ID: 1151370834

View in Genome Browser
Species Human (GRCh38)
Location 17:73645206-73645228
Sequence CCGCAGCTCCGGCTCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151370834_1151370841 -7 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370841 17:73645222-73645244 GCTGCGGGGGCAGCGTGAGCCGG No data
1151370834_1151370852 29 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370852 17:73645258-73645280 GGAGGCGGAGACGCGGAGAGGGG No data
1151370834_1151370850 27 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370850 17:73645256-73645278 GCGGAGGCGGAGACGCGGAGAGG No data
1151370834_1151370849 22 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370849 17:73645251-73645273 GCGCGGCGGAGGCGGAGACGCGG No data
1151370834_1151370843 -5 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370843 17:73645224-73645246 TGCGGGGGCAGCGTGAGCCGGGG No data
1151370834_1151370842 -6 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370842 17:73645223-73645245 CTGCGGGGGCAGCGTGAGCCGGG No data
1151370834_1151370846 11 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370846 17:73645240-73645262 GCCGGGGACGAGCGCGGCGGAGG No data
1151370834_1151370853 30 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370853 17:73645259-73645281 GAGGCGGAGACGCGGAGAGGGGG No data
1151370834_1151370845 8 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370845 17:73645237-73645259 TGAGCCGGGGACGAGCGCGGCGG No data
1151370834_1151370851 28 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370851 17:73645257-73645279 CGGAGGCGGAGACGCGGAGAGGG No data
1151370834_1151370848 14 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370848 17:73645243-73645265 GGGGACGAGCGCGGCGGAGGCGG No data
1151370834_1151370844 5 Left 1151370834 17:73645206-73645228 CCTGCGCCGAGCCGGAGCTGCGG No data
Right 1151370844 17:73645234-73645256 GCGTGAGCCGGGGACGAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151370834 Original CRISPR CCGCAGCTCCGGCTCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr