ID: 1151370510

View in Genome Browser
Species Human (GRCh38)
Location 17:73644082-73644104
Sequence CTCCAGGCTGGTCACCATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151370510_1151370525 25 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370525 17:73644130-73644152 TCCGCCCTGTTTTATAATCCTGG 0: 1
1: 0
2: 1
3: 2
4: 75
1151370510_1151370518 -9 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370518 17:73644096-73644118 AGCCTGGAGAGGGGTCCTCGGGG 0: 1
1: 0
2: 1
3: 17
4: 223
1151370510_1151370531 30 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370531 17:73644135-73644157 CCTGTTTTATAATCCTGGTGGGG 0: 1
1: 0
2: 4
3: 12
4: 135
1151370510_1151370517 -10 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370517 17:73644095-73644117 CAGCCTGGAGAGGGGTCCTCGGG 0: 1
1: 0
2: 2
3: 35
4: 345
1151370510_1151370529 29 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370529 17:73644134-73644156 CCCTGTTTTATAATCCTGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1151370510_1151370527 28 Left 1151370510 17:73644082-73644104 CCCACATGGTGACCAGCCTGGAG 0: 1
1: 0
2: 0
3: 22
4: 262
Right 1151370527 17:73644133-73644155 GCCCTGTTTTATAATCCTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151370510 Original CRISPR CTCCAGGCTGGTCACCATGT GGG (reversed) Exonic
900099258 1:954130-954152 CGCGAGGCTGCTCAGCATGTTGG + Intronic
900194976 1:1371493-1371515 CTGCAGGCTGGGCAGGATGTGGG + Intergenic
901037768 1:6346698-6346720 CTCCTGGCAGGTCACCCTGCTGG - Intronic
901235391 1:7664814-7664836 GTCCAGGCTGAGCTCCATGTTGG - Exonic
901289367 1:8111236-8111258 CTGCTGGCTGATCACCATGGTGG - Intergenic
901689671 1:10964485-10964507 CTCCAGGCTGGGGAGCATTTGGG + Intronic
902341204 1:15784762-15784784 TTGCAGGCTGGTCTCCATGGAGG - Intronic
904410653 1:30322842-30322864 CCCCAGTCTGGGCACCATGGAGG - Intergenic
904746439 1:32714152-32714174 GGCCAGGCTGGTCACTATATTGG + Intergenic
905269052 1:36774778-36774800 CTCCTGGCTGGGTAACATGTGGG - Intergenic
906058789 1:42935208-42935230 CTCCAGGGTGGTCTCCATGGTGG - Intronic
906507477 1:46390875-46390897 CACCAGGCTTGCCACCATCTTGG - Intergenic
907284542 1:53371315-53371337 CTCCAGGCTGATAACCGTGTGGG - Intergenic
909409037 1:75328022-75328044 CTCCAGGCTGGTTACATGGTAGG + Intronic
910440483 1:87246765-87246787 CGCCAGAGTGGTCACCATGGGGG - Intergenic
912421261 1:109543808-109543830 CTCCACGATGGTCACCAGCTCGG + Exonic
916641050 1:166729462-166729484 CTCCAGGCAGCTCTCCATGTTGG - Intergenic
919745360 1:201005293-201005315 CTGCAGGCTCCTCACCAGGTCGG + Exonic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
921586732 1:216955615-216955637 CTCCATGCTGTTCACCATAGTGG + Intronic
921757222 1:218872770-218872792 CTCCAGGATGTTCACCTTGAAGG - Intergenic
921828561 1:219701571-219701593 TTCCAGGCTGGTGAACATTTTGG + Intronic
922730145 1:227945394-227945416 CACCAGGCTGGACCCCCTGTGGG - Intronic
923335430 1:232965811-232965833 CTTCAGTCGGGTGACCATGTGGG + Intronic
923639347 1:235738263-235738285 CTCCAAGCTGGTCACTATCACGG + Intronic
924204430 1:241697252-241697274 CTCCAGGTTTTTCATCATGTAGG - Intronic
924499012 1:244618747-244618769 CTCCAGGCTGGGCAACAAGAGGG + Intronic
1064638518 10:17392549-17392571 ATCCAGGCTGCTCCCCATTTTGG - Intronic
1065939985 10:30555750-30555772 CTCCAGGGAGTTCACCATATTGG + Intergenic
1067295513 10:44973230-44973252 CCCCAGGCCGGGCACCCTGTGGG + Intronic
1068436592 10:57000402-57000424 CTTCAGGATGGTCAGCAGGTTGG - Intergenic
1070503002 10:77089183-77089205 CTTCTGACTTGTCACCATGTTGG - Intronic
1071347178 10:84703894-84703916 GTCAAGGCAGGTCACCATCTTGG + Intergenic
1071557046 10:86612391-86612413 CACGAGGCTTGCCACCATGTTGG + Intergenic
1071887667 10:89968505-89968527 CTCCAGCCTGGTTGACATGTGGG + Intergenic
1074997113 10:118767101-118767123 CTCCAGGCTGGGCAACAAGAGGG + Intergenic
1075081306 10:119385713-119385735 CTGCAGGAGGGTCACCTTGTGGG + Intronic
1076664674 10:132079492-132079514 CTCCTGGCTTGTTTCCATGTTGG - Intergenic
1077393238 11:2309336-2309358 CTCCAGGCAGGTCAGCATCCAGG - Intronic
1078118306 11:8479221-8479243 CCCCAGGTTGGTCAGGATGTTGG - Intronic
1078754600 11:14197106-14197128 CTCAGGGCTGGTCACAAAGTAGG + Intronic
1078798033 11:14613281-14613303 GTCCAGCCTGGGCACCATCTCGG - Intronic
1080426559 11:32160122-32160144 CTGCAGGATGGCCACCTTGTAGG - Intergenic
1080666390 11:34339949-34339971 AGGCAGGCTGGTCACCATGTGGG + Intronic
1080881432 11:36325051-36325073 CACGAGGCTTGCCACCATGTTGG - Intronic
1081834642 11:46143702-46143724 TTGCAGGCTGGTCCCCATGGAGG - Intergenic
1083585712 11:63857365-63857387 GGTCAGGCTGGTCTCCATGTTGG + Intronic
1083817445 11:65143465-65143487 GGCCAGGATGGTCACCATGTTGG + Intergenic
1087093402 11:94298309-94298331 CGCCAGGCTGCTCATCATCTCGG - Intergenic
1089526693 11:119101649-119101671 CCCCTGACCGGTCACCATGTGGG - Exonic
1090188998 11:124756314-124756336 CTCCAGGGTGTGCCCCATGTGGG - Exonic
1093537278 12:20237427-20237449 CTGCAGGCTCAACACCATGTAGG - Intergenic
1093860151 12:24155561-24155583 CTGCAGGAAGGCCACCATGTGGG - Intergenic
1094002204 12:25707400-25707422 CTGCAGGCTTAACACCATGTGGG - Intergenic
1094446299 12:30534159-30534181 CTGCAGGATGGCCACCTTGTAGG + Intergenic
1094476448 12:30844238-30844260 CTCCAGACTTGTGTCCATGTCGG + Intergenic
1096995033 12:55833108-55833130 CTGCGGCGTGGTCACCATGTTGG + Intergenic
1097641652 12:62190872-62190894 ATCCTGGCTGGTAACCATTTTGG - Intronic
1099282947 12:80675975-80675997 CTGCCTGCTGGGCACCATGTTGG - Intronic
1099495868 12:83345335-83345357 CTCCAAACTGTTCACCATGGTGG - Intergenic
1100548936 12:95628564-95628586 CTCCAGCCTGGGCAACAAGTGGG + Intergenic
1101769396 12:107735019-107735041 CTCCAGTCTGGGCAACATGGTGG - Intronic
1101849259 12:108389169-108389191 AGCCAGGCTGGGCCCCATGTAGG - Intergenic
1102067708 12:109991889-109991911 CATCAGGCTGGTCATCTTGTTGG + Intronic
1104471986 12:129036711-129036733 GGCCAGTCTGGTCTCCATGTTGG - Intergenic
1105014693 12:132779110-132779132 CTCCAGCCTGGGCAACAAGTGGG - Intronic
1105751325 13:23424491-23424513 CTCCAGCCTGGGCAACAAGTGGG + Intronic
1110197982 13:72812731-72812753 TTCCAGGCTGGACACAATCTTGG - Intronic
1110383726 13:74883693-74883715 CTCCAGCCTGGGCACCAAGAGGG + Intergenic
1117056028 14:51912678-51912700 ATCCAGGCTGGTAACCTTGTAGG - Intronic
1118318460 14:64739503-64739525 CTACAGCCTGGACCCCATGTTGG + Intronic
1119400102 14:74357428-74357450 CTCCACGCTGCACATCATGTGGG + Exonic
1119628105 14:76200390-76200412 CTGCAGTTTGGTGACCATGTAGG + Intronic
1121212072 14:92214620-92214642 CTTGAGGCTGGTGACCATGTTGG + Intergenic
1121932280 14:97983225-97983247 CTCCAGGCTGGTCTTGAAGTTGG + Intergenic
1122425107 14:101601272-101601294 CTCTAGGCAGGGCACCATGCGGG - Intergenic
1202890244 14_KI270722v1_random:149897-149919 CACCAGGCTGGACACAATCTTGG + Intergenic
1123688597 15:22818402-22818424 CTCCAGCCTGGGCACCAAGAGGG + Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123954986 15:25325860-25325882 CTCAAGGCTGGTCTCCCTGGTGG + Intergenic
1126151276 15:45525808-45525830 CACCAGCCTGGTCAACATGGTGG + Intergenic
1127682047 15:61306943-61306965 CTCCAGGTTGGCCATCATTTAGG - Intergenic
1128739627 15:70074553-70074575 CGCCAAGCAGGTCACCATGACGG - Exonic
1128805301 15:70526490-70526512 TTCCAGGCAGGTCCCCATCTGGG - Intergenic
1129458563 15:75688629-75688651 CTCCAGGGTGGCCTCCAGGTGGG + Exonic
1129725230 15:77898243-77898265 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130273279 15:82463449-82463471 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130465630 15:84190820-84190842 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130487061 15:84404000-84404022 CTCCAGGGTGGCCTCCAGGTGGG + Intergenic
1130498635 15:84482716-84482738 CTCCAGGGTGGCCTCCAGGTGGG + Intergenic
1130587920 15:85195415-85195437 CTCCAGGGTGGCCTCCAGGTGGG - Intergenic
1130924157 15:88372695-88372717 CTCCAGGCTGTTCCTAATGTTGG - Intergenic
1132876824 16:2143639-2143661 CTTCAGCCTGCTCACCATGGTGG - Intronic
1133072515 16:3255913-3255935 CTCAGTGCTGTTCACCATGTTGG - Intronic
1135767959 16:25194176-25194198 GCCAAGGCTGGCCACCATGTTGG - Intergenic
1136011905 16:27368885-27368907 CTCCAGCCTGGGCAACAAGTGGG + Intergenic
1136235829 16:28913114-28913136 CACCATGCTTGTCTCCATGTTGG + Intronic
1137298388 16:47120937-47120959 CTCCAGCCTTGTTACCATGTCGG - Intronic
1138570649 16:57869905-57869927 GACCAGCCTGGTCACCATGGTGG + Intergenic
1139482368 16:67237532-67237554 CTCCAGGATGGACACCAGATTGG + Exonic
1139558483 16:67727522-67727544 TTCCAGGCTGGGCATCATGCAGG - Intronic
1141392763 16:83678365-83678387 CTCCTGCCTGGTCACCATCATGG - Exonic
1141875774 16:86823237-86823259 CTCCATGCTGGGGACCGTGTGGG - Intergenic
1142153647 16:88523551-88523573 CTCCAGGCTGGGGACCCTGGTGG + Intronic
1142825818 17:2509703-2509725 GGCCAGGATGGTCTCCATGTTGG - Intronic
1143448017 17:7020056-7020078 CCCCTGGCTGGTCACCGTGGTGG + Intergenic
1144330229 17:14216679-14216701 CTCCAGGCCAGTCACCCTGCAGG + Intergenic
1144359850 17:14481635-14481657 CTCCATTCTGGGCACCTTGTGGG + Intergenic
1145014659 17:19388270-19388292 CTCCAGACTTTTCACCATGGAGG + Intergenic
1146062068 17:29612877-29612899 CTCCCCGCAGGTCACCATCTGGG + Exonic
1146312532 17:31780208-31780230 CTCCAGGGTGGCCACCCTGATGG - Intergenic
1149693786 17:58600335-58600357 CACCATGTTGGTCACCATGTTGG - Intronic
1149693788 17:58600347-58600369 GGCCATGGTGGTCACCATGTTGG - Intronic
1150769125 17:68026395-68026417 GACCAGGCTGGTCAACATGGTGG - Intergenic
1151370510 17:73644082-73644104 CTCCAGGCTGGTCACCATGTGGG - Exonic
1151484426 17:74389587-74389609 CTCTGGGCTGGGCACCATCTGGG + Intergenic
1152243873 17:79175323-79175345 CACCAGGCTGGTCACCAGAAGGG + Intronic
1152780067 17:82223373-82223395 GGCCAGGCTGGTCACCCTATTGG + Intergenic
1152789174 17:82269424-82269446 CTCATGGCTGGTCAGCATCTTGG + Intronic
1154291208 18:13108971-13108993 CTCCAAACTGGTCTCCATGGTGG - Intronic
1155166600 18:23237238-23237260 TTCCACGCTACTCACCATGTAGG - Exonic
1155176101 18:23302621-23302643 CTCCAGGGAGATCACCATGTAGG - Intronic
1157275645 18:46309556-46309578 GGCCAGGCTGGTCTCCATGTTGG + Intergenic
1157621813 18:49021225-49021247 CTCCAGTGTGGTGACCATGCCGG - Intergenic
1158422424 18:57307075-57307097 CTCAAGGCTGGTCCTCATGAAGG + Intergenic
1159893905 18:73978835-73978857 CTGCCTGCTGGTCACCATGCAGG - Intergenic
1160539646 18:79613562-79613584 CTCCAAGCTTGTCACCCAGTAGG - Intergenic
1161191660 19:2960729-2960751 GGCCAGGCTGATCACCATGTTGG + Intergenic
1161554158 19:4931028-4931050 CCCCAGGCTAGTCCCCAAGTGGG - Intronic
1161970534 19:7577251-7577273 CACCACGTTGGCCACCATGTTGG - Intergenic
1165534118 19:36428930-36428952 CTCCAGCCTGGGCAACATGAGGG + Intergenic
1167206627 19:48106874-48106896 CTCCAGCCTGGTCAACAAGAGGG - Intronic
1167358163 19:49016532-49016554 CCCCAGGCAGCTCACCATGGTGG + Exonic
1202665664 1_KI270708v1_random:116725-116747 CACCAGGCTGGACACAATCTTGG + Intergenic
925380636 2:3423085-3423107 CTCTAGGGAGGTCACCATATTGG - Intronic
926643487 2:15263278-15263300 CTCCAGGGTTTTCACCACGTTGG + Intronic
926730526 2:16032729-16032751 ATCCAGGCTGGACCCCAAGTAGG + Intergenic
928210477 2:29320092-29320114 CACCAGGCTGGGCAGGATGTGGG - Intronic
928243895 2:29610613-29610635 CTCCAGTTTGGTCAGCAAGTTGG + Intronic
928369919 2:30733219-30733241 CACCAGGCTTGTCCCCATGATGG - Intronic
931365384 2:61614621-61614643 GGCCAGCCTGGTCAACATGTTGG - Intergenic
932116578 2:69055426-69055448 CTCCATGTTGGTCACAATGATGG + Intronic
933805295 2:85994719-85994741 CTTCATGTTGGTCACCATGGTGG - Intergenic
933885487 2:86716487-86716509 CTCCAGGCTGAACAGCATGTGGG + Intronic
933924690 2:87080204-87080226 CTCCAGGCTGAACAGCATGTGGG - Intergenic
935987565 2:108689429-108689451 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936126392 2:109792130-109792152 CTCCTGGCTGGACTCCATGCAGG - Intergenic
936218301 2:110579338-110579360 CTCCTGGCTGGACTCCATGCAGG + Intergenic
936778585 2:116004037-116004059 CACCAGCCTATTCACCATGTGGG - Intergenic
937288734 2:120769162-120769184 CACCAGGCTGGGCACCAAGTGGG - Intronic
937905280 2:127050007-127050029 CTGCAGGGTGGGCACCTTGTGGG + Intronic
938801207 2:134765053-134765075 CTGCAGGCTGGCCATCCTGTGGG - Intergenic
938902389 2:135809071-135809093 ACCCAGGCTGGGCACCATATAGG - Exonic
940105651 2:150096863-150096885 GTCCAGGATGGTCTCCATGCTGG - Intergenic
940288252 2:152053376-152053398 CTCCAGGCGTGTCACCCTCTAGG - Intronic
941171558 2:162143941-162143963 CTGCAAGCTGTTCCCCATGTAGG - Intronic
941812851 2:169771262-169771284 CTCATGGCTAGTCACCATTTTGG + Intronic
947197105 2:227579162-227579184 CTCCAGGCTGGTCACAGGATGGG + Intergenic
947617907 2:231570066-231570088 CTCCAGGCTGGTCTGCACCTGGG + Intergenic
947921712 2:233881161-233881183 CTCCAGCCTGGTCAACAAGAGGG - Intergenic
948732629 2:239976691-239976713 CTCAAGGCTGTTCAGCCTGTCGG - Intronic
1169562949 20:6821682-6821704 CTGCAGGCTGGTCATCACCTGGG + Intergenic
1170240932 20:14165214-14165236 CTCCAGGCAGCTCTCTATGTTGG + Intronic
1172128285 20:32638542-32638564 TTCCAGGGTGGCCACCAAGTGGG - Intergenic
1172433927 20:34914921-34914943 CTCCAGGCTGAGCAGCATGAGGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175225752 20:57442885-57442907 CTCCTGGCTGCTCCCCAGGTTGG - Intergenic
1175775014 20:61647645-61647667 CACCAGGCTGATCCCCATCTGGG + Intronic
1175829405 20:61953766-61953788 GTCCTGGATGGTCACCATGCAGG - Intronic
1175862018 20:62155638-62155660 CTCCAGGCTGGTCACTTTCCTGG + Intronic
1176183612 20:63766002-63766024 CTCCAGGGTGGGCAGCAGGTGGG - Intronic
1178523339 21:33304089-33304111 CTACTGGCTGGTCACCAAGCTGG - Intergenic
1178887302 21:36494201-36494223 CTGCACACTGGTCGCCATGTAGG + Intronic
1180332378 22:11493650-11493672 CACCAGGCTGGACACAATCTTGG + Intergenic
1180788513 22:18560279-18560301 CTCCAGCGTGGTCACCATTCTGG - Intergenic
1181040914 22:20192279-20192301 CTGAAGGCTGGTCACCAGGAAGG - Intergenic
1181233224 22:21435039-21435061 CTCCAGCGTGGTCACCATTCTGG + Intronic
1181245426 22:21499804-21499826 CTCCAGCGTGGTCACCATTCTGG - Intergenic
1181776713 22:25165511-25165533 CTCCATGCTGTTCAGCATGGTGG + Intronic
1181805174 22:25370250-25370272 CACCATGTTGGCCACCATGTTGG + Intronic
1182292568 22:29292794-29292816 CTCCAGCCTGGGCACCAAGAAGG - Intronic
1182493015 22:30686302-30686324 GGCCAGGCTGTTTACCATGTTGG + Intergenic
1184602339 22:45551079-45551101 GTCCAGCCTGGTGACCGTGTGGG + Intronic
949307899 3:2663534-2663556 CTTGAGGGTGGTCAGCATGTAGG + Intronic
950887230 3:16372982-16373004 CTCTTGGCTGGTTTCCATGTGGG - Intronic
951837694 3:27001446-27001468 CACAAGGCTTGCCACCATGTTGG + Intergenic
952834641 3:37592566-37592588 GTCCAGGCTGGGCACCACCTTGG + Intronic
953520143 3:43634675-43634697 TTCCAGGATGGTCACCAGATGGG - Intronic
953630412 3:44611040-44611062 CTCAAGGTTGGTCAGCATCTGGG + Intronic
954670126 3:52286438-52286460 CTGCAGCCTGGGCACGATGTCGG - Intronic
957090244 3:75722761-75722783 CACCAGGCTGGACACAATCTTGG - Intronic
962462438 3:135626996-135627018 CTCCAGGCAGGTGACCTTGCTGG - Intergenic
962579156 3:136782139-136782161 CTCCAGCCTGGGCAACATGGAGG - Intergenic
963492325 3:146017047-146017069 CACGAGGCTTGTCACCATCTTGG + Intergenic
966189138 3:177255955-177255977 CTCCAGCCTGGGCACCAAGAGGG - Intergenic
968163783 3:196448095-196448117 CTCCAGCCTGGTCAACAAGAGGG + Intergenic
968227739 3:196985729-196985751 CTCCAGGCTGGTCCCAAGGCTGG + Intergenic
969625765 4:8304685-8304707 CTCCAGGCTGGGCAACAAGAGGG - Intronic
969913905 4:10471462-10471484 CTCCATGCTGATCAACATGATGG + Intergenic
970156260 4:13144618-13144640 CTCCAGCCTGGGCAACATGAGGG - Intergenic
971316540 4:25572614-25572636 CTCCAGCCTGGACAACATCTCGG + Intergenic
971992128 4:33912457-33912479 CTCCAATCTGGTCACCATGACGG + Intergenic
972374403 4:38457034-38457056 CACCAGGCTGCCCACCAAGTGGG + Intergenic
977817287 4:101429608-101429630 CTGCAGGATGGCCACCTTGTAGG - Intronic
980549592 4:134317088-134317110 CTGCTGGCTAATCACCATGTTGG + Intergenic
984642012 4:182177108-182177130 CTCCGTGCGGGTCCCCATGTGGG - Intronic
985629356 5:1006758-1006780 CTCCAGCTTGGGCACCCTGTAGG + Intergenic
985746079 5:1648540-1648562 GACCAGGCTGGTCAACATGGTGG + Intergenic
987502652 5:18733250-18733272 CACCAGGCTAGCCACCATCTTGG - Intergenic
988699841 5:33662559-33662581 CTCCAGGCTGCTGACCAGTTAGG + Intronic
988986551 5:36624932-36624954 CTCCAGGGCGTTCACCATGTAGG + Intronic
991398659 5:66231147-66231169 TTCAAGGCTTGTTACCATGTAGG - Intergenic
991958516 5:72019263-72019285 CTGCAGGCAGGTCAACATGGTGG - Intergenic
996086085 5:119306490-119306512 CTCCTGGGAGGTCACCATATTGG + Intronic
999327872 5:150654596-150654618 CTCCAAGCTGTTCACCATCTTGG + Intronic
999847797 5:155504751-155504773 CTCCAGGCTGGTCACACACTGGG - Intergenic
1001492392 5:172165012-172165034 CTCCAGGCTGGGCCCCTTGCGGG - Intronic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1003312060 6:4977939-4977961 CTCTAGCCTGGACACCATGCAGG - Intergenic
1003524458 6:6886286-6886308 CTCCAGGCTGGCCAGCAAGCAGG + Intergenic
1004406287 6:15336756-15336778 CCCCAGGCTGGTCTCCATCTGGG + Intronic
1006037331 6:31223893-31223915 CTCCAGCCTGGTCAACAAGAGGG - Intergenic
1006804088 6:36777309-36777331 CTCCCACCTGTTCACCATGTCGG + Intronic
1007417549 6:41700845-41700867 CTCCTGGCTGGTCAGACTGTTGG + Intronic
1007624692 6:43238025-43238047 CTGCAGCCTGGTAACCTTGTAGG - Intergenic
1008615338 6:53220716-53220738 CTCCAGGATTGTCACCATGAGGG + Intergenic
1015262941 6:131259353-131259375 TTCCAGGCTCGTCACCATCCTGG - Intronic
1016897097 6:149064171-149064193 CACAAGGCTTGTCACCATGGGGG - Intronic
1016963949 6:149700813-149700835 CTCCAGCCTGGTCAACAAGAGGG - Intronic
1017307422 6:152935469-152935491 CTCCAGCCTGGTGACAAAGTGGG - Intergenic
1017994436 6:159520316-159520338 GTCCAGGCTGTTCTCCATGCAGG - Intergenic
1018703995 6:166450094-166450116 CTCCATGTTGGTCCCCATGGTGG - Intronic
1019507428 7:1399325-1399347 CTCCAGGCTGGGCAGGAGGTTGG - Intergenic
1019514108 7:1432291-1432313 CTCCAGGCTGGGCACACAGTTGG - Intronic
1021670583 7:23031579-23031601 CTCCAGCCTGGTCAACAAGAAGG - Intergenic
1022117706 7:27276775-27276797 CACGAGGCTTGTCACCATCTTGG + Intergenic
1022593512 7:31689126-31689148 CTCCAGGCTTGTCACAAGGGTGG + Intronic
1022856031 7:34315561-34315583 CTCCAGGCTGGTCACTGGATTGG - Intergenic
1023479115 7:40613815-40613837 GGTCAGGCTGGTCTCCATGTTGG + Intronic
1023865969 7:44238611-44238633 GGCCAGGCTGCTCACCCTGTGGG + Intronic
1026049284 7:66931501-66931523 CTCCAGCCTGGCCAACATGGTGG - Intronic
1026866131 7:73825139-73825161 CCCCAGGTTGGGCACCACGTGGG - Intronic
1027555188 7:79655551-79655573 ATCCAGGCTGATCACCAGCTAGG + Intergenic
1029137366 7:98383313-98383335 CTCCAGCCTGGTCAACAAGAAGG - Intronic
1029641052 7:101819402-101819424 GGGAAGGCTGGTCACCATGTGGG - Intronic
1030221274 7:107101723-107101745 CACCAGGTTGGTCAGCATGGTGG - Intronic
1030477684 7:110058493-110058515 ATGCAGTCTGGTCAGCATGTTGG - Intergenic
1030648219 7:112088168-112088190 CTTCAGGCAGGTCACACTGTTGG + Intronic
1032129902 7:129219408-129219430 GTCCAGGCTGGTCTCCAACTTGG + Intergenic
1033280616 7:140003895-140003917 CTCCTGGCAGGTAACCCTGTGGG - Intronic
1033440289 7:141372340-141372362 CTCCAGGCTGTTCATCATGCAGG + Intronic
1035029951 7:155850286-155850308 CTCCAAGCTGCTCCCCATGGGGG + Intergenic
1035381391 7:158443582-158443604 CTCCACGCTGCTCCCCCTGTTGG - Intronic
1035864622 8:3069245-3069267 CGACAGGGTGTTCACCATGTTGG - Intronic
1037975627 8:23209143-23209165 CTGCAGGCTTAACACCATGTGGG - Intronic
1038985445 8:32804038-32804060 CTCCAGCCTGGTAACAAAGTAGG + Intergenic
1044688496 8:94852784-94852806 CTCCATGTTGTTCTCCATGTTGG + Intronic
1045656405 8:104391723-104391745 CTCCAGCCTGGGCAACAGGTTGG - Intronic
1049096636 8:140552047-140552069 CTCCAGGCTGCTCATGAGGTTGG - Intronic
1055591275 9:77817108-77817130 CTCCAGGCTGGTAAGATTGTGGG - Intronic
1056441680 9:86628156-86628178 CACGGGGTTGGTCACCATGTTGG - Intergenic
1057704644 9:97388213-97388235 CTCCAGGGTGGCCACCCTGAAGG + Intergenic
1058057467 9:100463539-100463561 CTCCAGGCTGGGCAACAAGAGGG - Intronic
1058607731 9:106741706-106741728 CTCCAGGGAGCTCACCATCTAGG - Intergenic
1059628308 9:116091610-116091632 CTGCAGGCTCAGCACCATGTGGG - Intergenic
1060135237 9:121147288-121147310 CTCCAGGCTGGGCACGGTGATGG - Intronic
1061277771 9:129579302-129579324 CTCCGGGCTAGGCCCCATGTTGG + Intergenic
1185696845 X:2201344-2201366 ATTCAGGATGTTCACCATGTTGG + Intergenic
1186697967 X:12057695-12057717 CCCCAGGCTCGTCACCCTCTTGG - Intergenic
1187675898 X:21716315-21716337 CTCCAGGCTGGTTCCAAGGTGGG + Intronic
1187835765 X:23430451-23430473 CTGCAGGCCTGCCACCATGTAGG + Intergenic
1187953758 X:24495670-24495692 CTCCAGGTTGGTGAACATATGGG - Intronic
1189133593 X:38526138-38526160 CTCCACGCTGCTTTCCATGTAGG + Intronic
1189576520 X:42359466-42359488 CACTAGGTAGGTCACCATGTTGG - Intergenic
1190453471 X:50603406-50603428 CTCAACAGTGGTCACCATGTTGG + Intronic
1190819626 X:53961357-53961379 CTCCAGCCTGGGCAACAAGTGGG - Intronic
1193440129 X:81530624-81530646 CTCCAGTCTGGTCAACAAGAGGG - Intergenic
1194521651 X:94926251-94926273 CTCCAGACTGGTCTTCATGGTGG - Intergenic
1194546020 X:95235025-95235047 CTCCAGCCTGGTCAACAAGAGGG - Intergenic
1195057915 X:101164527-101164549 GTCCAGCCTGGTCAACATGACGG - Intergenic
1195499350 X:105576542-105576564 CCCCATACTGGTCACCTTGTGGG + Intronic
1198593414 X:138209853-138209875 CACCATATTGGTCACCATGTTGG + Intergenic
1200843076 Y:7803625-7803647 CTCCAGGGTTGTCAACATGTGGG - Intergenic
1200942190 Y:8796101-8796123 TTCCAGACTGGTGCCCATGTAGG + Intergenic
1201733013 Y:17225970-17225992 CTGAAGACTGGTCACCATATTGG + Intergenic