ID: 1151372801

View in Genome Browser
Species Human (GRCh38)
Location 17:73659550-73659572
Sequence TGGCCTCAGCTGGAGATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151372793_1151372801 10 Left 1151372793 17:73659517-73659539 CCTTCCTCAGAGAATTGCCCATG No data
Right 1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG No data
1151372792_1151372801 11 Left 1151372792 17:73659516-73659538 CCCTTCCTCAGAGAATTGCCCAT No data
Right 1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG No data
1151372798_1151372801 -8 Left 1151372798 17:73659535-73659557 CCATGGCCACTAGAGTGGCCTCA No data
Right 1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG No data
1151372795_1151372801 6 Left 1151372795 17:73659521-73659543 CCTCAGAGAATTGCCCATGGCCA No data
Right 1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG No data
1151372797_1151372801 -7 Left 1151372797 17:73659534-73659556 CCCATGGCCACTAGAGTGGCCTC No data
Right 1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151372801 Original CRISPR TGGCCTCAGCTGGAGATGTC TGG Intergenic
No off target data available for this crispr