995 CAGGGGTTCAGGCGGGAGGGGGG - Intronic
968515053 4:1012243-1012265 CGGTGTTTGGAGAGGGGGGGCGG + Intronic
969431511 4:7157589-7157611 CAGTGATGGTGGAGGCAGGGAGG - Intergenic
969467520 4:7366476-7366498 GAGTGTTGGGGGAGAGAGGGGGG - Intronic
969491108 4:7499725-7499747 CAGCGTTTGAGGAGCGAGGAAGG - Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969939848 4:10721149-10721171 CAGGGACTGAGGAGGGAGGTGGG + Intergenic
971418818 4:26457143-26457165 CAGTCTTTGTGGATGAAGGGTGG - Intergenic
971466410 4:26967818-26967840 CACTGTTGGAGGAGGGGGGAGGG - Intronic
971734035 4:30423064-30423086 AAGTATTTGAGGATGGAGAGTGG - Intergenic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973333582 4:48933998-48934020 CCGTGTTGGAGGAGAGAGGGAGG - Intergenic
973724847 4:53764689-53764711 CAGAGTTTGGGCAGGGATGGAGG - Intronic
974278986 4:59765480-59765502 AAGAGTTTGAGGAGGGAAGGTGG - Intergenic
974445631 4:61977405-61977427 TAGTGTTTGAGAGTGGAGGGTGG - Intronic
974912599 4:68141297-68141319 CAGTGATTTAGGAGGAAGAGTGG - Intergenic
974958612 4:68673228-68673250 GAGGGTTTGAAGAGGGAAGGGGG - Intergenic
976050273 4:81003837-81003859 GGGTGATGGAGGAGGGAGGGAGG + Intergenic
976230106 4:82833756-82833778 CATTAATTGATGAGGGAGGGAGG + Intronic
977624980 4:99180224-99180246 AAGTGTTTGTGCAGGGAGTGAGG + Intergenic
977691017 4:99911027-99911049 CAGGGGTTGGGAAGGGAGGGAGG - Intronic
978464375 4:108993175-108993197 CAGGGTTTGGGGTGGGAGTGTGG - Intronic
979267204 4:118717451-118717473 GACTATTTGAGGTGGGAGGGAGG - Intergenic
980153964 4:129081669-129081691 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
981511029 4:145558586-145558608 GAGTATTTGAGGTGGGTGGGGGG + Intergenic
981688746 4:147482699-147482721 CATTGTTGGAGGAGGAAGGAAGG + Intronic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982446483 4:155496393-155496415 GATTGTTCGAGGAGGGAGGAGGG + Intergenic
982637631 4:157916857-157916879 ATGTGTGTGAGGAGGGAGAGTGG + Intergenic
984779061 4:183506779-183506801 CCGTGTTTGGGGAGGGGGTGGGG + Intronic
984895093 4:184531837-184531859 CAGAGGTTGAGGTGGTAGGGTGG + Intergenic
985161227 4:187047010-187047032 GGGTTTTTGGGGAGGGAGGGAGG + Intergenic
985811498 5:2093235-2093257 CAGTGATTGCCTAGGGAGGGTGG + Intergenic
986041042 5:3994239-3994261 CTGTGCTTCAGGAGGGAGAGTGG + Intergenic
986633761 5:9800413-9800435 CAGCCTTTGTGGTGGGAGGGAGG + Intergenic
988966721 5:36426054-36426076 GAGTTTTGGAGGAGGGAGAGGGG - Intergenic
989240222 5:39194891-39194913 CAGGGATTAAGGAGGGTGGGTGG + Intronic
989642347 5:43595230-43595252 CAGAGTTTGAGGAGGGGGTGAGG - Intergenic
990365601 5:55067083-55067105 CAGTGATGGAGGAGGAAGTGAGG - Intergenic
990522787 5:56595775-56595797 CAGTGGTTGAAGAGTGAAGGAGG - Intronic
991109600 5:62883453-62883475 CATTTTTTGAGGTGGGGGGGAGG + Intergenic
991306137 5:65177979-65178001 TAGTGTTGGAAGAGGGAGGCTGG - Intronic
991959334 5:72028395-72028417 CAGAGTCTGAGGTGGGAGGGAGG - Intergenic
992705967 5:79392916-79392938 CACTGTCTTACGAGGGAGGGAGG + Intronic
992760567 5:79947849-79947871 CAGTAGTTTAGGAGGGAGGGGGG + Intergenic
993851563 5:93016421-93016443 CAGTATGTGTGGAGGGAGTGAGG + Intergenic
994303400 5:98173809-98173831 GAGTGTGTGAGGAAGGAAGGAGG - Intergenic
995546425 5:113236773-113236795 ATCAGTTTGAGGAGGGAGGGAGG - Intronic
995964267 5:117885191-117885213 CAGGTTTTCAGGGGGGAGGGAGG - Intergenic
997230445 5:132238637-132238659 CACTGGCTGAGGAGGCAGGGAGG + Intronic
997310686 5:132878464-132878486 CACCTATTGAGGAGGGAGGGGGG + Exonic
997711063 5:136005366-136005388 CACTATTTGAGGAGGGGTGGAGG - Intergenic
998329273 5:141309544-141309566 TAGTGTCTGAGGTGGGAGTGGGG - Intergenic
998351449 5:141504647-141504669 GAGTGTTTGAGGGCGGGGGGTGG + Intronic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
998959153 5:147466433-147466455 CAGTGCTGGTGGAGTGAGGGTGG - Intronic
999916254 5:156265264-156265286 TAGTCTTTGGGGAGGGAGGTAGG + Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000601536 5:163281282-163281304 CAATGTTGGAGGTGGGAGGTGGG + Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001319138 5:170666019-170666041 CAGTGTGTAAGAGGGGAGGGAGG - Intronic
1001854119 5:174995866-174995888 CACTGTCACAGGAGGGAGGGAGG + Intergenic
1002565848 5:180112823-180112845 CAGTGACTGAGGATGGATGGAGG + Intronic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1002859876 6:1071209-1071231 CAGAGATTGAGGTGGGAGGATGG - Intergenic
1002985028 6:2181290-2181312 CACTTTTTGAGGAGAGAGGTAGG - Intronic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003147816 6:3523541-3523563 CAGAGTCTGAGGAGGAAGGGAGG - Intergenic
1003496017 6:6663864-6663886 GAGCGCTGGAGGAGGGAGGGCGG - Intergenic
1003509477 6:6767612-6767634 CAATGTTGGAGGTGGGTGGGAGG - Intergenic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1003617801 6:7671019-7671041 AAGAGATGGAGGAGGGAGGGAGG - Intergenic
1003814400 6:9821742-9821764 CAGTACTTGAGGGTGGAGGGTGG - Intronic
1004069293 6:12283292-12283314 TAGAGTTTGAGGGGGGAGTGTGG + Intergenic
1004180395 6:13376180-13376202 CAGAGTCTAAGGAGGCAGGGAGG + Intronic
1004227745 6:13802452-13802474 CAGTGTGGTAGGAGGCAGGGAGG + Intronic
1004734710 6:18393787-18393809 AAGTTTTTGAGAAGGGTGGGTGG - Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005852493 6:29832011-29832033 TGGTGTGGGAGGAGGGAGGGAGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006187381 6:32189150-32189172 CAGAGTTTGAGGTGGCAGAGTGG + Intronic
1006238197 6:32654197-32654219 CAGAGATTGAGGTGGGAGGATGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1006856400 6:37136492-37136514 TAGTGTTTGGAAAGGGAGGGAGG + Intergenic
1007908104 6:45484362-45484384 GATGGTTTGAGGAGGAAGGGAGG + Intronic
1008352247 6:50505716-50505738 CAGTGACTGAGAAGGGAGGGTGG + Intergenic
1008513114 6:52295806-52295828 CAGTGTTGGAGGTTGGAGGTGGG + Intergenic
1008773138 6:55003696-55003718 CATTATTGGAGTAGGGAGGGGGG + Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1011964488 6:93136942-93136964 CAGTGTTTCAGAAGGAAGAGTGG + Intergenic
1013796919 6:113898557-113898579 CAGAGTTGGAGGATGGATGGGGG + Intergenic
1014382157 6:120755523-120755545 GACTGCTAGAGGAGGGAGGGAGG - Intergenic
1014501458 6:122195209-122195231 CAGAGTTTCCGGAGGGAGTGTGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015004258 6:128259084-128259106 CCATGTTTGAGGAGGGAGACAGG + Intronic
1015439175 6:133228017-133228039 CAGTGCTTCTTGAGGGAGGGAGG - Intergenic
1016252029 6:142055011-142055033 CAGGGTGTGATGGGGGAGGGGGG + Intergenic
1016301187 6:142633548-142633570 CAGTGTTTGGGGAGGCTGAGGGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1017739848 6:157397471-157397493 CTGGCTTTGAGGATGGAGGGAGG - Intronic
1017935921 6:159005004-159005026 AAGTGATTCAGGAGAGAGGGTGG + Intergenic
1018265918 6:162024174-162024196 AAGGGTTGGGGGAGGGAGGGAGG - Intronic
1018639054 6:165890061-165890083 GAGTGAGTGAGGAGTGAGGGAGG - Intronic
1018733207 6:166668827-166668849 GAGGGATGGAGGAGGGAGGGAGG - Intronic
1018844673 6:167547371-167547393 GACTGATTGAGGAGGGAGGAGGG - Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019522797 7:1468247-1468269 CAGGGTCTGATCAGGGAGGGAGG - Intergenic
1019711740 7:2521111-2521133 CGGGGTTTGAGCAGGGAGGAAGG - Intronic
1020255930 7:6503224-6503246 CAGGCTTTGGGGTGGGAGGGGGG + Intronic
1020790857 7:12626839-12626861 CAGTGTATGTAGGGGGAGGGTGG + Intronic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021164924 7:17325800-17325822 CAGGGTGGGAGGAGGGAGAGAGG + Intronic
1021201107 7:17729454-17729476 CAGTGTTTTGGCAGGGGGGGTGG - Intergenic
1021525339 7:21580135-21580157 GAGTGAGTGAGAAGGGAGGGAGG + Intronic
1021738956 7:23666095-23666117 CAGGGTTTGGGGAGAGTGGGTGG + Intergenic
1022389812 7:29933715-29933737 CATAGTAGGAGGAGGGAGGGAGG + Intronic
1022832957 7:34086659-34086681 CAGGGCTTGAGGATGGAGGGAGG + Intronic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023195029 7:37627247-37627269 CAGTGGTTAAGGAGGGAGTGAGG - Intergenic
1024362961 7:48487786-48487808 CTGTGTGTGAGGGGGCAGGGTGG + Intronic
1024923199 7:54582892-54582914 CAGAGTTTGAGAAGGGTGTGTGG + Intergenic
1024966020 7:55022409-55022431 CCTCCTTTGAGGAGGGAGGGTGG - Intronic
1025292560 7:57743603-57743625 CATTGTTTGAGGATGCAGTGAGG + Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1028407247 7:90489155-90489177 CAGTGTTAGAGGTGGGGTGGGGG - Intronic
1028897716 7:96060994-96061016 CAGTGTTTGAGAGGGGATTGTGG + Intronic
1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG + Intergenic
1029634164 7:101772846-101772868 GAGTATTTAAGGAGGGAGGGAGG + Intergenic
1030034953 7:105401049-105401071 CAGTGACTGAGGAGAGAGGAGGG - Intergenic
1030038977 7:105433050-105433072 CAGAGTTTGAGATGGGAGGATGG - Intergenic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1031160531 7:118162059-118162081 CAGTCTTAGAGGAAAGAGGGAGG + Intergenic
1031929165 7:127666788-127666810 CTGTGTTTGATGACAGAGGGCGG + Intronic
1031972496 7:128074724-128074746 TAGTGTGTGAGGAGGACGGGAGG - Intronic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032789503 7:135232112-135232134 CAGTGGTTGGGGCGGGAGGTGGG + Intronic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1034313956 7:150112634-150112656 CCTTGATGGAGGAGGGAGGGAGG - Intergenic
1034686132 7:152972920-152972942 GAGTGCTTGTGGAGGGAGGTAGG + Intergenic
1034954742 7:155327566-155327588 CAGGGTTGGGGGAGAGAGGGGGG - Intergenic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1035197255 7:157231909-157231931 CACTCTTTGGGGGGGGAGGGAGG + Intronic
1035304671 7:157924113-157924135 GAGTGTTTCAGAAGGCAGGGTGG + Intronic
1035405439 7:158594094-158594116 CAGTGTTGGTGGTGGGATGGTGG + Intergenic
1036809580 8:11858198-11858220 AAGTGTTAGAGGAGAGAGGGAGG - Intronic
1037227415 8:16609824-16609846 CAGTGTTGTAGGAAGGAGTGAGG + Intergenic
1038240525 8:25803674-25803696 CAGTGGGTGAGCAGGTAGGGAGG + Intergenic
1038268249 8:26052237-26052259 CAGTGGTGGCGGGGGGAGGGGGG + Intergenic
1038342124 8:26695265-26695287 CATTGATTGAGGAGGGAGGAAGG - Intergenic
1038438787 8:27557467-27557489 CAGGGTTTGAGAAGGAAGTGGGG + Intergenic
1039084706 8:33768330-33768352 CAGAGGTTGAGGGGGAAGGGGGG + Intergenic
1039206160 8:35157913-35157935 GACTGCTTGAGGTGGGAGGGTGG + Intergenic
1039666652 8:39540673-39540695 AAATGCTTGAGGAGGAAGGGTGG - Intergenic
1039817381 8:41106572-41106594 CAGTATTTTAGGAGGGTGAGTGG + Intergenic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041392395 8:57358654-57358676 CAGTGTTGGAGGAGGGGGCGTGG + Intergenic
1041653235 8:60322044-60322066 CTGTATTTGAGGAGTCAGGGTGG + Intergenic
1043165050 8:76893201-76893223 CAGTGTTTGAGCAGTGAAAGAGG - Intergenic
1043206585 8:77451303-77451325 CAGTGTTTGGGAAGAGAGAGAGG - Intergenic
1044631891 8:94288190-94288212 CAATGTATGAAGAGGGAGAGGGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046778528 8:118190195-118190217 CAGAGTATGAGAAGGGAGGATGG - Intronic
1046946250 8:119976845-119976867 CAGGGTGTGCGGGGGGAGGGTGG - Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047788963 8:128182798-128182820 CTGTGTTTCAGCAGAGAGGGAGG + Intergenic
1048023712 8:130564706-130564728 CAGCTTTTCCGGAGGGAGGGAGG - Intergenic
1048136023 8:131747127-131747149 GACTGCTTGAGCAGGGAGGGTGG + Intergenic
1048823640 8:138402021-138402043 GTGTGTGTGAGGAGGGTGGGAGG + Intronic
1048960972 8:139576819-139576841 CGGTGTTCGGGGAGGCAGGGAGG - Intergenic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049171757 8:141165882-141165904 CAGGCTTTGAGGATGGGGGGAGG - Intronic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049794148 8:144488871-144488893 GAGGGTTTCAGGATGGAGGGTGG + Intronic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1051582600 9:18694180-18694202 CAGTGTTGGAGGAGGGGGCTGGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051943449 9:22536705-22536727 CATTGTGTGAGAAGGGAGAGAGG + Intergenic
1052413844 9:28152218-28152240 CAGGGTTTGGGGAGGCAGTGAGG + Intronic
1052436749 9:28439486-28439508 CAGTGTTGGAGGAGGGGGCTTGG + Intronic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1054877200 9:70109240-70109262 CAGTGGTTGAGGATGGAGCATGG + Intronic
1056160295 9:83884157-83884179 CTGTGTTTGATGGGGGTGGGTGG - Intronic
1056359930 9:85845681-85845703 CTGTGTTTGATGGGGGTGGGTGG + Intergenic
1057171574 9:92966175-92966197 CATTGTCTGAGGAGGGAGACAGG + Intronic
1057598727 9:96438722-96438744 CAGGGGTTGATGGGGGAGGGTGG + Intergenic
1058040431 9:100296016-100296038 CAGCCTTTGGGGAAGGAGGGAGG + Intronic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1059398957 9:114056842-114056864 CAGTGTTTGATAAATGAGGGAGG + Intergenic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060484447 9:124038237-124038259 AAGTGTTTGAGTAGGGGGGAGGG + Intergenic
1060506612 9:124202648-124202670 CAGTGTGTGAGGGTGGAGAGGGG - Intergenic
1060987679 9:127828987-127829009 CAGGGCTGGAGGAGGCAGGGTGG - Intronic
1060993564 9:127862492-127862514 CAGTCTTTGCGGGGGGTGGGGGG + Intergenic
1061502571 9:131012506-131012528 ATGTCTTTGAGGAGGCAGGGCGG - Intronic
1061599974 9:131662134-131662156 CAGTGTGTGAGCAGGCCGGGTGG - Intronic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1061987813 9:134140316-134140338 CAGTGTTCGGGGTCGGAGGGTGG + Intronic
1062640448 9:137515805-137515827 GAGGGATTGAGGGGGGAGGGGGG - Intronic
1203772754 EBV:57922-57944 CAGTGGTGGAGGACAGAGGGAGG + Intergenic
1185499476 X:585715-585737 CAGGGATGGAGGAGGGAGGTGGG - Intergenic
1185565249 X:1090316-1090338 CAGGGATTAAGGAGGGAGTGGGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186137026 X:6532793-6532815 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137047 X:6532852-6532874 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137070 X:6532915-6532937 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137089 X:6532974-6532996 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137120 X:6533066-6533088 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137143 X:6533129-6533151 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137154 X:6533159-6533181 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137178 X:6533225-6533247 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137189 X:6533255-6533277 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137230 X:6533376-6533398 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137254 X:6533442-6533464 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267175 X:7844263-7844285 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267220 X:7844388-7844410 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267243 X:7844451-7844473 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267256 X:7844484-7844506 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297728 X:8169142-8169164 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297740 X:8169175-8169197 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324870 X:8466597-8466619 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324880 X:8466626-8466648 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324913 X:8466718-8466740 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324923 X:8466747-8466769 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324933 X:8466776-8466798 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324943 X:8466805-8466827 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324965 X:8466867-8466889 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324976 X:8466897-8466919 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324987 X:8466927-8466949 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325034 X:8467055-8467077 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325046 X:8467088-8467110 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325085 X:8467205-8467227 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325115 X:8467292-8467314 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325131 X:8467329-8467351 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186364216 X:8874515-8874537 CAGTGTTTGAGTAGGTGGAGGGG + Intergenic
1186680477 X:11868356-11868378 CAGGGGTTGAGGATGGAGGCTGG + Intergenic
1188956063 X:36436119-36436141 AAGTGTTTGTGCAGGGAGTGGGG - Intergenic
1189261033 X:39678997-39679019 CAGTGTATGGGGCGGGTGGGGGG - Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1189727568 X:43983562-43983584 CACTGTTAGATGGGGGAGGGAGG + Intergenic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190786842 X:53659518-53659540 CAGTGGTTGAGGAGGGTTAGTGG + Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193272087 X:79541067-79541089 GACTGCTAGAGGAGGGAGGGAGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194087165 X:89542551-89542573 CAGGGTTTTAGGGGGGAGGAGGG + Intergenic
1195597167 X:106705081-106705103 CAATGTTTGGGCAGGGAGGTAGG + Intronic
1195910052 X:109880379-109880401 TAGAGTGTGAGGTGGGAGGGAGG - Intergenic
1196198623 X:112860823-112860845 GTGTGTTTGCGGGGGGAGGGGGG + Intergenic
1196220212 X:113105039-113105061 CAGTGTTTGAGGTGGGGCTGAGG + Intergenic
1197230836 X:124002110-124002132 CAGTTACTGAGGAGGGAGGATGG + Intronic
1197457936 X:126701311-126701333 CACTGTTTGAGGTTGGAGGCAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197826642 X:130597242-130597264 CATTCATTGAGTAGGGAGGGAGG + Intergenic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199229781 X:145423452-145423474 AAGTGTTTGTGCAGGGAGTGAGG - Intergenic
1199544713 X:148995773-148995795 CAGACTTTGAGGAGGGAAGGGGG + Exonic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1199932129 X:152533998-152534020 GACTGCTTGAGGAGGGATGGTGG - Intergenic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1200128208 X:153828114-153828136 CCGTGTTTAAGGAGGCCGGGAGG + Intronic
1200439813 Y:3198424-3198446 CAGGGTTTTAGGGGGGAGGAGGG + Intergenic
1201438516 Y:13985245-13985267 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438532 Y:13985300-13985322 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438667 Y:13985696-13985718 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445906 Y:14057012-14057034 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201446041 Y:14057408-14057430 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446057 Y:14057463-14057485 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202097061 Y:21262996-21263018 CAGTGTTGTGGGAGGCAGGGAGG + Intergenic