ID: 1151366955

View in Genome Browser
Species Human (GRCh38)
Location 17:73623726-73623748
Sequence GTGAAGAAGCAGAGAGAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 2, 2: 5, 3: 63, 4: 549}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151366955_1151366960 -4 Left 1151366955 17:73623726-73623748 CCCGACTCTCTCTGCTTCTTCAC 0: 1
1: 2
2: 5
3: 63
4: 549
Right 1151366960 17:73623745-73623767 TCACGCCTGTGGGCCCAGGCTGG 0: 1
1: 0
2: 0
3: 40
4: 333
1151366955_1151366964 17 Left 1151366955 17:73623726-73623748 CCCGACTCTCTCTGCTTCTTCAC 0: 1
1: 2
2: 5
3: 63
4: 549
Right 1151366964 17:73623766-73623788 GGACTGCTCTGCCCGTTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 119
1151366955_1151366959 -8 Left 1151366955 17:73623726-73623748 CCCGACTCTCTCTGCTTCTTCAC 0: 1
1: 2
2: 5
3: 63
4: 549
Right 1151366959 17:73623741-73623763 TTCTTCACGCCTGTGGGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151366955 Original CRISPR GTGAAGAAGCAGAGAGAGTC GGG (reversed) Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901603473 1:10440864-10440886 GTGAAGACCCAGAGATACTCTGG + Intronic
901617474 1:10553249-10553271 GTGAAGAAGAGGGAAGAGTCTGG + Intronic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901861168 1:12075492-12075514 GGGAGGCAGAAGAGAGAGTCAGG - Intronic
902051688 1:13568147-13568169 GGAAAGAAGCAGAGAGAGAGGGG + Intergenic
902541523 1:17158969-17158991 GGGAAGCAGCAGAGAGAGCCAGG - Intergenic
903269109 1:22176767-22176789 GTTAGGGAGCAGAGAGAGGCTGG + Intergenic
904997733 1:34644015-34644037 GGGAAGGAGCAGAGAGAGAGAGG + Intergenic
905295483 1:36951825-36951847 GGGAAGAAGCAGAGAGAAGGAGG + Intronic
905874933 1:41426599-41426621 GGGAAGAATCAGAAAGGGTCTGG + Intergenic
907628919 1:56060542-56060564 GTGAAGAAACTGAGAGCTTCAGG + Intergenic
907888011 1:58611757-58611779 GTGAGGAAGCAGGTAGAGACTGG - Intergenic
908033519 1:60027408-60027430 GTCAGGAGGCAGAGAGAGTGAGG - Intronic
908955319 1:69618433-69618455 GTGATTAAGCAGAGAGACACTGG - Intronic
909106214 1:71412176-71412198 GTGAAGAAGCGGTGTGAGTCTGG - Intronic
909348829 1:74624692-74624714 GTTAGGAAGCAGAGGGAGTGGGG - Intronic
910240882 1:85085073-85085095 GTAAAGAAGCAGGCAGAGACTGG + Intronic
910629282 1:89339663-89339685 GAGAAGCAGCAGAGAGATTTGGG + Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
911230399 1:95354809-95354831 GGGAAGAAGCACATAGAATCAGG + Intergenic
911824556 1:102465057-102465079 GTGAAGAAAAAGGGAGAGACGGG - Intergenic
912492563 1:110070283-110070305 AGGAAGAAGAAGAGAGGGTCGGG + Intronic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913588738 1:120302342-120302364 GTGAAGTAGGAGAAAAAGTCTGG + Intergenic
913619447 1:120596027-120596049 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
914457609 1:147850742-147850764 GTGAAGACACAGAGAGAGACAGG + Intergenic
914570761 1:148914213-148914235 GTGAAGTAGGAGAAAAAGTCTGG + Intronic
914602069 1:149216050-149216072 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915161253 1:153922498-153922520 GTGAAGAAGGAGCGCGAGGCGGG + Intronic
915191841 1:154157462-154157484 GGGAAGAGGCAGAGACAGTTTGG + Intronic
915567901 1:156726733-156726755 TGGAAGAAGCAGTGAAAGTCAGG - Intronic
915896445 1:159814877-159814899 GTGAATAAGTACATAGAGTCAGG - Intronic
916192902 1:162196562-162196584 GTGAAGTAGCAGGGTGAGGCTGG + Intronic
916384710 1:164254618-164254640 GTGGAGCAGGAGAGAGAGTTGGG - Intergenic
916678247 1:167082359-167082381 GTGAAAAAGTAGAGACAGTGAGG + Intronic
916889239 1:169100570-169100592 CTGAAGAAGCAGAGAAAGTCAGG + Intergenic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918132538 1:181642404-181642426 GTGGAGAATCAGAGAGGGACTGG + Intronic
918343992 1:183590563-183590585 GGAAAGAAGCAGAGAGAGAGAGG + Exonic
918590607 1:186237016-186237038 GCGAAGAAGCAGAGTGTGTGAGG + Intergenic
919230583 1:194768098-194768120 GTGAAGAAACAGTCAGAATCTGG - Intergenic
919575805 1:199308075-199308097 GTCAAGAAGAAAAGAGAGTGAGG - Intergenic
919893660 1:201994474-201994496 GTGAGGAAGCACCGAGAGTCTGG - Intronic
920759052 1:208763927-208763949 GTGAGGCAGCAGAGAGAGGGAGG - Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922625705 1:227039565-227039587 GTGATGAAGGAGAGAGGGTCAGG - Intronic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
923226550 1:231943315-231943337 GTGAGGAGGTAGAGAGAGTGAGG + Intronic
924447147 1:244143977-244143999 GTCAGGAGGCAGAGAGAGTGAGG + Intergenic
1063601155 10:7482670-7482692 GAGAAGAAGCAGCCTGAGTCTGG - Intergenic
1063690387 10:8281708-8281730 GGGGAGAATCAGAGAGAATCAGG + Intergenic
1064394119 10:14967032-14967054 GTTAATAAGATGAGAGAGTCTGG - Intronic
1065130174 10:22612614-22612636 CGAAAGAAGCAGAGAGACTCCGG + Intronic
1067350962 10:45475060-45475082 GTGAAGAAGCAGGGACTGTTGGG - Intronic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1067791121 10:49288519-49288541 TTCAAGAAGCAGAGCTAGTCTGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068381331 10:56257057-56257079 GTGAGGAAGCACAGGGAGTAAGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068695662 10:59965717-59965739 GTGAGGAAATAGGGAGAGTCTGG - Intergenic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1069994997 10:72336514-72336536 GAGAAGCAGCAGAGTGAGTGTGG - Exonic
1070272404 10:74969012-74969034 GTTAAGAAGCTGAGAGATCCAGG - Intronic
1071089382 10:81901043-81901065 GTGGAAAAGGAGAGAGAGTAGGG - Intronic
1071132577 10:82411999-82412021 GTCAAGAAGAAGAATGAGTCTGG + Intronic
1071286425 10:84151181-84151203 GTGAAGATGGAGACAGAGACTGG - Intronic
1072305988 10:94107815-94107837 GATAAGAAGTAGAGAGATTCTGG - Intronic
1072379503 10:94852911-94852933 CTGAAGAAGCACAGATGGTCTGG + Exonic
1072464602 10:95651627-95651649 GGGAACAAGAAGAGAGAGTGAGG + Intronic
1072540241 10:96392986-96393008 GTGATGCAGCAGAGAGAATGTGG + Intronic
1072627243 10:97120530-97120552 GTGAAGCAGCATTGCGAGTCAGG - Intronic
1073523562 10:104157507-104157529 GGGAAGAGGCAGAGATAGTTTGG + Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1074844899 10:117389101-117389123 GAGAAGAGGCAGAGAGTTTCAGG - Intergenic
1075697251 10:124446303-124446325 GTGAACAAGCAGAGATTGTAAGG - Intergenic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1077729363 11:4713173-4713195 GTGAAGCAGCTGAGGAAGTCAGG - Intronic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1077981746 11:7308119-7308141 GTGATGAAGAAGAGAGAGTTAGG - Intronic
1078103759 11:8345635-8345657 GGGGACAGGCAGAGAGAGTCAGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078885266 11:15493703-15493725 GCCAAGGAGCAGTGAGAGTCAGG - Intergenic
1078912884 11:15749801-15749823 GTCAAGAGGCAGTGGGAGTCGGG + Intergenic
1079117748 11:17651389-17651411 GTGAGGAAGCGGAGAGAGTGAGG + Intergenic
1079403527 11:20125818-20125840 GTAGAGAAGCAGAGAGACACAGG - Intergenic
1080285521 11:30606781-30606803 GTGATGAGGTAGAGAGAGACCGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081004440 11:37717405-37717427 TTGAAGAGACAGAGAGAGTGGGG + Intergenic
1083032884 11:59610380-59610402 GTGAAGATGCTGGCAGAGTCAGG - Exonic
1084764291 11:71298098-71298120 GAGAGGAAGCAGAGGCAGTCAGG - Intergenic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085461899 11:76699080-76699102 GTGAGGAAGAAGAGAGAGAAGGG - Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1086331375 11:85757624-85757646 GGGCCGAAGAAGAGAGAGTCAGG - Exonic
1086572537 11:88302056-88302078 TTGAAGGAGCAGAGAGAGAGAGG - Intronic
1087163339 11:94973205-94973227 GTGAAGAGGCAGCGAGTTTCTGG - Intronic
1087773350 11:102235179-102235201 TTACAGAAGCAGGGAGAGTCTGG - Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1088649227 11:111942642-111942664 GTGAAGGAGCAGAGAGTGTTTGG + Intronic
1088757962 11:112902497-112902519 GTGGGGAAGGAGAGAGGGTCAGG - Intergenic
1088827702 11:113509682-113509704 GGGAAGTAACAGAGAAAGTCAGG - Intergenic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089597043 11:119586935-119586957 GTGAAGAAGCAGAGAGCATGAGG - Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1091110524 11:132962308-132962330 GTGAGCAGGCAGAGAGAGCCCGG - Intronic
1091163584 11:133449642-133449664 GTGAAGATGAAGATAGAGACTGG - Intronic
1091418985 12:318217-318239 ATGAAGAAGCTGATAGACTCTGG - Exonic
1091443378 12:528645-528667 CTGAAGTGGCACAGAGAGTCAGG - Intronic
1091780694 12:3212951-3212973 GTGGACAAGCAGAGGGAGTGGGG + Intronic
1091920307 12:4299034-4299056 GTAAAGAAGCAGAAAAAGTTGGG + Intronic
1091947542 12:4561916-4561938 TTGAAGAAGGGGAGAGAGTAGGG + Intergenic
1092531410 12:9348674-9348696 GTGAAGGAGCAGAGAGAGTCAGG - Intergenic
1092647423 12:10591341-10591363 ATTATGCAGCAGAGAGAGTCAGG + Intergenic
1092818925 12:12335212-12335234 GTGAAGAAACAGGGAGTGGCGGG - Intronic
1092943878 12:13435613-13435635 GGGGAGGGGCAGAGAGAGTCTGG - Intergenic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093920670 12:24856147-24856169 GTCAAGAAGCAAACAGAATCAGG - Intronic
1094423768 12:30298414-30298436 TTGAAGCAGTAGAGAGACTCAGG - Intergenic
1095219200 12:39588453-39588475 GTGAAGAAGGAGACAGAGATGGG + Intronic
1095304496 12:40623899-40623921 GTGGTGGAGCAGAGAGAGTAAGG + Intergenic
1095715486 12:45341755-45341777 GTGTAGAGGCAGAGTGAGTGGGG + Intronic
1096091880 12:48907569-48907591 GTGAAGAAGTAGAGATAGTGAGG - Intronic
1097320663 12:58222522-58222544 AGGTTGAAGCAGAGAGAGTCTGG - Intergenic
1097806997 12:63976431-63976453 GTCAAGATGCAGTGAGAGTCTGG - Intronic
1098302176 12:69065890-69065912 GTAAATAAACAGAGAGAGCCTGG - Intergenic
1101438293 12:104682927-104682949 GAGAAGAAGGACAGAGAGTCAGG - Intronic
1101623473 12:106415003-106415025 GTGAAGGAACAGAAAGAGTCTGG - Intronic
1101674088 12:106901986-106902008 GTGAAGAAGCAAAGAGGTTAAGG - Intergenic
1101745732 12:107540040-107540062 GTGAAGATGCAGAGAGATGTAGG + Intronic
1101834941 12:108288555-108288577 GAGAAGAGGCACAGAGATTCTGG - Exonic
1102290364 12:111694243-111694265 GTGAAGGAACAGAGAGGCTCAGG - Intronic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1103060689 12:117856027-117856049 GAGAGGAAGCAGAGAGAGAGTGG - Intronic
1104039862 12:125122708-125122730 GGGCAGAAGCTGAGAGACTCAGG + Intronic
1104400634 12:128473095-128473117 GTGAAGATGAAGACAGAGTCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1105287220 13:19014227-19014249 GTGAGGATGGAGAGAGAGGCAGG - Intergenic
1106097612 13:26662014-26662036 GTGCAGAAGCACAGAGTGTGAGG + Intronic
1106618586 13:31352854-31352876 GGAAAAAAGCAGCGAGAGTCTGG - Intergenic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1106864645 13:33950019-33950041 GAGAGAAAGCAGAGAGAGACAGG - Intronic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107977321 13:45702943-45702965 TAGAATAAGCAGAGATAGTCAGG + Intronic
1108677001 13:52745718-52745740 CTTGAGAAGGAGAGAGAGTCAGG + Intergenic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1109225472 13:59689307-59689329 GTGAAGAAGGAGACAGGGTGTGG - Intronic
1109233095 13:59782943-59782965 GTGAAGGTGAAGAGAGAGCCGGG + Intronic
1112716914 13:102197450-102197472 GTAAAGAAACTGAGAGAGTCAGG - Intronic
1113135186 13:107080952-107080974 GTGAGGAACCAGAGAGAGAGAGG - Intergenic
1113160676 13:107377137-107377159 GTGAAGAAGCAGCCATTGTCTGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1117012516 14:51485292-51485314 GAGAAGAAACACAGAGAGACAGG - Intergenic
1117389397 14:55248662-55248684 GTGAGCAGGCAGAGAAAGTCAGG - Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1119477449 14:74939337-74939359 TTGAAGAGGCAGAGACAGACAGG - Intergenic
1119715481 14:76856111-76856133 GAGCAGAAGCAGAGAGAATGAGG - Intronic
1119958237 14:78824028-78824050 GTAAAGAGGGAGAGAGAGTCTGG + Intronic
1121526065 14:94620392-94620414 GTGCAGGAGCAGAGAGAGTGAGG + Intronic
1122052582 14:99070149-99070171 GTGAGCATGGAGAGAGAGTCAGG - Intergenic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1122530260 14:102420410-102420432 GTGAAGAACCAGCTAGAGCCAGG - Intronic
1123457883 15:20442643-20442665 GTGAAGACGCAGGCAGAGACTGG + Intergenic
1123660186 15:22557766-22557788 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124176142 15:27425936-27425958 GTGAAGAAGCTGGTAGAGTGTGG + Intronic
1124264031 15:28217796-28217818 GTGAAGACGCAGGCAGAGACTGG + Intronic
1124314045 15:28652261-28652283 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124387310 15:29220995-29221017 GTGAAGAGGGAGAGAGAGACAGG + Intronic
1125158277 15:36614355-36614377 GGGAAGAGGCAGAGACAGTTTGG - Intronic
1125165918 15:36704162-36704184 GTGAAGAAGCTGGGACAGTGTGG - Intronic
1125299183 15:38236082-38236104 CTGAAGAAGCACAGATAGGCTGG + Intergenic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126223576 15:46243302-46243324 GTGGAAAAGCAGAGAAAATCTGG - Intergenic
1126433876 15:48615751-48615773 GTGAAGAAGAAGAGAGAAAGAGG + Intronic
1126821170 15:52505523-52505545 GTGAAGAAGCAAAGAGGCTAAGG + Intronic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1126976444 15:54187209-54187231 GTGATGAAGAGGAGAGATTCAGG - Intronic
1127988467 15:64093752-64093774 GTGAAGATGCAGCGGGTGTCCGG - Exonic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128935726 15:71745024-71745046 GTGGAGATGCACAGAGATTCGGG - Intronic
1129029280 15:72606763-72606785 GTGAAGAAGCAGACATAAACAGG - Intergenic
1129037220 15:72657807-72657829 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129212667 15:74079419-74079441 GTGAAGAAGCAGACAGAAACAGG + Intronic
1129397732 15:75261667-75261689 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129401343 15:75285944-75285966 GTGAAGAAGCAGACAGAAACAGG - Intronic
1129474936 15:75778638-75778660 GTGAAGAAGCAGACATAAACAGG - Intergenic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1129729812 15:77923741-77923763 GTGAAGAAGCAGACAGAAACAGG + Intergenic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1129756037 15:78099733-78099755 GTGAAGAAGCAGAGGGTAGCAGG - Intronic
1129838709 15:78730241-78730263 GTGAAGAAGCAGACAGAAACAGG - Intergenic
1129846235 15:78768896-78768918 GGGAAGGAGCAGAGGGAATCGGG - Intronic
1130567700 15:85011378-85011400 GTCAAAAAGCAGGGAGAGACAGG - Intronic
1131149490 15:90037937-90037959 GTGAAGAGGCAGTGAGGGTCTGG + Intronic
1131232041 15:90666470-90666492 GTGAAGAAGAAAAGGGGGTCTGG + Intergenic
1131294799 15:91137853-91137875 GTAAATAAGAAGAGAGAATCAGG + Intronic
1132246105 15:100297478-100297500 GGGAAGAAGCAAATAGATTCAGG + Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1132936636 16:2484502-2484524 GTGTAGAAGCAGAGAGGCCCCGG - Intronic
1133071394 16:3248955-3248977 CTGAAGAAGCTGAGAAAATCAGG - Exonic
1134504486 16:14793932-14793954 GGGAAGATCCAGAGAGAGGCGGG - Intronic
1134576085 16:15334977-15334999 GGGAAGATCCAGAGAGAGGCGGG + Intergenic
1134726357 16:16421524-16421546 GGGAAGATCCAGAGAGAGGCGGG - Intergenic
1134941074 16:18290335-18290357 GGGAAGATCCAGAGAGAGGCGGG + Intergenic
1137514563 16:49131755-49131777 GGGTAGAGGCAGAGATAGTCTGG + Intergenic
1137707144 16:50543590-50543612 GTGAAGAAGAGCAGAGAGGCAGG + Intergenic
1137954416 16:52814589-52814611 GGCTAGAAGGAGAGAGAGTCTGG - Intergenic
1138099425 16:54240439-54240461 TGGAAAAAGCAGAGAAAGTCTGG + Intergenic
1138182070 16:54948100-54948122 GAAAAGATGCAGGGAGAGTCTGG - Intergenic
1139106631 16:63834745-63834767 GGGAAGAGGCAGAGGGAGTGTGG + Intergenic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1140890539 16:79281018-79281040 GTGAAAAAGCAGCAAGAGACAGG + Intergenic
1140936216 16:79672685-79672707 GTGAAGAAGCTGTGAGAGGTTGG - Intergenic
1141801123 16:86309957-86309979 TTGAGGAAGCAGACAGAGGCTGG + Intergenic
1141962667 16:87420042-87420064 TTGAAGAAGCAGTGGCAGTCGGG - Intronic
1143271504 17:5678830-5678852 GTGAAGAAGGAAAGAGTGACAGG - Intergenic
1143445667 17:7007529-7007551 GAGAAGAACTAGAGAGAGTTTGG - Intronic
1143758766 17:9085926-9085948 GTGTAGTAGCAGTGAGAGCCAGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144194405 17:12876327-12876349 GTCAAGAGGCAGAGGGAGTGAGG - Intronic
1144411065 17:15002288-15002310 GTGAAGGAGCAGGGAGATTCTGG - Intergenic
1147465931 17:40610877-40610899 GAGAAGAGGCAGAGAGAGCAGGG + Intergenic
1147760676 17:42795707-42795729 TTGGAGAACCAGAGAGAGTGGGG - Exonic
1147889050 17:43704451-43704473 AGGAAGAAGCAGCGAGATTCAGG - Intergenic
1148334980 17:46834962-46834984 GAGAAGAAGAAGAGAGACTGAGG - Intronic
1148575323 17:48706471-48706493 ATGAAGCAACAGAGAGAGGCAGG - Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1149667004 17:58371886-58371908 GTGAATGAGAAGAGAGAGTAAGG - Intronic
1150461703 17:65359127-65359149 GTCAGGAAGCAGAGAGAGTGAGG + Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151740413 17:75978570-75978592 GTGAAGAAGATGAGGGAGTTTGG - Exonic
1152055189 17:78019174-78019196 GGAAAGAAGCAGAGAGAATGGGG + Intronic
1152251031 17:79212649-79212671 GAAAAGGAGCAGAGAGAGTAAGG - Intronic
1152408469 17:80110454-80110476 CTGCAGAACCAGAGAGCGTCAGG - Intergenic
1152736320 17:81999064-81999086 GTGAGGAAGCTGAGGAAGTCAGG - Intronic
1152743448 17:82028632-82028654 GAGAAGATGCAGACAGAGCCTGG + Exonic
1153883494 18:9441070-9441092 TTGAAGAACCAGAGATAGTGTGG - Intergenic
1154041381 18:10859526-10859548 GTGATGCAGGAGAGAGAGCCAGG - Intronic
1156286835 18:35705038-35705060 ACGAAGAAGGAGAGAGAGCCAGG - Intronic
1156355907 18:36339659-36339681 GTGCAGGTGCAGAGAGAGTTGGG + Intronic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156485111 18:37460443-37460465 GCACAGAAGCAGAGAAAGTCAGG - Intronic
1156910517 18:42406611-42406633 GTGAAGTAGCAGAGCAAGGCAGG - Intergenic
1157019095 18:43757562-43757584 AAGAAGAAGAAGAGAAAGTCTGG - Intergenic
1157410404 18:47458477-47458499 GAGAAGAGACAGGGAGAGTCAGG + Intergenic
1157410810 18:47461519-47461541 GTGAAGATGAAGTGAGAGACTGG - Intergenic
1158425767 18:57338550-57338572 GGGAAGAAGATGAGAGAGTGAGG - Intergenic
1158801771 18:60919674-60919696 CTGAAGAAGCAGGGGGACTCTGG + Intergenic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1159915320 18:74182932-74182954 GGGAAGATGCAGGGAGAGGCAGG - Intergenic
1161238762 19:3210471-3210493 GAGAAGAAGCAGGGAGAGGTGGG + Intergenic
1162064029 19:8114070-8114092 GTGAAGATGGAGACAGAGACTGG + Intronic
1162147532 19:8621850-8621872 GTGAAGACGCAGAGAGAAGGTGG + Intergenic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163742289 19:19022841-19022863 GTGAAAGAGCAAAGAAAGTCAGG + Intronic
1164147850 19:22523408-22523430 GTGAAGAAGCAGACATAAACAGG + Intronic
1164760933 19:30727798-30727820 GTGAGGAGGAGGAGAGAGTCGGG + Intergenic
1164882841 19:31749589-31749611 GCCAAGAATCAGAGAGAGACAGG + Intergenic
1165089499 19:33375836-33375858 GTGAGGGAGGAGAGAGGGTCAGG + Intronic
1165444651 19:35850219-35850241 ATGAAGAAGCTTTGAGAGTCAGG + Intronic
1166064751 19:40350935-40350957 TTGAAGGAGAAGAGAGAGTAGGG + Intronic
1166475206 19:43118491-43118513 ATGAAGATGCAGAGAGTGTTGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166998621 19:46731940-46731962 GTGGAGAAGCAGAGCTCGTCTGG - Intronic
1167419663 19:49395480-49395502 ATGAGGAAGCAGAGGGGGTCTGG + Intronic
1167576228 19:50319243-50319265 GGGACGAGGCCGAGAGAGTCGGG - Intronic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1168249436 19:55133363-55133385 GTGGAGAAACAGAGAGATTCAGG + Intronic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
1168332832 19:55579733-55579755 ATGGAGAGGCAGAGAGGGTCAGG + Intronic
1168508301 19:56954728-56954750 GTCAGGAAGCAGAGGGAGTGAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925981501 2:9180952-9180974 GTGAAGAAGCAGAGATGATGGGG - Intergenic
925991892 2:9260870-9260892 GCGGAGAAGCAGATAGAGTAGGG - Intronic
926219209 2:10924045-10924067 GTGCAGAAGCAAAGAGTGCCCGG - Intergenic
926337558 2:11875583-11875605 TTGAAGAAACAGTGACAGTCAGG - Intergenic
926383815 2:12316640-12316662 GTGCAGAGGGAGAGACAGTCAGG + Intergenic
926592586 2:14755716-14755738 GTGTAGAGGCAGAGAGTGTGTGG + Intergenic
927081954 2:19639343-19639365 TTGTAGAAGCAGAGAGTGTTGGG - Intergenic
927781568 2:25943422-25943444 CTGACTTAGCAGAGAGAGTCTGG - Intronic
927988883 2:27433206-27433228 GGGAAAAGGCAGAGAAAGTCAGG - Intronic
928332554 2:30368752-30368774 GTGATGGAGCTGAGAGAATCTGG - Intergenic
928706224 2:33952606-33952628 GGGAAGAAGAAAAGAGAGACTGG - Intergenic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
929788508 2:45008275-45008297 GTGGAGAAGCAGAGAGCTTCGGG - Intronic
931936817 2:67207579-67207601 GCAAAGAAGCAGAGAGAGGTGGG + Intergenic
932123775 2:69125168-69125190 ATGAAGCAGGAGAGAGAGTGGGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
933983421 2:87572072-87572094 GTGAAGATGCAGAGACAGGTTGG - Intergenic
935084089 2:99827565-99827587 GTGAAGACACAGAGAGACTTTGG + Intronic
935131116 2:100261592-100261614 GTGAAGCAGAAGACAGAGTTGGG - Intergenic
936310427 2:111378722-111378744 GTGAAGATGCAGAGACAGGTTGG + Intergenic
936865700 2:117074175-117074197 GTGAAGAGGCAGAGGGATTGAGG - Intergenic
937249645 2:120515335-120515357 GTCAGGGAGGAGAGAGAGTCAGG - Intergenic
937249691 2:120515547-120515569 GTCAGGGAGGAGAGAGAGTCAGG - Intergenic
937249725 2:120515676-120515698 GTCAGGGAGGAGAGAGAGTCAGG - Intergenic
937379852 2:121366925-121366947 GAGCAGAAGCAGAGCTAGTCTGG - Intronic
938225432 2:129611804-129611826 ATGAAGAAGCAGAGGAAATCAGG - Intergenic
938718021 2:134038909-134038931 GTGGAGCAGGAGAGAGAGTGAGG + Intergenic
938718292 2:134040958-134040980 GTGAAGCAGGAGAGACAGTGAGG + Intergenic
938847942 2:135230829-135230851 GTGACGAATCAAAGAGATTCCGG - Exonic
938987311 2:136590382-136590404 GAGAAGCAGCAGAGAGAGAGAGG + Intergenic
939467909 2:142581841-142581863 GTAAAAAAGGAGAGAGAGCCTGG - Intergenic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940803405 2:158157422-158157444 GTGAAGAAGCAGCTAGAGCCAGG + Intergenic
941246938 2:163110161-163110183 GTGAAGAAGGAGGGAGAGTATGG - Intergenic
941324702 2:164099339-164099361 GAGAAGAAGCTTAGAGACTCAGG - Intergenic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
942606485 2:177697138-177697160 GTGTATAAGCCAAGAGAGTCAGG - Intronic
944644131 2:201761477-201761499 GTCAATAAGCAGAGAGATTTGGG - Exonic
944972511 2:205010138-205010160 GAGAAGGAGTGGAGAGAGTCGGG + Intronic
945089112 2:206162042-206162064 GTGAAGAAGCAAAGAGGCTAAGG + Exonic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
945900246 2:215529267-215529289 GTGAGGACGCAGTGAGAGTGTGG + Intergenic
947488370 2:230572988-230573010 GAGAAGAGGCAGAGACAGTTTGG + Intergenic
947908575 2:233785568-233785590 GTGAGGAGGCAGAGGGAGTCAGG + Intronic
1168937822 20:1682184-1682206 GTAAAAAAGAAGAGAGAGTGTGG + Intergenic
1169675206 20:8145224-8145246 GTGAAGATGCAGGGAGAAGCAGG - Intronic
1169973275 20:11294877-11294899 GTGGAGAAGAGGACAGAGTCTGG - Intergenic
1170064376 20:12294577-12294599 GAGGAGAAGCAGAGAGTGTGGGG + Intergenic
1170431153 20:16278165-16278187 GAGAAGAGGCCGAGAGAGACAGG + Intronic
1170823918 20:19777259-19777281 GTGAAGAGGGAAAGAGATTCAGG - Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170961457 20:21029388-21029410 GTGAAGAAGCGTATAGAGCCTGG - Intergenic
1170964300 20:21052604-21052626 GTGAGGAAGTGGGGAGAGTCAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1172128891 20:32642732-32642754 GTGATGAAGCAGTGAGTTTCTGG - Intergenic
1172310179 20:33912142-33912164 GGGAAGAGGCAGAGACAGTTTGG + Intergenic
1172794718 20:37528690-37528712 GAGAAGAAGTAGAGAGTGTTAGG + Intergenic
1174911167 20:54608969-54608991 ATGAAGAAACAGAGGGAGTTTGG - Intronic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176864603 21:14038812-14038834 GTGGAGAAGCAGAGAAAATCTGG - Intergenic
1178352874 21:31885430-31885452 GTGAAGGGGCAGAGAGTGACAGG - Intronic
1179013572 21:37575136-37575158 GTGAAGAGAAAGAGAGTGTCTGG + Intergenic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1180118435 21:45727501-45727523 GTCAAGAGGCAGAGAGAGCAAGG + Intronic
1180674601 22:17578578-17578600 GTGCCCAAGCAGAGAGCGTCCGG + Intronic
1180701571 22:17784203-17784225 ATGGAGGAGCCGAGAGAGTCGGG + Intergenic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1181915541 22:26276906-26276928 GTGAATGAGCCCAGAGAGTCTGG - Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1183032192 22:35114682-35114704 GTGAGGAATCAGAGACAGGCTGG + Intergenic
1183269413 22:36851281-36851303 GTGAAGACGCTGACAGAGGCTGG + Intergenic
1183517190 22:38273245-38273267 GTGAAGCACCAGCGAGGGTCAGG - Intergenic
1183756322 22:39769589-39769611 GTGGAGAAGAAGAGAGATACAGG + Intronic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184588220 22:45462139-45462161 GTGGAGACACACAGAGAGTCTGG + Intergenic
1184791899 22:46705232-46705254 TGGAAGATGCAGAGAGAGTATGG + Intronic
949870470 3:8583706-8583728 GTCCAGAAGCAGAGGGAGTGAGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950318103 3:12023385-12023407 GTGAAGAAGTAGAGAGGATAGGG + Intronic
950768095 3:15288979-15289001 GTGATGTAGCAGAGAGATACAGG + Intronic
951924013 3:27887411-27887433 ATTAAGTAGCAAAGAGAGTCAGG - Intergenic
951925521 3:27905350-27905372 GTCAATAATCAGATAGAGTCCGG + Intergenic
954776480 3:53023577-53023599 CTGATGATGCAGGGAGAGTCTGG - Intronic
956344532 3:68263596-68263618 GTAATGAAGCTGAGAGAGGCTGG + Intronic
956639110 3:71397942-71397964 AGGAAGAAGCAGAGAGAGTGGGG + Intronic
957632819 3:82739908-82739930 GTGAAAAAGGAGATAGAATCTGG + Intergenic
958489884 3:94758897-94758919 GTACAGAAGCAGAGAGAGATCGG - Intergenic
964539663 3:157765519-157765541 GTGATGAAGAAGAGAGGGTTTGG - Intergenic
964904711 3:161706501-161706523 AAGAAGTAGCAGAGAAAGTCTGG + Intergenic
965239238 3:166173271-166173293 GTAAAGAAGCAGGGAAAATCAGG + Intergenic
965817870 3:172655507-172655529 CTGGAGAAGGAGAGAGAGTTGGG + Intronic
966209846 3:177442023-177442045 CTGAAGATGGAGAGAGAGCCTGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967676213 3:192301796-192301818 GAGAAGAAGAAAAGAGAGTATGG + Intronic
967688427 3:192444620-192444642 GTCTAGAAGCTGAGAGAATCTGG - Intronic
967815560 3:193795589-193795611 ACGAAGAAGCAGACAGAGTCAGG - Intergenic
968427840 4:535006-535028 ATGAGGAAGCAGAGAGTGTGCGG - Intronic
968826413 4:2901067-2901089 CTGAAGAAGCAGTTAGAGTTGGG + Intronic
969363488 4:6680466-6680488 GTGAAGAAGCACCGAGAAACTGG - Intergenic
969387820 4:6867679-6867701 GTAAAGAAGGAGTGAGGGTCAGG + Intronic
969418140 4:7074431-7074453 GTGAGGATGGAGAGAGAGACTGG - Intergenic
969912369 4:10457866-10457888 GTAAAGGAGTAGGGAGAGTCAGG - Intergenic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
970258174 4:14191673-14191695 TTCAAGAAGCAGAGAGAATGTGG - Intergenic
970689328 4:18603888-18603910 GTGAAGAAGAAGAGAAAGCAGGG - Intergenic
971176412 4:24286602-24286624 GTGAAGGCACAGAGAGAATCTGG + Intergenic
971274412 4:25182362-25182384 GTGAAGAAGAGGAGAGAGTCTGG + Intronic
971514611 4:27470893-27470915 GTGATGAGGCAGAGATAGTTTGG - Intergenic
972426409 4:38937369-38937391 GTCAAGACACAGAGAGAGACTGG - Intronic
973885066 4:55312581-55312603 GTGAAGATGGAGACAGAGTTTGG + Intergenic
973926980 4:55748739-55748761 GTAAAGAAACAGAGAGAGAGAGG + Intergenic
976140233 4:81983906-81983928 GCCCTGAAGCAGAGAGAGTCAGG - Intronic
976716805 4:88131624-88131646 GTGAAAAGGCAGGGAGAATCTGG - Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976874428 4:89836742-89836764 GTGGAGAAGCAGAGGGACTCAGG - Intronic
977483931 4:97617630-97617652 GTGAAGAACCAGACAGAATAAGG + Intronic
978421972 4:108542664-108542686 GTGAAAAAGGAGAGAGAGTGGGG - Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979592840 4:122500216-122500238 GTGAAGACGCAGACAAAGACTGG - Intergenic
980837692 4:138217112-138217134 GTGAAGACGCAGAAATAATCTGG - Intronic
981765587 4:148245304-148245326 GTTAAGAATCAGGGAGAGGCTGG + Intronic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
982135734 4:152272468-152272490 GGGAAGAAACATACAGAGTCTGG - Intergenic
982417926 4:155158311-155158333 GAGAAGAAGCAAAGAGAGAAGGG - Intergenic
983159553 4:164394416-164394438 GTGAAGATGCAGAGAGAATGTGG - Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984556916 4:181225612-181225634 GAGAAGAAAAAGAGAGAGACAGG - Intergenic
985861946 5:2478105-2478127 GTGAAGCTCCAGAGACAGTCTGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986143992 5:5059718-5059740 GTGGAGAAGGAGAGAAAGTTGGG + Intergenic
986915327 5:12612989-12613011 TTGGAGAAGAAGAGACAGTCTGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988327157 5:29785202-29785224 GTGAAGAAGCAGAGAGGTTATGG + Intergenic
988386442 5:30572386-30572408 GTGAAAAAGTGGAGACAGTCAGG + Intergenic
989177066 5:38538586-38538608 GTGAGGAAGAAGGAAGAGTCAGG - Intronic
990851158 5:60206083-60206105 GAAAAGAAGCTGAGAGGGTCAGG - Intronic
991534248 5:67649079-67649101 GTGAAAAAGCAGATACAGCCAGG - Intergenic
991581421 5:68159537-68159559 GTGAAGAAGCAAAGAGGCTAAGG - Intergenic
993723124 5:91341332-91341354 GTGAGGCTGCAGAGAGAGGCAGG + Intergenic
994102165 5:95905438-95905460 CTGGAGAAGCAGTGAGAGTCAGG - Intronic
995730215 5:115231196-115231218 GTGAATAAGAAGAGAAAATCAGG - Intronic
996423315 5:123285762-123285784 GGGAAGAGGGAGAGGGAGTCGGG - Intergenic
997031241 5:130131342-130131364 TGGAAACAGCAGAGAGAGTCAGG - Intronic
997103455 5:130993708-130993730 GTCAGGAAGGAGAGAGTGTCAGG + Intergenic
997584665 5:135037271-135037293 CTGAAGCAGCAGGCAGAGTCCGG - Intronic
997863977 5:137444608-137444630 CTCAGGAAGCAGAGTGAGTCCGG - Intronic
998785834 5:145707864-145707886 GACAAGAAGGAGAGAGAGCCTGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999505968 5:152196710-152196732 GTGAGGTAGCACGGAGAGTCAGG + Intergenic
999736646 5:154517947-154517969 GGGAAGCAGCAGGCAGAGTCGGG + Intergenic
1000991310 5:167914837-167914859 GTAAAGATGCAGAGAGACACAGG - Intronic
1001584674 5:172825622-172825644 GTGAAGAAGCAGAGTTATTCTGG + Intergenic
1001748044 5:174107288-174107310 GGGAAGAAAGAGACAGAGTCAGG - Intronic
1002047683 5:176550967-176550989 GAGAAGAATCAGGGAGACTCTGG - Intronic
1002792277 6:445337-445359 GTAAACAAGCAGAGGGAGGCAGG + Intergenic
1002821639 6:730929-730951 GTCTAGAAGAAGAAAGAGTCCGG + Intergenic
1003571183 6:7257779-7257801 GTGTGGAGGCAGAGAGGGTCGGG - Intergenic
1003695159 6:8398511-8398533 GAGAAGAAGCAAAGGGAATCTGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004675687 6:17839744-17839766 GTGAAGATGCAGGCAGAGACTGG + Intronic
1004708027 6:18142571-18142593 GGGAACAAGCAGAGAGAATCTGG - Intronic
1004764665 6:18712572-18712594 GAGAGGAACCAGAGAGAGTTGGG - Intergenic
1005011613 6:21341182-21341204 GACAAGAAGAAGAAAGAGTCTGG + Intergenic
1005283828 6:24303075-24303097 ATGAACAAGCAGAGACAGCCGGG - Intronic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005930924 6:30483229-30483251 GTGAAGAAGGAGGCAGAGACTGG - Intergenic
1005968011 6:30741385-30741407 GAGAAAAAGCAGAGAGAGAAGGG + Intronic
1006424553 6:33956090-33956112 GTGAAGAAACAGGGAAACTCAGG - Intergenic
1006508467 6:34506880-34506902 GTGAAGAATGAGGGAGAGCCAGG - Intronic
1006637287 6:35469517-35469539 GTCAAGAAGCTGGGTGAGTCCGG + Exonic
1006803651 6:36775069-36775091 GTGAAGAAGAAGAGAGGGAAAGG + Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007274740 6:40665071-40665093 GTGAAGAGGCAGTGAGAGAGTGG - Intergenic
1007404701 6:41627889-41627911 GTGATGATGCCGAGACAGTCTGG - Intergenic
1007506165 6:42337056-42337078 AGGAAGATGCAGAGAGACTCTGG + Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1008414430 6:51223489-51223511 ATGAGGAAGCAGATAGAATCTGG - Intergenic
1008433476 6:51447478-51447500 GGGAAGAAGAAGAGAGAGAAAGG + Intergenic
1008639299 6:53445032-53445054 GAGAAGAAGCAAAGAGAGATGGG - Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1009889474 6:69663298-69663320 GTGAAGATGATGAGAGATTCTGG + Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010579325 6:77574737-77574759 GTGAAGAGGCAGAAAGACACAGG + Intergenic
1011080795 6:83488667-83488689 ATGAACATGCAGAGACAGTCAGG - Intergenic
1011715715 6:90103274-90103296 GTGTGGGAGCAGAGAGAGCCAGG + Intronic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012556911 6:100524736-100524758 ACTAAGAAGCAGAGAGAGCCTGG - Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1015732198 6:136360754-136360776 GTGAAGAAGCAGAGAGGGTCCGG - Exonic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017076565 6:150624290-150624312 GACAAGAAGCAGAGATAGGCAGG - Intronic
1017386504 6:153891033-153891055 TTAAAAAAGCAGAGAGAGGCCGG + Intergenic
1017902765 6:158732563-158732585 AGGAAATAGCAGAGAGAGTCTGG - Intronic
1018135161 6:160771904-160771926 GTGAGGGTGCAGTGAGAGTCAGG - Intergenic
1018907045 6:168081503-168081525 GTCCAGAAGAAGAGAGAGTTGGG - Intronic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1019209991 6:170397310-170397332 TTCAAGCAGCAGAGAGAGTGAGG - Intronic
1020627603 7:10601201-10601223 GTGAAGATGCAGGCAGAGACTGG + Intergenic
1021206432 7:17786697-17786719 ATGAGGAAGCACAGATAGTCTGG + Intergenic
1021425147 7:20491086-20491108 GAGCAGAAGAAGAGAGAGACGGG - Intergenic
1021610852 7:22456737-22456759 GAGAGGAAGAAAAGAGAGTCTGG + Intronic
1021799789 7:24293597-24293619 GTGAAGAAGCAGAGGGATCAAGG - Intergenic
1022499064 7:30871215-30871237 GGGAAGAAGCACAGAGAAGCTGG - Intronic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1023057783 7:36303688-36303710 TGGAAGGAGCAGAGAGAGCCTGG - Intergenic
1023172422 7:37402580-37402602 GAGTAGAGGGAGAGAGAGTCTGG + Intronic
1023507943 7:40919853-40919875 GTGAAGAATCAGGAGGAGTCAGG - Intergenic
1023986453 7:45099961-45099983 GGGAAGAAGCTGGGAGAGACAGG + Intergenic
1024710081 7:52005738-52005760 CTGTGGAAGCAGAGAGGGTCTGG + Intergenic
1024742215 7:52366589-52366611 GTGTAGAGACAGAGAGAGACAGG - Intergenic
1026785446 7:73299290-73299312 GTGAAGTAGGAGAGAAAATCTGG + Intergenic
1026844389 7:73689829-73689851 GTGAAAGAGGAGAGAGAGTTAGG + Intronic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1027108628 7:75420643-75420665 GTGAAGTAGGAGAGAAAATCTGG - Intronic
1027137300 7:75633909-75633931 TTGAGGAAGCAGTGAGATTCAGG + Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1029127318 7:98303566-98303588 CTGAAGAGGCAGGCAGAGTCCGG + Intronic
1029167756 7:98606150-98606172 GTGGAGAACTGGAGAGAGTCTGG - Intergenic
1029501681 7:100934575-100934597 GTGAAAATGCAGAGAGAGAGAGG - Intergenic
1030059783 7:105613196-105613218 GTGAGGAAGCTGAGAGAGTGTGG - Intronic
1030161411 7:106512175-106512197 GAGCAGAAGCTGAGACAGTCTGG - Intergenic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1031053763 7:116971989-116972011 GGGAAGAGGCAGAGACAGTTTGG + Intronic
1031131027 7:117833274-117833296 GTCAGGAGGCAGAGAGAGTGAGG - Intronic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1032406816 7:131662267-131662289 GTGAAGAAGCAAAGAGGCTAAGG - Intergenic
1032725544 7:134587129-134587151 GGGAAGAAGCAGAGAGAGAGGGG + Intergenic
1032733616 7:134669412-134669434 GATAATAAGCAGAGATAGTCTGG - Intronic
1032980947 7:137282475-137282497 GAGAAGCAGAACAGAGAGTCAGG + Intronic
1033639444 7:143247078-143247100 GGGAAGAAAATGAGAGAGTCAGG - Intronic
1033681599 7:143600838-143600860 GTGCAGAAGGAGAGAGACACGGG + Intergenic
1033703293 7:143860975-143860997 GTGCAGAAGGAGAGAGACACGGG - Intronic
1034539735 7:151749371-151749393 TGGAGGAAGCAGAGAGAGTGAGG - Intronic
1035054716 7:156026898-156026920 GAGAAGCAGCAGAGACAGGCTGG + Intergenic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035733413 8:1869571-1869593 GTGAGAAAGTAGAGAGAATCAGG + Intronic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1037475124 8:19249534-19249556 GTGAAGAAGCGGAGACAGCCGGG + Intergenic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1037499870 8:19475226-19475248 ATGCAGAAGCCGAGAAAGTCTGG + Intronic
1037826244 8:22162301-22162323 GGGAAGCAGCAGGGAGAGACAGG + Intronic
1037915408 8:22769988-22770010 GTGGACAAGAGGAGAGAGTCAGG - Intronic
1037939533 8:22941282-22941304 TTCAAGATGCACAGAGAGTCAGG + Intronic
1038900995 8:31843705-31843727 GGGAAGAAGCAGAGTGACTGGGG - Intronic
1039389391 8:37165177-37165199 AGGAAGAAGCAGAGAGTCTCTGG + Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1042419421 8:68568030-68568052 GAGAAGAAGCAGAGAGATAGGGG + Intronic
1042996957 8:74711213-74711235 GTGCAGATGCACAGAGAGCCAGG - Intronic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043259833 8:78182910-78182932 GGGAAGAAGTAGAGAGAACCAGG + Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1044644232 8:94421072-94421094 TTGAAGAAGCAGAGGCAGTGTGG - Intronic
1044861922 8:96532387-96532409 CTCAATAAGCAGAGAGACTCAGG - Intronic
1044869855 8:96607949-96607971 GTGAAGGAGCAGGGAGAATTGGG + Intronic
1045545141 8:103121980-103122002 GAGAACAACCAGAGAGAGTGTGG + Intergenic
1045866076 8:106866976-106866998 GAGAAGGAACAGAGGGAGTCAGG + Intergenic
1046320045 8:112561658-112561680 GGGAAGAAACAGAGAAAGACTGG - Intronic
1046521793 8:115334485-115334507 GTGAACAAGCTGGGAGAGTGAGG - Intergenic
1046669189 8:117038996-117039018 CTGAAACAGCAGAGAGATTCAGG + Intronic
1046807207 8:118492552-118492574 GTGAAACAGCAGAGAGAGCATGG - Intronic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047769590 8:128020159-128020181 GTGGAGAAGCAGAGAAGCTCTGG + Intergenic
1048386145 8:133914191-133914213 GTTGGGAAGCAGAGAGAGCCAGG - Intergenic
1048543443 8:135363990-135364012 GAAAAGTAGCAGAGAGAGGCAGG - Intergenic
1050301804 9:4266217-4266239 GTTAAGAAGCAGGGTGAGTGCGG - Intronic
1050619965 9:7442125-7442147 TTGGAGAAGCAGTGACAGTCTGG + Intergenic
1050687046 9:8183487-8183509 GAGAAGAAGCAAAGAGATACAGG + Intergenic
1050882087 9:10714532-10714554 GTAAAGAAGCTGAGAGACTTGGG + Intergenic
1051083493 9:13320295-13320317 GCAAAGGAGCAGAGGGAGTCAGG - Intergenic
1051731320 9:20146244-20146266 CATCAGAAGCAGAGAGAGTCTGG + Intergenic
1053111019 9:35460402-35460424 GGGAAGAGGCAGAGAGAGAGAGG - Intergenic
1054738239 9:68778548-68778570 GGGGAGAAGCAGAGAGACTGAGG - Intronic
1055252873 9:74329595-74329617 GTGCAGAGGCAGAGATTGTCAGG + Intergenic
1055670834 9:78604773-78604795 CTGAAAACGCAGACAGAGTCAGG - Intergenic
1056759294 9:89403930-89403952 GAGAAAAAACAAAGAGAGTCAGG + Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1057601272 9:96459637-96459659 GTCAAGAAGCAGAAAGAGTTTGG - Intronic
1057722893 9:97547028-97547050 GAGAAAGAGCAGAGAGAATCTGG - Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1058791966 9:108456657-108456679 GTGAACAAGTACAGGGAGTCTGG + Intergenic
1059212204 9:112523885-112523907 GAGAGTAAGCAGGGAGAGTCAGG - Intronic
1059252813 9:112902422-112902444 GTGAAGCAGGAGAGAGAAGCTGG - Intergenic
1060058773 9:120440017-120440039 GTGAGGAAGGAGAGAGGGTTTGG - Intronic
1060773405 9:126349084-126349106 GTCAGGAAGCACAGAGAGCCAGG + Intronic
1061614925 9:131773330-131773352 GTCAAGAGGCAGAGGGAGCCAGG - Intergenic
1061955080 9:133957066-133957088 GTGAGGAACCAGAGAGACACTGG - Intronic
1062070160 9:134551127-134551149 GTGAAGAGGCGGAGAGATGCAGG - Intergenic
1062081910 9:134628605-134628627 GTGAAGAAGGAGGCAGAGGCTGG - Intergenic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062318363 9:135978840-135978862 CTGGAGAAGCACAGAGAGTGAGG - Intergenic
1062480944 9:136751054-136751076 GGGAAGAAGGAGAGAGAGAGAGG + Intergenic
1185691132 X:2156041-2156063 GTGAAGATGGAGACAGAGACGGG - Intergenic
1185699561 X:2220195-2220217 GTGATGATGCAGACAGAGACTGG - Exonic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1186184796 X:7010281-7010303 ATGAAGATGCAGAGAGTGTTGGG - Intergenic
1187495039 X:19788352-19788374 GTGAAGATGAAGACAGAGACTGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187581750 X:20614630-20614652 GTGAAGGAGCAGGGAGAGTAAGG - Intergenic
1187983831 X:24788713-24788735 GTGAAGAAGCAAAGAGGCTAAGG - Intronic
1189530526 X:41877167-41877189 TTGAAGAAACAGAGAGGGACGGG - Intronic
1190495786 X:51027457-51027479 GTGGAGAAACAGTGAGTGTCAGG - Intergenic
1190510139 X:51166141-51166163 GTGGAGAAACAGTGAGTGTCAGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192917428 X:75667447-75667469 GGGAAAAAGGAGAGAGAGTTAGG - Intergenic
1194419249 X:93651765-93651787 GAGAAACAGCAGAGAGGGTCTGG - Intergenic
1194696159 X:97053616-97053638 TTGAAGAATCAGAGTGATTCAGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1195791229 X:108589143-108589165 GTGTAGATGCAGAGAGAATAAGG + Intronic
1196071198 X:111524468-111524490 TTGAAGAAGCACAGTGAGTGAGG + Intergenic
1198341633 X:135719971-135719993 GGACAGTAGCAGAGAGAGTCAGG - Intronic
1198346365 X:135763390-135763412 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198348271 X:135780675-135780697 GGACAGTAGCAGAGAGAGTCAGG + Intergenic
1198350173 X:135797938-135797960 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198352083 X:135815211-135815233 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198353991 X:135832479-135832501 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198355899 X:135849729-135849751 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198359728 X:135884290-135884312 GGACAGTAGCAGAGAGAGTCAGG + Intronic
1198366582 X:135946068-135946090 GGACAGTAGCAGAGAGAGTCAGG + Intergenic
1198957386 X:142147855-142147877 GAGATGAGGAAGAGAGAGTCTGG - Intergenic
1199295731 X:146156130-146156152 AGGAAGATACAGAGAGAGTCTGG - Intergenic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1200032204 X:153305964-153305986 GTGAAGAAACAGAGATGGACAGG - Intergenic
1201253617 Y:12086107-12086129 GTTCAGAAACAGAGAGACTCTGG + Intergenic