ID: 1151369305

View in Genome Browser
Species Human (GRCh38)
Location 17:73637861-73637883
Sequence CATCTGGGTTGGGCAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151369305_1151369314 10 Left 1151369305 17:73637861-73637883 CCAGGGGCTGCCCAACCCAGATG 0: 1
1: 0
2: 2
3: 22
4: 214
Right 1151369314 17:73637894-73637916 TAAGAGGCAGATTCATCTGTCGG 0: 1
1: 0
2: 3
3: 15
4: 158
1151369305_1151369311 -6 Left 1151369305 17:73637861-73637883 CCAGGGGCTGCCCAACCCAGATG 0: 1
1: 0
2: 2
3: 22
4: 214
Right 1151369311 17:73637878-73637900 CAGATGCCAGGCCTGCTAAGAGG 0: 1
1: 0
2: 1
3: 13
4: 195
1151369305_1151369315 11 Left 1151369305 17:73637861-73637883 CCAGGGGCTGCCCAACCCAGATG 0: 1
1: 0
2: 2
3: 22
4: 214
Right 1151369315 17:73637895-73637917 AAGAGGCAGATTCATCTGTCGGG 0: 1
1: 0
2: 2
3: 13
4: 185
1151369305_1151369316 22 Left 1151369305 17:73637861-73637883 CCAGGGGCTGCCCAACCCAGATG 0: 1
1: 0
2: 2
3: 22
4: 214
Right 1151369316 17:73637906-73637928 TCATCTGTCGGGCCAGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151369305 Original CRISPR CATCTGGGTTGGGCAGCCCC TGG (reversed) Intronic
900935192 1:5760668-5760690 CATCTGGCTGGGGAAGCCTCAGG - Intergenic
901215227 1:7551173-7551195 CCTCTGGGCAGGGAAGCCCCAGG - Intronic
901782811 1:11605242-11605264 CATCTGGGCTGGGCAACTGCTGG + Intergenic
902273791 1:15325230-15325252 AATCTAGGGTGGGCTGCCCCTGG - Intronic
902368232 1:15990827-15990849 CATGAGGGTCTGGCAGCCCCTGG - Intergenic
904492443 1:30869410-30869432 CATTTGGGGAGGGCAGCCCATGG - Intergenic
906212658 1:44020806-44020828 CGTCAGGGTGGGGCAGCCCCTGG + Intronic
906692228 1:47800077-47800099 CAACTGGCTGGAGCAGCCCCTGG - Intronic
912696881 1:111848659-111848681 CTGCTGGGTGGGCCAGCCCCAGG - Intronic
913115181 1:115690437-115690459 CATCAGGCCTGGGCATCCCCTGG + Intronic
913971841 1:143422493-143422515 CAGCTGGGCGGGGCAGCCACAGG - Intergenic
914066220 1:144248106-144248128 CAGCTGGGCGGGGCAGCCACAGG - Intergenic
914112933 1:144718248-144718270 CAGCTGGGCGGGGCAGCCACAGG + Intergenic
915304605 1:154970304-154970326 CAGCCGGGTTGGCCAGCCTCAGG + Exonic
915948768 1:160173761-160173783 CATCTGGGTGGGGCAGGCTGGGG - Intronic
918075913 1:181171374-181171396 CCTCTGGGTCGGGGAGCCACAGG + Intergenic
919790806 1:201289645-201289667 CAGCTTGGTTGGGGAGACCCAGG + Intronic
919921477 1:202168895-202168917 TTTCTGAGCTGGGCAGCCCCGGG + Intergenic
922725483 1:227921059-227921081 CAGCAGGGTTGGCCAGGCCCGGG + Exonic
924150307 1:241123279-241123301 CAGCTGGGTTGGGGAGGCCTTGG - Intronic
924772607 1:247090001-247090023 CATGTGGGGTGGACAGCACCTGG + Intergenic
1063270704 10:4507586-4507608 CATCTGGTTGGGGGAGGCCCGGG + Intergenic
1063904311 10:10766715-10766737 CCTCTGCTTTGGGCAACCCCAGG - Intergenic
1065362632 10:24903610-24903632 CAGCTGGCTTGGGCAGAGCCAGG + Intronic
1067081835 10:43216620-43216642 TCTCTGGGTGGGGCAGCCCCTGG - Intronic
1067180529 10:43982492-43982514 CATCAGGGTTGGGCAGGCCCTGG - Intergenic
1067250405 10:44581693-44581715 GGTCTGGGGTGGGCAGCACCAGG + Intergenic
1070750726 10:78962584-78962606 CACCTGGGATGGGGAGCCACTGG - Intergenic
1072682265 10:97516110-97516132 CACCAGGCTTGGGGAGCCCCTGG - Intronic
1075208230 10:120465365-120465387 CCCCTGGGTTCTGCAGCCCCAGG - Intronic
1075347774 10:121696918-121696940 CAGCTGGGTTGTGCATCCTCAGG + Intergenic
1075700731 10:124468028-124468050 GGTCTGGGTTGGGCAGACCAGGG - Intronic
1076107676 10:127836129-127836151 CATCTGGTTTATACAGCCCCAGG - Intergenic
1076481278 10:130786678-130786700 CAGATGGGATGGGAAGCCCCCGG - Intergenic
1076814457 10:132907955-132907977 CATCTGGGGTGGGAGCCCCCCGG + Intronic
1077301589 11:1849726-1849748 CACATGGGCTGGGCAGCCTCCGG + Intergenic
1077308025 11:1876543-1876565 CAGCCGGGTGGGGCAGCCACAGG + Intronic
1078645910 11:13141249-13141271 CATCTGGAAAGGGCAGCCCCTGG + Intergenic
1080502567 11:32884783-32884805 AACTTGGATTGGGCAGCCCCTGG - Intergenic
1081184344 11:40023612-40023634 CATCTGCCATGGGCAGCTCCTGG + Intergenic
1081769767 11:45642462-45642484 CAGCTGGCTTGGGCTACCCCAGG + Intergenic
1083681175 11:64352546-64352568 CTTCTGGGTTGGGCTCCCCGTGG + Intronic
1083959154 11:66004405-66004427 CAGCTGGGCTAGGCAGCACCTGG + Intergenic
1084426316 11:69086199-69086221 CATGGGGGTGGGGGAGCCCCGGG + Intronic
1086452060 11:86926789-86926811 CATCTACGTGGGGCAGCCTCTGG + Intronic
1089767022 11:120775355-120775377 CAGCTGGGTTGGGCAGCAAGAGG + Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090658101 11:128861173-128861195 CATGTGGGTTAGGGAGCCCCAGG - Intronic
1090828748 11:130406159-130406181 GACCTGGGCTGGGCAGCCACTGG - Intronic
1091102311 11:132886558-132886580 TAGCTGGATTGGGCAGGCCCTGG - Intronic
1096113663 12:49042785-49042807 CATCTGGGTTGTGGAACCCCTGG - Exonic
1096579356 12:52574477-52574499 CTTCTGTGTTGGGCAGGGCCTGG + Intergenic
1101444759 12:104729831-104729853 CATCTGGATGGGGGAGCCCCTGG + Intronic
1102247799 12:111366199-111366221 CATCTGGGCTGGGGGACCCCAGG + Exonic
1103927137 12:124429351-124429373 CATCTGGATGGGGGAGCGCCAGG + Intronic
1112429434 13:99337722-99337744 CATGTGGGTTGGGAAGGCCAAGG - Intronic
1118491996 14:66270073-66270095 CTACTGTGTTAGGCAGCCCCTGG + Intergenic
1119301053 14:73571346-73571368 CCGCTGGGTAGGGCAGCACCTGG - Intronic
1119508931 14:75196282-75196304 CATTTGGGTTTGGGAGACCCTGG - Intergenic
1120444770 14:84580067-84580089 CTTCTGTGTTGGGAAGTCCCTGG - Intergenic
1123119323 14:105909528-105909550 CATCAGGGTTGGGGTCCCCCAGG + Intergenic
1128309722 15:66622442-66622464 CACCTGGGAGGGGCAGCCCGGGG - Intronic
1128780086 15:70353575-70353597 CACCTGAGCTAGGCAGCCCCGGG + Intergenic
1129522747 15:76196137-76196159 TATCTGGATAGGGCAGGCCCAGG + Intronic
1130411841 15:83654239-83654261 TATCTGGGACGTGCAGCCCCGGG - Exonic
1132295731 15:100732866-100732888 CATCAGTGTTGGTCAGCCCAGGG - Intergenic
1132352447 15:101148500-101148522 CAGCTGGGAGGGGCAGTCCCAGG + Intergenic
1132418913 15:101647502-101647524 CTTCTGAGTTGGGCTGCCTCTGG - Intronic
1132860953 16:2071554-2071576 CATCCTTGTTGGGCAGGCCCAGG - Exonic
1133252613 16:4493537-4493559 CAACTGGGATGGGCAGAACCAGG + Intronic
1133297576 16:4762420-4762442 GATCTTGGGTGGGCAGCCGCCGG - Intronic
1133788298 16:8989763-8989785 CATCTGGGTGTGGCAGCCAGAGG - Intergenic
1134671636 16:16060077-16060099 CATCCTTGTTGGCCAGCCCCTGG + Intronic
1134862975 16:17577433-17577455 CTTCTGGGTCAGGGAGCCCCGGG - Intergenic
1136024050 16:27458680-27458702 CATCTGGGCTGTGCATTCCCTGG + Intergenic
1136454866 16:30374706-30374728 TATCTGGGGTGGGCACCCGCAGG + Intronic
1137057365 16:35752096-35752118 CTTCTGGGCTGGGCACCCTCAGG - Intergenic
1138236708 16:55389812-55389834 CAGCTGGGCTGGGCAGTCCATGG - Intronic
1138342476 16:56299264-56299286 CTCCAGGGTTGGACAGCCCCAGG - Intronic
1138537100 16:57666080-57666102 TGTCCGGATTGGGCAGCCCCGGG + Intergenic
1139474190 16:67194438-67194460 CCTCTGGGATGGGCACCTCCAGG - Exonic
1139512995 16:67437873-67437895 CTTCAGGGTTGGGGAGTCCCAGG - Intergenic
1141413727 16:83854145-83854167 CGTCAGGAGTGGGCAGCCCCAGG + Intergenic
1141859802 16:86708761-86708783 CATCTGCTGTGGGAAGCCCCTGG + Intergenic
1142376017 16:89707509-89707531 CATCTGGCTGGGGCAGCTCCTGG - Exonic
1142900500 17:3008482-3008504 CTCCTGGGTTGGGGAGCCCAGGG + Intronic
1143751672 17:9032687-9032709 CCTTTGGGTTGGGCGGCCCCAGG + Intronic
1147158326 17:38556647-38556669 CTTCTGGGTTGGGCAGATACTGG - Intronic
1147163023 17:38578836-38578858 CTTGGGGGATGGGCAGCCCCAGG - Intronic
1147583286 17:41638621-41638643 CCCCTGGGTAGGGGAGCCCCTGG - Intergenic
1147591997 17:41689502-41689524 CAGCTGGGTGGGGCACCGCCTGG + Intronic
1147758772 17:42784346-42784368 CCACTGGGCTAGGCAGCCCCAGG - Intronic
1147768928 17:42854646-42854668 CATCTGGATGCGGTAGCCCCGGG - Exonic
1147914317 17:43877580-43877602 CATCAGGAGTGGGCAGCACCTGG + Intronic
1149865183 17:60147638-60147660 AGTCTGGGCTGGGCAGGCCCTGG + Intergenic
1151369305 17:73637861-73637883 CATCTGGGTTGGGCAGCCCCTGG - Intronic
1151681769 17:75626207-75626229 CATCTGGTTTGAGCTGCCACAGG + Intergenic
1151815205 17:76468327-76468349 CAGCAGGGTTGGGGTGCCCCAGG + Intronic
1152463370 17:80452656-80452678 CATGTGGCTTGGGCAGGCCAGGG - Intergenic
1153372303 18:4333229-4333251 CATCTGGGATGAGCAGCCCCTGG - Intronic
1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG + Intronic
1161729600 19:5951338-5951360 GGTCTGGGTTGGGCTCCCCCTGG + Intronic
1162035036 19:7934036-7934058 TGTCTGGGTTCGGCCGCCCCAGG + Intronic
1162560553 19:11416032-11416054 TTTCTGGGCTGGGCGGCCCCAGG - Exonic
1162885180 19:13691684-13691706 CATATGGGCAGGGCAGCTCCAGG + Intergenic
1164011844 19:21210492-21210514 CAGCTGGGCTGGGCAGCCTCAGG - Intergenic
1165306013 19:35003448-35003470 TATCCTGGTTGGGCAGCCGCAGG + Intronic
1166391169 19:42409694-42409716 ATGCTGGTTTGGGCAGCCCCGGG + Intronic
1166807224 19:45494627-45494649 CATCTGGGCTGGGTGGCCCGGGG - Exonic
1167012284 19:46816464-46816486 CATGTGGGTTGGGCCGCCGTTGG + Intergenic
1167249560 19:48392899-48392921 CATCTGGGTGTGGGACCCCCGGG + Intergenic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
1168630892 19:57955225-57955247 CACATGGGATGGGCAGCCCCGGG - Intergenic
925134068 2:1514457-1514479 CATCGGGTTTGGGCAGGCCCTGG - Intronic
925298029 2:2791169-2791191 GATCCGTGTTGGGCAGCTCCAGG + Intergenic
925844716 2:8024816-8024838 CAGCTGGGTGAGGCAGCCCGTGG - Intergenic
927506066 2:23615635-23615657 GAGCTGGGGTGGGCAGCCCATGG - Intronic
929712281 2:44277531-44277553 GATCTGGGGTGGGGAGCCCATGG - Intronic
929833783 2:45375266-45375288 CTTCTGGGTGGGGGAGCCTCAGG + Intergenic
932895894 2:75639253-75639275 CATCTTGGGTGGGCAGTGCCAGG + Intergenic
933764149 2:85695649-85695671 TATTTGGGTTCTGCAGCCCCAGG - Intronic
934176531 2:89583425-89583447 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934286841 2:91657786-91657808 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934546143 2:95218118-95218140 CAGATGGGTTTAGCAGCCCCAGG - Intronic
934656319 2:96118274-96118296 CCTCTGGGCTGGGCAGGGCCTGG + Intergenic
936529118 2:113263009-113263031 CAGCAGGCTTGGGCAGCCCCTGG + Intronic
937078354 2:119123456-119123478 CAGCTGGGCTGGGCTGGCCCAGG + Intergenic
937364059 2:121248218-121248240 CAGCTGGGTCGGGCTGGCCCTGG + Exonic
940622022 2:156124197-156124219 CATATTGGTTGGTCAGCCCATGG + Intergenic
944221909 2:197311064-197311086 CATATGGGTGGGGAAGCCCGCGG + Intronic
945033732 2:205686655-205686677 CATCTGGGTTGGGGAACCTTCGG + Intronic
947828798 2:233124692-233124714 TAGCTGGGATGGGCAGCCCGAGG - Intronic
948566534 2:238890842-238890864 AATCTGGGAAGGGCAGACCCTGG - Intronic
948792809 2:240388100-240388122 CATGTGGGGTGGGCTGACCCTGG - Intergenic
948845213 2:240679861-240679883 CATCCTGGTGGGGCAGACCCGGG - Intronic
948848647 2:240695018-240695040 CATCCTGGTGGGGCAGACCCGGG + Intronic
1170143330 20:13147104-13147126 CATCAGGGGTGGGCAGCCGTCGG - Intronic
1172160799 20:32866663-32866685 CATCTGGGCTGGTCAGGACCAGG + Intronic
1175194140 20:57230577-57230599 CCTCTGGTTTGGGCAGGACCTGG - Intronic
1182351115 22:29700537-29700559 CTTCTGGGGTAGGCAGCCCTGGG - Intergenic
1182464383 22:30505488-30505510 CAGCCGGGTTGGGCAGTGCCAGG + Intronic
1182759274 22:32708905-32708927 CATCTGGGCTGTGCAGCCTGCGG - Intronic
1183179379 22:36248465-36248487 CATCTGGATTGGCCATTCCCGGG - Intergenic
1184506797 22:44908537-44908559 CATGTGGGATGGCCAGCCCAGGG - Intronic
1185175193 22:49322465-49322487 CTGCTGGGCAGGGCAGCCCCTGG - Intergenic
1185414982 22:50704927-50704949 CAGCTGGGTGGGGACGCCCCAGG - Intergenic
950424309 3:12916374-12916396 CTTGTGGTTAGGGCAGCCCCGGG - Intronic
951761108 3:26148340-26148362 GATCTGGGTGGGGCAGCCAGTGG + Intergenic
954333088 3:49901168-49901190 CATCTGGGTTGAGAGGCCCTAGG - Intronic
955516171 3:59728735-59728757 CATCTGAGTTGTTCAACCCCTGG + Intergenic
956688160 3:71851371-71851393 CATCTGGGTCTGGCATTCCCTGG + Intergenic
960055294 3:113272648-113272670 CAATGGGGTTGGGCAGCCCGGGG + Exonic
960604209 3:119488302-119488324 CATCTGAGTTTGACATCCCCAGG - Intronic
961498808 3:127315811-127315833 CCTCTAGGATGAGCAGCCCCTGG - Intergenic
961901173 3:130213340-130213362 CATGTGGGTAGAGCAGGCCCTGG + Intergenic
963728526 3:148948223-148948245 CATCTGGGGTGTGAAGCCCAAGG - Intergenic
967216470 3:187214892-187214914 TACCCAGGTTGGGCAGCCCCAGG - Intergenic
968046448 3:195626339-195626361 CACCAGGGTTGTGGAGCCCCTGG - Intergenic
968308205 3:197663752-197663774 CACCAGGGTTGTGGAGCCCCTGG + Intergenic
968560382 4:1277828-1277850 CACCTGGGGTGGGCAGTACCCGG + Intergenic
968760995 4:2442759-2442781 CAGCTGGGAGGAGCAGCCCCCGG - Intronic
969715746 4:8867423-8867445 ACTCTGGGCTGCGCAGCCCCCGG - Exonic
971732792 4:30407077-30407099 GATCTGGGCTGGGCAATCCCTGG - Intergenic
973780985 4:54287998-54288020 CACCTGGGTTGTTCAGCACCTGG - Intronic
974988588 4:69059034-69059056 CTCCTGGGTGTGGCAGCCCCTGG - Intronic
977573149 4:98650399-98650421 CAGCTGAGGAGGGCAGCCCCAGG + Intronic
979869230 4:125796395-125796417 CATCTGGTTTGGACACCCACAGG + Intergenic
982564701 4:156971987-156972009 CCTCTGGGAGGGGCAGCCCTGGG + Intergenic
986443624 5:7802063-7802085 CATCTGGATTGGGCCGCGGCTGG + Intronic
986690081 5:10307019-10307041 CATGTGGGTCGGGCAGGCCTTGG - Intronic
987022349 5:13887783-13887805 CATTTGGGTTGGGCGTCTCCTGG - Intronic
988737853 5:34040529-34040551 GATCTGGGGTGGGCAGACCTGGG - Intronic
989484605 5:41975222-41975244 CATCTGGCTTTGTCTGCCCCAGG + Intergenic
989952236 5:50313097-50313119 CATCTCTGTTTGGCAGCCCTCGG + Intergenic
990461808 5:56037672-56037694 CAGCTGCCTTGGGAAGCCCCTGG - Intergenic
991592537 5:68268680-68268702 TATTTGGCTTGGGCAGCCTCTGG + Intronic
992864852 5:80947889-80947911 CATGTGGGTTAGGCTGCCCCTGG + Intergenic
993313519 5:86369342-86369364 CATGTGGCTTGGGAAGCCTCGGG + Intergenic
995401450 5:111746965-111746987 CATGTGGGTTAGGCAGCACATGG - Intronic
997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG + Intronic
997627661 5:135341948-135341970 AAGCTGGGATGGGAAGCCCCAGG + Intronic
1000015662 5:157273442-157273464 CTCCAGGGTGGGGCAGCCCCAGG + Intronic
1001547488 5:172579626-172579648 CTTCTGGGTTGGGTGGCCCTTGG - Intergenic
1002454295 5:179337576-179337598 TCTCTGGCTTGGGCAGCCCTGGG - Intronic
1005352480 6:24949827-24949849 CACCTGGAAGGGGCAGCCCCTGG + Intronic
1005716125 6:28550087-28550109 CATAGGGGTGGGGCAGCCCAAGG + Intergenic
1006359712 6:33580318-33580340 GATCTGGGTGGGCCAGGCCCAGG + Intergenic
1006783802 6:36651147-36651169 ATTCTGGGCTGGGGAGCCCCGGG + Intergenic
1007756583 6:44103509-44103531 CATCTGGGATGGGGAGCCACTGG + Intergenic
1008555987 6:52673238-52673260 TCTCTGGGTTGGGCAGGCCTGGG - Intronic
1008871123 6:56272843-56272865 CATATGGCTTGGGGAGCCTCAGG - Intronic
1011552961 6:88546668-88546690 CATCTGCTCAGGGCAGCCCCGGG - Intergenic
1012909408 6:105102349-105102371 CAGCTGGGTTGGCCAGCACAGGG + Intronic
1018177339 6:161188778-161188800 CCTCTGGGTTGAGCAGCCAGCGG + Intronic
1018962931 6:168461107-168461129 CATGTGGGTGGGGAAGCCTCAGG + Intronic
1019153937 6:170026341-170026363 CAGGTGGGTAGGGCAGGCCCGGG + Intergenic
1019428654 7:988642-988664 CGTCTGTGTTGGGGAGCGCCTGG + Exonic
1020125163 7:5529502-5529524 TGGCTGGGTGGGGCAGCCCCGGG - Intronic
1020658900 7:10959617-10959639 CATGTGGGGTGGGCAGTTCCAGG + Intergenic
1023940816 7:44767521-44767543 CATCAGGGTTGGTCAGTTCCGGG - Exonic
1024499879 7:50093384-50093406 CAACTGTGCTGTGCAGCCCCCGG + Intronic
1025811791 7:64880381-64880403 CTCCTGGGGAGGGCAGCCCCAGG - Intronic
1025932084 7:66003566-66003588 CATCTAGTTGGGGGAGCCCCGGG + Intergenic
1026766234 7:73161677-73161699 TTTATGGGTTGGGCTGCCCCAGG + Intergenic
1026901287 7:74038828-74038850 CATCTGGGTTGTGAAACACCAGG + Intronic
1027042707 7:74971373-74971395 TTTATGGGTTGGGCTGCCCCAGG + Intronic
1027080935 7:75230984-75231006 TTTATGGGTTGGGCTGCCCCAGG - Intergenic
1029698300 7:102229120-102229142 CAGCTGGGGCGGGCAGCCCCTGG + Intronic
1032127192 7:129203619-129203641 TCTCTGGGTTGGGCAGGACCGGG + Intronic
1032266305 7:130372434-130372456 CATCTGAGGTGGGCAGTCCAGGG + Intergenic
1033209881 7:139452945-139452967 CATGTGGGCTGGCCAGCCCCTGG - Exonic
1033685721 7:143639748-143639770 CTTCTGGATAGGCCAGCCCCAGG + Intronic
1033690022 7:143727567-143727589 CTTCTGGATAGGCCAGCCCCAGG - Intronic
1033698893 7:143817873-143817895 CTTCTGGATAGGCCAGCCCCAGG - Intergenic
1034165571 7:149022667-149022689 CATCAGGGTTGGTGAGCCCCAGG - Intronic
1035710462 8:1709718-1709740 CTTCTGGGTTTGTCAGCCACGGG - Intergenic
1038004469 8:23418053-23418075 AAACTGGGTTGCGCAGCCACTGG + Intronic
1049221783 8:141431867-141431889 CACCTGGTTTGGGCAGCACAGGG - Exonic
1049574186 8:143382891-143382913 CCTCAGGGTGGGGCAGCCCCAGG - Exonic
1049787376 8:144457470-144457492 CTCCTGGGGTTGGCAGCCCCAGG - Intronic
1049962827 9:752974-752996 CATCTGTGTTGGAAAGCCACAGG + Intergenic
1051365186 9:16316839-16316861 CAGCAGTGATGGGCAGCCCCGGG - Intergenic
1056189990 9:84175685-84175707 CATCTGGGACTCGCAGCCCCAGG + Intergenic
1056563190 9:87750850-87750872 CATCTGGGCTGGCAAGCCACGGG - Intergenic
1057822436 9:98342789-98342811 CTACTGGGTAGGGCAGACCCTGG + Intronic
1058985798 9:110207604-110207626 CAGCTGGGTGGGGCAGGACCTGG + Exonic
1060883126 9:127132665-127132687 CAGCTGGGAAGGGCAGGCCCAGG - Intronic
1062277654 9:135738328-135738350 CAGCTGGGCTGAGCAGCCCCTGG + Intronic
1062444259 9:136587106-136587128 CATCTGGGTGGGTCGGCCCCGGG + Intergenic
1062544656 9:137056008-137056030 CCTCTGGGTGGGGCAGCTCTCGG + Intergenic
1185942663 X:4338927-4338949 CATTTGGGTTGGGAAGTCCAGGG - Intergenic
1185971505 X:4670644-4670666 CCTGGGGGTTGGGGAGCCCCAGG - Intergenic
1185971525 X:4670686-4670708 CCTGGGGGTTGGGGAGCCCCAGG + Intergenic
1190004582 X:46723253-46723275 TGTCTGGGTGGGGCAGCCCGTGG + Intronic
1193655392 X:84190617-84190639 CATCATGGCTGGGGAGCCCCAGG - Intergenic
1197050749 X:122056223-122056245 CATCTGGGTTAAGTAGCACCAGG - Intergenic
1198229559 X:134676233-134676255 CATCTGGCTGGGCCATCCCCTGG + Intronic
1200054735 X:153454344-153454366 CCTGTGCGTGGGGCAGCCCCAGG + Intronic
1200060533 X:153481844-153481866 ACTCCAGGTTGGGCAGCCCCAGG - Intronic